Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Oct 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 286.0    0Xt7.1-TTbA012d03.3.5                      241 PI      78       1632     2042                XB-cadherin [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012071192 Xt7.1-TTpA066k09.3.5 - 118 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TTpA066k09.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATACCCCTCCAGAAGGAGTGTTCACTATTGGACGGGAGGATGGATGGCTAAATGTGACACGACCTTTGGACAGAGAAGCCATTGATAGTTACACTCTTTTTTCTCATGCTGTGTCAGTAAATGGGCAAAATGTGGAAGATCCCATGGAAATCCAAATTAAAGTACAAGATCAGAATGATAATGACCCAGTTTTCACACAGGAGGTCTTTGAAGGCTATGTGCCTGAAGGGTCTAAGCCAGGTACGCCCGTCATGACTGTATCTGCAACAGATGCCGATGATGCTATAGACATGTACAATGGTGTGATTACTTACTCCATTCTCAACCAAGACCCTAAAGAGCCCAACAATCAAATGTTCACTATTGATTCCCAGTCTGGGTTGATCAGCGTAGTTACAACTGGATTAGACAGAGAGAAAATACCAGTGTATACACTGACCATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCAAAAGCTGTGATCATTGTGACAGACACCAATGATAACCCTCCTGTGTTTAACCCAACGCAATACATTGCAGAGGTTCCTGAAAATGAAGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGCAGATATTGAAGGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCCACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAACAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222806                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCAGAAGGAGTGTTCACTATTGGACGGGAGGATGGATGGCTAAATGTGACACGACCTTTGGACAGAGAAGCCATTGATAGTTACACTCTTTTTTCTCATGCTGTGTCAGTAAATGGGCAAAATGTGGAAGATCCCATGGAAATCCAAATTAAAGTACAAGATCAGAATGATAATGACCCAGTTTTCACACAGGAGGTCTTTGAAGGCTATGTGCCTGAAGGGTCTAAGCCAGGTACGCCCGTCATGACTGTATCTGCAACAGATGCCGATGATGCTATAGACATGTACAATGGTGTGATTACTTACTCCATTCTCAACCAAGACCCTAAAGAGCCCAACAATCAAATGTTCACTATTGATTCCCAGTCTGGGTTGATCAGCGTAGTTACAACTGGATTAGACAGAGAGAAAATACCAGTGTATACACTGACCATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCAAAAGCTGTGATCATTGTGACAGACACCAATGATAACCCTCCTGTGTTTAACCCAACGCAATACATTGCAGAGGTTCCTGAAAATGAAGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGCAGATATTGAAGGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCCACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     8     3     9     3     9     4     9     4     9     4     9     4     9     4     8     6     8     6     8     6     8     8     9     8     9    10    10    10    10    10    10     9     9     9     9     8     9     8    10     8    10     8    10     7     8     7     8     7     8     7     8     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     8     8     9     8     8     8     8     9     9     9     9     9     9     9     9     9    10     9    11     9    11    10    12    10    12    10    12    10    12    10    12    10    12    11    13    11    13    11    13    11    13    11    13    12    14    12    14    12    14    12    14    11    14    13    16    12    16    12    16    12    16    13    17    13    17    13    17    13    17    13    17    15    18    14    17    15    18    14    17    14    17    15    18    14    18    15    19    15    19    15    19    15    18    15    18    14    16    13    16    12    16    12    16    11    16    11    16    11    16    10    17    11    17    11    17    11    16    11    16    14    16    15    16    13    16    13    17    14    18    13    17    15    18    15    19    17    19    16    19    15    18    15    18    16    19    16    19    16    18    16    18    17    19    17    19    18    20    18    20    17    19    16    19    16    17    17    18    18    19    19    21    19    21    20    22    20    22    20    22    22    25    22    25    22    25    23    25    23    25    23    25    23    25    23    25    23    24    24    25    25    26    25    27    25    27    25    27    25    27    25    27    25    28    25    28    25    28    25    28    25    28    25    27    26    27    26    28    27    28    27    28    28    29    30    31    31    35    35    38    36    40    35    39    37    41    40    44    41    45    41    47    43    49    51    58    51    58    53    60    51    60    54    63    56    67    55    66    54    65    54    66    53    64    51    63    52    66    52    65    51    66    52    67    53    68    55    69    54    68    53    67    54    67    54    67    54    67    53    67    55    69    55    70    56    70    67    70    66    69    67    70    67    70    65    67    66    67    65    66    64    66    64    66    61    65    63    65    60    63    56    63    55    63    56    63    54    62    55    62    55    62    55    62    54    62    53    62    53    61    51    60    51    60    51    59    50    57    46    57    46    57    44    57    45    57    45    56    45    54    44    54    43    53    43    51    38    50    12    19     7     8
  5   1   2  SIG                                    Xt7.1-TTpA066k09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATTTCCCAAACGGCTTGTGCAGATCAAGTCCAGTAATGCAAAGGAAATCAAGGTTTTTTACAGTATCACAGGCCAGGGTGCCGATACCCCTCCAGAAGGAGTGTTCACTATTGGACGG------------GCTAAATGTGACACGACCTTTGGACAGAGAAGCCATTGATAGTTACACTCCTTTTTTCTCATGCTGTGTCAGTAAATGGGCAAAATGTGGAAGATCCCATGGAAATCCAAATTAAAGTACAAGATCAGAATGATAATGACCCAGTTTTCACACAGGAGGTCTTTGAAGGCTATGTGCCTGAAGGGTCTAAGCCAGGTACGCCCGTCATGACTGTATCTGCAACAGATGCCGATGATGCTATAGACATGTACAATGGTGTGATTACTTACTCCATTCTCAACCAAGACCCTAAAGAGCCCAACAATCAAATGTTCACTATTGATTCCCAGTCTGGGTTGATCAGCGTAGTTACAACTGGATTAGACAGAGAGAAAATACCAGTGTATACACTGACCATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCAAAAGCTGTGATCATTGTGACAGACACCAATGATAACCCTCCTGTGTTTAACCCAACGCAATACATTGCAGAGGTTCCTGAAAATGAAGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGCAGATATTGAAGGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCCACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABG8589.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAGGCTCCAATTGCCTTTGAATTATTGAGACACATAGTCACCTGGATGGCAAATGGGACAAAGGAGCACACAATAGATTTACATTGTAAACCACTGTGTATACACAACTCAGATTCACTCACCTCAGCTAAAGATGAAAAGATTATAAAGAAATTGCAATTAGTACAAGATGGTGATCACATGATTTCATCATCATGGTCAAATCTAATACAGATTGCCAGATTTCATTGATTCCTGTGAAAATCACATTGATTTTTAAAAAAAAAAAAAAACTCCAAATACAATATAACAAATTGATATTTGAAACATAAATGTCTGCTGAATTTTAGTTCAATTGCTAGCTCACCCTAAAATTGAACTTTTAGTGTTACATAGACAGTGAAATTATCTTCATTTTTATTTTTTGTGGTTTTTGAAGTATTTACATTTTTACCGCAGCATTCCAGTTTGGAATAGCATCCATTATTGGTTGCTGGAATTCTGTTTAACTTGACAGCCTGGCATTGGTTTAAAGGACAGACTGGAAAATAAAGAGAAGAATATTTGTTTTTTTCTTGTTGCTGAATCTGCTGACACAACCATTTTGTTTACTTATAGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTATTGGTTGCTGGAATTCTGTTTAACTTGACAGCCTGGCATTGGTTTAAAGGACAGACTGGAAAATAAAGAGAAGAATATTTGTTTTTTTCTTGTTGCTGAATCTGCTGACACAACCATTTTGTTTACTTA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TA----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----T------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------A-
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bb ---- 2e-023     BAD12592.1 Bb2-cadherin [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 2e-031     NP_506256.2 F15B9.7 [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 5e-040     XP_001187261.1 PREDICTED: similar to FAT tumor suppressor 1 precursor [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-046     NP_649171.2 CG7749-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Cs ---- 4e-082     BAB68345.1 type II cadherin [Ciona savignyi] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ---- 1e-092     BAA92182.1 cadherin [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 2e-170     AAI21646.1 LOC779546 protein [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dr ---- 0          NP_571895.1 cadherin 1, epithelial [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Mm ---- 0          NP_033994.1 cadherin 1 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 0          NP_004351.1 cadherin 1, type 1 preproprotein; cadherin 1, E-cadherin (epithelial);uvomorulin; calcium-dependent adhesion protein, epithelial; cell-CAM 120/80;Arc-1 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- ?? ---- 0          NP_001089045.1 XB-cadherin [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Gg ---- 0          NP_001034347.1 cadherin 1, type 1, E-cadherin (epithelial) [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xl ---- 0          AAA93116.1 E-cadherin [Xenopus laevis]  -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TTpA066k09.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------TAG------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------TGA------------------------------------------------------------------------------------------ATG---------------------------------TGATGA---------------TGA---------------TAG------TAA------ATG------------------------TGA---------------------------ATG------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2  SIG                                    Xt7.1-TTpA066k09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATTTCCCAAACGGCTTGTGCAGATCAAGTCCAGTAATGCAAAGGAAATCAAGGTTTTTTACAGTATCACAGGCCAGGGTGCCGATACCCCTCCAGAAGGAGTGTTCACTATTGGACGG------------GCTAAATGTGACACGACCTTTGGACAGAGAAGCCATTGATAGTTACACTCCTTTTTTCTCATGCTGTGTCAGTAAATGGGCAAAATGTGGAAGATCCCATGGAAATCCAAATTAAAGTACAAGATCAGAATGATAATGACCCAGTTTTCACACAGGAGGTCTTTGAAGGCTATGTGCCTGAAGGGTCTAAGCCAGGTACGCCCGTCATGACTGTATCTGCAACAGATGCCGATGATGCTATAGACATGTACAATGGTGTGATTACTTACTCCATTCTCAACCAAGACCCTAAAGAGCCCAACAATCAAATGTTCACTATTGATTCCCAGTCTGGGTTGATCAGCGTAGTTACAACTGGATTAGACAGAGAGAAAATACCAGTGTATACACTGACCATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCAAAAGCTGTGATCATTGTGACAGACACCAATGATAACCCTCCTGTGTTTAACCCAACGCAATACATTGCAGAGGTTCCTGAAAATGAAGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGCAGATATTGAAGGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCCACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008276876                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCAAACGGCTTGTGCAGATCAAGTCCAGTAATGCAAAGGAAATCAAGGTTTTTTACAGTATCACAGGCCAGGGTGCCGATACCCCTCCAGAAGGAGTGTTCACTATTGGACGGGAAGAAATGGATGxxxAATGTGACACGACCTTTGGACAGAGAAGCCATTGATAGTTACACTCCTTTTTTCTCATGCTGTGTCAGTAAATGGGCAAAATGTGGAAGATCCCATGGAAATCCAAATTAAAGTACAAGATCAGAATGATAATGACCCAGTTTTCACACAGGAGGTCTTTGAAGGCTATGTGCCTGAAGGGTCTAAGCCAGGTACGCCCGTCATGACTGTATCTGCAACAGATGCCGATGATGCTATAGACATGTACAATGGTGTGATTACTTACTCCATTCTCAACCAAGACCCTAAAGAGCCCAACAATCAAATGTTCACTATTGATTCCCAGTCTGGGTTGATCAGCGTAGTTACAACTGGATTAGACAGAGAGAAAATACCAGTGTATACACTGACCATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCAAAAGCTGTGATCATTGTGACAGACACCAATGATAACCCTCCTGTGTTTAACCCAACGCAATACATTGCAGAGGTTCCTGAAAATGAAGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGCAGATATTGAAGGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCCACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTCGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAAAAAAAAAAAAAAAAAAA
  0   1   1           Ski1 FLt5                        CABJ6698.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTCGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGGATCTTTATCTGCTTAATTATAAATATAAAATGCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATATAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCGAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTAATATACAACAAAAAAAAAAAAAAAAAA
  5   1   1           HdA  FLt5                   THdA025n18.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCGGGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTCGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGGATCTTTATCTGCTTAATTATAAATATAAAATGCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATATAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCGAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTAATATACAAAAAAAAAAAAAAAAAA
  5   1   0       add Neu  5g                        TNeu021m08.p1kSP6                                                                                                                                                                                                                                                                                                                                         CGGCTCAGAGCAGGGAAGTACAGCGCTGCGCTACAAGAACTGAGCAAACGAGCAGAAAAGTACACATTCCTGATCCTTCGGTCTTTCCAAAAGTCCCCAATGGGGTCACACAGGCCATGGTTACTTGGTGCTGTGGTGCTGCTGGCACTCCTTCAGGTACAGGGAGGACTGGCAGAATGGACACAGTGTCAAATGGGATTTTCCAAGGAAAGGTACAGCTTTTCGGTACCTAAGAACTTGGAGACAGACAAAGCACTGGGTAGAGTGATCTTTAACAGCTGTGAGGGACCAGTGAGAATTCAGTTTGCCTCTAAAGATCCTAATTTTGAAATTCACAAAGATGGCACAGTTTATGTTAAGAATCCTACCAAGATGAAAGACAACAGAAAAACATTCCGTGTCCTGGCTTGGGAGAATCAAGGTCATGTATACTCTACCAGTGTAACCTTGAAAGGGGAAGGGCATCACCATAAGCAGGACATTTCTTCTGTGAAACATTCCCACCACCCAAAATCTGAGACTGGTTT
  5   1   0       add Gas       in                   TGas064n05.p1cSP6                                                                                                                                                                                                                                                                                                                                                     TAGAGCAGGGAAGTCAGCGCTGCGCTACAAGAACTGAGCAAACGAGCAGAAAAGTACACATTCCTGATCCTTCGGTCTTTCCAAAAGTCCCCAATGGGGTCACACAGGCCATGGTTACTTGGTGCTGTGGTGCTGCTGGCACTCCTTCAGGGAGGACTGGCAGAATGGACACAGTGTCAAATGGGATTTTCCAAGGAAAGGTACAGCTTTTCGGTACCTAAGAACTTGGAGACAGACAAAGCACTGGGTAGAGTGATCTTTAACAGCTGTGAGGGACCAGTGAGAATTCAGTTTGCCTCTAAAGATCCTAATTTTGAAATTCACAAAGATGGCACAGTTTATGTTAAGAATCCTACCAAGATGAAAGACAACAGAAAAACATTCCGTGTCCTGGCTTGGGAGAATCAAGGTCATGTATACTCTACCAGTGTAACCTTGAAAGGGGAAGGGCATCACCATAAGCAGGACATTTCTTCTGTGAAACATTCCCACCACCCAAAATCTGAGACTGGTTTAAAAAGACAAAAAAGAGACTGGGTGATTCCACCAATCGTAACATCTGAGAATGAAAAGGGCCCATTTCCCAAACGGCTTGTGCAGATCAAGTCCAGTAATGC
  5   1   2       ext TbA  5g                        TTbA041l02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                  AGCAAACGAGCAGAAAAGTACACATTCCTGATCCNTTCGGTCTTTCCAAAAGTCCCCAATGGGGTCACACAGGCCATGGTTACTTGGTGCTGTGGTGCTGCTGGCACTCCTTCAGGTACAGGGAGGACTGGCAGAATGGACACAGTGTCAAATGGGATTTTCCAAGGAAAGGTACAGCTTTTCGGTACCTAAGAACTTGGAGACAGACAAAGCACTGGGTAGAGTGATCTTTAACAGCTGTGAGGGACCAGTGAGAATTCAGTTTGCCTCTAAAGATCCTAATTTTGAAATTCACAAAGATGGCACAGTTTATGTTAAGAATCCTACCAAGATGAAAGACAACAGAAAAACATTCCGTGTCCTGGCTTGGGAGAATCAAGGTCATGTATACTCTACCAGTGTAACCTTGAAAGGGGAAGGGCATCACCATAAGCAGGACATTTCTTCTGTGAAACATTCCCACCACCCAAAATCTGAGACTGGTTTAAAAAGACAAAAAAGAGACTGGGTGATTCCACCAATCGTAACATCTGAGAATGAAAAGGGCCCATTTCCCAAACGGCTTGTGCAGATCAAGTCCAGTAATGCAAAGGAAATCAAGGTTTTTTACAGTATCACAGGCCAGGGTGCCGATACCCCTCCAGAAGGAGTGTTCACTATTGGACGGGAGGATGGATGGCTAAATGTGACACGACCTTTGGACAGAGAAGCCATTGATAGTTACACTCTTTTTTCTCATGCTGTGTCAGTAAATGGGCAAAATGTGGAAGATCCCATGGAAATCAAATTANAGTACAAGATCAGAATGATAATGACCCAGTTTTCACA
  5   1   3        nb TbA  5x3  out                  TTbA009g12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                  TACACATTCCTGATCCTTCNGGTCTTTCCATTAGTCCCCAATGGGGTCACACAGGCCATGGTTACTTGGTGCTGTGGTGCTGCTGGCACTCCTTCAGGTACAGGGAGGACTGGCAGAATGGACACAGTGTCAAATGGGATTTTCCAAGGAAAGGTACAGCTTTTCGGTACCTAAGAACTTGGAGACAGACAAAGCACTGGGTAGAGTGATCTTTAACAGCTGTGAGGGACCAGTGAGAATTCAGTTTGCCTCTAAAGATCCTAATTTTGAAATTCACAAAGATGGCACAGTTTATGTTAAGAATCCTACCAAGATGAAAGACAACAGAAAAACATTCCGTGTCCTGGCTTGGGAGAATCAAGGTCATGTATACTCTACCAGTGTAACCTTGAAAGGGGAAGGGCATCACCATAAGCAGGACATTTCTTCTGTGAAACATTCCCACCACCCAAAATCTGAGACTGGTTTAAAAAGACAAAAAAGAGACTGGGTGATTCCACCAATCGTAACATCTGAGAATGAAAAGGGCCCATTTCCCAAACGGCTTGTGCAGATCAAGTCCAGTAATGCAAAGGAAATCAAGGTTTTTTACAGTATCACAGGCCAGGGTGCCGATACCCCTCCAGAAGGAGTGTTCACTATTGGACGGGAGGATGGGATGGCTAATGTGACACGACCTTTGGACAGAGAAGCCATTGATAGTTATACTCTTTTTTCTCATGCTGTGTCAGTAAATGGGCAAAATNGTGGAAGATCCCATGGAAATCCAAATTAAAGTACAAGATCAGAATGATAATGACCCAGTTTTCACACAGGAGGTCTTTGAAGGCTATNGTGCCTGAAGGGTCTAAGCCAGGTACGCCCGTCATGACTGTATCTGCA
  5   1   2       ext Liv1      in                         CAAR6077.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACAGGCCATGGTTACTTGGTGCTGTGGTGCTGCTGGCACTCCTTCAGGTACAGGGAGGACTGGCAGAATGGACACAGTGTCAAATGGGATTTTCCAAGGAAAGGTACAGCTTTTCGGTACCTAAGAACTTGGAGACAGACAAAGCACTGGGTAGAGTGATCTTTAACAGCTGTGAGGGACCAGTGAGAATTCAGTTTGCCTCTAAAGATCCTAATTTTGAAATTCACAAAGATGGCACAGTTTATGTTAAGAATCCTACCAAGATGAAAGACAACAGAAAAACATTCCGTGTCCTGGCTTGGGAGAATCAAGGTCATGTATACTCTACCAGTGTAACCTTGAAAGGGGAAGGGCATCACCATAAGCAGGACATTTCTTCTGTGAAACATTCCCACCACCCAAAATCTGAGACTGGTTTAAAAAGACAAAAAAGAGACTGGGTGATTCCACCAATCGTAACATCTGAGAATGAAAAGGGCCCATTTCCCAAACGGCTTGTGCAGATCAAGTCCAGTAATGCAAAGGAAATCAAGGTTTTTTACAGTATCACAGGCCAGGGTGCCGATACCCCTCCAGAAGGAGTGTTCACTATTGGACGGGAGGATGGATGGCTAAATGTGACACGACCTTTGGACAGAGAAGCCATTGATAGTTACACTCTTTTTTCTCATGCTGTGTCAGTAAATGGGCAAAATGTGGAAGATCCCATGGAAATCCAAATTAAAGTACAAGATCAGAATGATAATGACCCAGTTTTCACACAGGAGGTCTTTGAAGGCTATGTGCCTGAGGGGTCTAAGCCAGGTACGCCCGTCATGACTGTATCTGCAACAG
  5   1   2       add Gas1 5x                            IMAGE:6981346                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGCTGTGGACTTTGTTTCTGGGTGTGTCTGGTCTAGTGATCTTTAACAGCTGTGAGGGACCAGTGAGAATTCAGTTTGCCTCTAAAGATCCTAATTTTGAAATTCACAAAGATGGCACAGTTTATGTTAAGAATCCTACCAAGATGAAAGACAACAGAAAAACATTCCGTGTCCTGGCTTGGGAGAATCAAGGTCATGTATACTCTACCAGTGTAACCTTGAAAGGGGAAGGGCATCACCATAAGCAGGACATTTCTTCTGTGAAACATTCCCACCACCCAAAATCTGAGACTGGTTTAAAAAGACAAAAAAGAGACTGGGTGATTCCACCAATCGTAACATCTGAGAATGAAAAGGGCCCATTTCCCAAACGGCTTGTGCAGATCAAGTCCAGTAATGCAAAGGAAATCAAGGTTTTTTACAGTATCACAGGCCAGGGTGCCGATACCCCTCCAGAAGGAGTGTTCACTATTGGACGGGAAGATGGATGGCTAAATGTGACACGACCTTTGGACAGAGAAGCCATTGATAGTTACACTCTTTTTTTCTCATGCTGTGTCAGTAAATGGGCAAAATGTGGAAGATCCCATGGAAATCCAAATTAAAGTACAAGATCCGAATGATAATGACCCAGTTTTCACACAGGAGGTCTTTGAAGGCTATGTGCCTGAAGGGTCCTAAGCCCAGGTACGCCCGTTCATGGACTGTTATCTGCCAACCAGATGCCCAATGGATGCCTATAGACCTTGTTACAAATGGGTGGTGGATTACCTTTACCTCCCATTTCCCCAACCCAAGGAACCCTAAAAGAACCCCAAAACAATCCAAAATGGTTCCCCCTAATTGGAAATTCCCCCAGTTCTTGGGGTTTGGAA
  5   1   2       ext TbA  5g3  in                   TTbA058e07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACAGTTTATGTTAAGAATCCTACCAAGATGAAAGACAACAGAAAAACATTCCGTGTCCTGGCTTGGGAGAATCAAGGTCATGTATACTCTACCAGTGTAACCTTGAAAGGGGAAGGGCATCACCATAAGCAGGACATTTCTTCCTGTGAAACATTCCCCACCACCCAAAATCTGAGACTGGTTTAAAAAGACAAAAAAGAAACCTGGGTGATTCCACCAATCGTAACATCCTGAGAATGAAAAGGGCCCATTTCCCAAACGGCTTGTGCAGATCAAGTCCAGTAATGCAAAGGAAATCAAGGTTTTTTACAGTATCACAGGCCAGGGTGCCGATACCCCTCCAGAAGGAGTGTTCACTATTGGACGGGAAGAATGGATGGCTAAATGTGACACGACCTTTGGACAGAGAAGCCATTGATAGTTACACTCCTTTTTTCTCATGCTGTGTCAGTAAATGGGCAAAATGTGGAAGATCCCATGGAAATCCAAATTAAAGTACAAGATCAGAATGATAATGACCCAGTTTTCACACAGGAGGTCTTTGAAGGCTATGTGCCTGAAGGGTCTAAGCCAGGTACGCCCGTCATGACTGTATCTGCAACAGATGCCGATGATGCTATAGACATGTACAATGGTGTGATTACTTACTCCATTCTCAACCAAGACCCTAAAGAGCCCAACAATCAAATGTTCACTATTGATTCCCAGTCTGGGTTGAT
  5   1   2       add TbA  5g3  in                   TTbA018f22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTATACTCTACCAGTCTCTAACGCGCGGGGAAGGGCATCACCATAAGCAGGACATTTCCTCTGTGAAACATTCCCACCACCCAAAATCTGAGACTGGTTTAAAAAGACAAAAAAGAGACTGGGTGATTCCACCAATCGTAACATCTGAGAATGAAAAGGGCCCATTTCCCAAACGGCTTGTGCAGATCAAGTCCAGTAATGCAAAGGAAATCAAGGTTTTTTACAGTATCACAGGCCAGGGTGCCGATACCCCTCCAGAAGGAGTGTTCACTATTGGACGGGAGGATGGATGGCTAAATGTGACACGACCTTTGGACAGAGAAGCCATTGATAGTTACACTCTTTTTTCTCATGCTGTGTCAGTAAATGGGCAAAATGTGGAAGATCCCATGGAAATCCAAATTAAAGTACAAGATCAGAATGATAATGACCCAGTTTTCACACAGGAGGTCTTTGAAGGCTATGTGCCTGAAGGGTCTAAGCCAGGTACGCCCGTCATGACTGTATCTGCAACAGATGCCGATGATGCTATAGACATGTACAATGGTGTGATTACTTAC
  5   1   3        nb Neu                            TNeu035h08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAAGGCCCATTTCCCAAACGGCTTGTGCAGATCAAGTCCAGTAATGCAAAGGAAATCAAGGTTTTTTACAGTATCACAGGCCAGGGTGCCGATACCCCTCCAGAAGGAGTGTTCACTATTGGACGGGAAGATGGATGGCTAAATGTGACACGACCTTTGGACAGAGAAGCCATTGATAGTTACAC
  5   1   2       add In62 5g                         IMAGE:8953040.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCCCCCCGACGCCATAGGATCCGAGCCCACCCGATTCGTCCGGTGCCGATACCCCTCCAGAAGGAGTGTTCACTATTGGACGGGAGGATGGATGGCTAAATGTGACACGACCTTTGGACAGAGAAGCCATTGATAGTTACACTCTTTTTTCTCATGCTGTGTCAGTAAATGGGCAAAATGTGGAAGATCCCATGGAAATCCAAATTAAAGTACAAGATCAGAATGATAATGACCCAGTTTTCACACAGGAGGTCTTTGAAGGCTATGTGCCTGAAGGGTCTAAGCCAGGTACGCCCGTCATGACTGTATCTGCAACAGATGCCGATGATGCTATAGACATGTACAATGGTGTGATTACTTACTCCATTCTCAACCAAGACCCTAAAGAGCCCAACAATCAAATGTTCACTATTGATTCCCAGTCTGGGTTGATCAGCGTAGTTACAACTGGATTAGACAGAGAGAAAATACCAGTGTACACACTGACTATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCAAAAGCTGTGATCATTGTGACAGACACCAATGATAACCCTCCTGTGTTTAACCCAACGCAATACATTGCAGAGGTTCCTGAAAATGAAGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGCAGATATTGAAGGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAAGAAATGACGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAACGTGAAGGTTTGGACTATGAGCTGAAGAGCAGTATATTCTGTCAGTCATTGGGACAAACAAAGGCTACTTTTCTGTTCCTACACTTCAACTGCACGGTCCCTGTACTGTTCACAGATTGTGATGAGGCCCCAGTATATTTTGTA
  5   1   2       add In66 5g                         IMAGE:8965936.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTATAACTAACTACTCACCAAATAAAAAAAAATCCGATGGATGGCTAAATGTGACACGACCTTTGGACAGAGAAGCCATTGATAGTTACACTCTTTTTTCTCATGCTGTGTCAGTAAATGGGCAAAATGTGGAAGATCCCATGGAAATCCAAATTAAAGTACAAGATCAGAATGATAATGACCCAGTTTTCACACAGGAGGTCTTTGAAGGCTATGTGCCTGAAGGGTCTAAGCCAGGTACGCCCGTCATGACTGTATCTGCAACAGATGCCGATGATGCTATAGACATGTACAATGGTGTGATTACTTACTCCATTCTCAACCAAGACCCTAAAGAGCCCAACAATCAAATGTTCACTATTGATTCCCAGTCTGGGTTGATCAGCGTAGTTACAACTGGATTAGACAGAGAGAAAATACCAGTGTATACACTGACCATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCAAAAGCTGTGATCATTGTGACAGACACCAATGATAACCCTCCTGTGTTTAACCCAACGCAATACATTGCAGAGGTTCCTGAAAATGAAGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGCAGATATTGAAAGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCCTACTGAAACAGTGAATGGTCTGGACTTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACCTTTTCTGTTCCATTACAACTTCACTGCCACGGTCACTGTAACTGTCATAGAATGCGATGACGTCCCACGTAATTTTGTACCACTGTTGATGACGTGTCTGTGCCTAAGGCATCTGCCATGACCTAAGTCTGTTTGCTTTCCTTATACTCGCTATATGAATCTCAGACAAGGGATACAGA
  5   1   3        nb HdA  5g3  in                  THdA029i02.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCAAATGTGGAAGATCCCATGGAAATCCAAATTAAAGTACAAGATCAGAATGATAATGACCCAGTTTTCACACAGGAGGTCTTTGAAGGCTATGTGCCTGAAGGGTCTAAGCCAGGTACGCCCGTCATGACTGTATCTGCAACAGATGCCGATGATGCTATAGACATGTACAATGGTGTGATTACTTACTCCATTCTCAACCAAGACCCTAAAGAGCCCAACAATCAAATGTTCACTATTGATTCCCAGTCTGGGTTGATCAGCGTAGTTACAACTGGATTAGACAGAGAGAAAATACCAGTGTATACACTGACCATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCAAAAGCTGTGATCATTGTGACAGACACCAATGATAACCCTCCTGTGTTTAACCCAACGCAATACATTGCAGAGGTTCCTGAAAATGAAGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGCAGATATTGAAGGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCCACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAANGAACAGAACCAGAAAATAAGTTACTTCA
  3  -1   3        nb Neu       in                    TNeu061i10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAAATCCAAATTAAAGTACAAGATCAGAATGATAATGACCCAGTTTTCACACAGGAGGTCTTTGAAGGCTATGTGCCTGAAGGGTCTAAGCCAGGTACGCCCGTCATGACTGTATCTGCAACAGATGCCGATGATGCTATAGACATGTACAATGGTGTGATTACTTACTCCATTCTCAACCAAGACCCTAAAGAGCCCAACAATCAAATGTTCACTATTGATTCCCAGTCTGGGTTGATCAGCGTAGTTACAACTGGATTAGACAGAGAGAAAATACCAGTGTACACACTGACTATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCAAAAGCTGTGATCATTGTGACAGACACCAATGATAACCCTCCTGTGTTTAACCCAACGCAATACTATTGCAGAGGTTCCTGAAAATGAANGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGTAGATATTGAAGGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATAATTCTGTCAGTCATTGTGACAAACAAAGCTTAACTTTTTCTGTTCCACTACAAACTTCAACTGCAACGGTCACTG
  5   1   4      seed TpA       in                   TTpA066k09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCGGGGGTCTAAGCCAGGTACGCCCGTCATGACTGTATCTGCAACAGATGCCGATGATGCTATAGACATGTACAATGGTGTGATTACTTACTCCATTCTCAACCAAGACCCTAAAGAGCCCAACAATCAAATGTTCACTATTGATTCCCAGTCTGGGTTGATCAGCGTAGTTACAACTGGATTAGACAGAGAGAAAATACCAGTGTATACACTGACCATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCAAAAGCTGTGATCATTGTGACAGACACCAATGATAACCCTCCTGTGTTTAACCCAACGCAATACATTGCAGAGGTTCCTGAAAATGAAGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGCAGATATTGAAGGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCCACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGNGATTGTCACTGGAAATGGAAACTTGGATCGGNNAATCAAAGTTGTGCTAAACAACACCTACAAAGTCATA
  5   1   2       add In63                            IMAGE:8958137.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGATTCAGCGTAGTTACAACTGGATTAGACAGAGAGAAAATACCAGTGTACACACTGACTATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCAAAAGCTGTGATCATTGTGACAGACACCAATGATAACCCTCCTGTGTTTAACCCAACGCAATACATTGCAGAGGTTCCTGAAAATGAAGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGCAGATATTGAAGGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCAACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGTAAATGACCTCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATATCTTGGTCGCTGACGTGGCACTCCTTCTGCTACTGGACTGACCCTGTGCTAATCTCATGATGTATGATATGTCCATTTTGGATCCTAACAAATAGTCTGCTGAGATCAGCTTCGTGAATAATATCATGGACAAGATCTTACTACCATACCCAACAGTTAACTGACTGGGGTGATCAATGAAACCTG
  5   1   2       ext Te4       in                         CAAN5641.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTACAACTGGATTAGACAGAGAGAAAATACCAGTGTATACACTGACCATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCAAAAGCTGTGATCATTGTGACAGACACCAATGATAACCCTCCTGTGTTTAACCCAACGCAATACATTGCAGAGGTTCCTGAAAATGAAGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGCAGATATTGAAGGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCCACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCAACAAAATAGTTTCTGC
  5   1   3        nb Gas1      in                     NISC_mq01d01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAGACAGAGAGAAAATACCAGTGTATACACTGACCATTCAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCAAAAGCTGTGATCATTGTGACAGACACCAATGATAACCCTCCTGTGTTTAACCCAACGCAATACATTGCAGAGGTTCCTGAAAATGAAGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGCAGATATTGAAGGGTCAGATGTCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCCACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCA
  5   1   3        nb Tail      in                         CBSW8064.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGCTGCAGATGGAGAATTTGGGAAAGATCGCACAACAACTGCAAAAGCTGTGATCATTGTGACAGACACCAATGATAACCCTCCTGTGTTTAACCCAACGCAATACATTGCAGAGGTTCCTGAAAATGAAGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGCAGATATTGAAGGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCCACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAA
  5   1   2       add In63                            IMAGE:8957480.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGGGATTCTTTTTGTGACAGACACCAATGATAACCTCTCCTGTGTTTAACCCAACGCAATACATTGCAGAGGTTCCTGAAAATGAAGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGCAGATATTGAAGGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCAACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAAATGGGATTTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATAAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCAACAAATAGTTCTGCCAGAAGATCCAGGCTTTCGTGTATTTATATCATTGACAAGATTCTTTACCCTAACACATACCCATATACGTAGACTGACTGGTGATCCATGAAACTGACTGCTACGTGACGAACAAGTTACTTGAACTGAAACTTAAAGGACTCTGGAATTTGTGGACGCAATTCGA
  5   1   2       add In66                            IMAGE:8966593.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCCTTTCTTCATCACCAAACTTAAAAACTGCCACGGGCACTCGATTACCTTGCAGAGGTTCCTGAAAATGAAGTTGGATATGAGGTTGCACGTCTTACGGTAACAGATGCAGATATTGAAGGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCAACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGACCCTTGTGCTTATCTCATTGATGTTTATGATAATGGCCCATTTTTGGATCCCAACAAAATAATTTTCTGCAGAAAGGATCAAGGCTTTCGTGTATTAATATACATTGACAAAGATCTTTACCCTTAACACATACCTTATACAGTAGACCTGACTGGCGAATCTCATGAAACTGAACTTGCTACAGTGACGACCGGATTTTACTGGAGCTGGAGACTAAAAAGGAACTGAATATGGACGATATCGTATTTTTGATTTCATTTGAAGAACAATCTTGGGATTGACTGATGTTATCAGACTTACGATTACATTCGTTCATAGTATGGTGATCAATTGCTATGCTGAAAGGGCTGCTCAGTACGGAGTTTGGGGAAATACCCTAATTGGAATCCTGTGGAAGGGTATCTCAGGCTCTCTTTATTATTGTGTATTG
  5   1   2       ext Tbd0      in                     NISC_nl18c10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTCTTACGGTAACAGATGCAGATATTGAAGGGTCAGATGCCTGGAATGCTGTGTACAAGATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGAAGGGTCTCGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCAACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTAT
  5   1   0       chi Gas8      in                          st18c08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATCATTAAAGGAAATGAGGCTGGCTTTTTCAGCATCCAAACAGATATTGACAACATTGGGCTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCAACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGG
  5   1   3        nb Neu       in                   TNeu134f15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGACGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCCACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCACAGGAGGTGCGGCGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAATCATAATCTTGGCCGCTGACAGTAGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATG
  5   1   3        nb Neu                            TNeu018p19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTACTGAAAACAGTGAAGGGTCTGGACTATGAGCTGAAGAAGCAGTATATTCTGTCAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCCACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTNTACTTGAGCTG
  5   1   3        nb Sto1      in                        CABG10008.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTCATTGTGACAAACAAAGCTAACTTTTCTGTTCCACTACAAACTTCAACTGCAACGGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAANAGGCTGCTNCAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTC
  5   1   2       add In54                            IMAGE:8947104.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGTGTCACTGTAACTGTCACAGATGTGAATGAGGCCCCAGTATTTGTACCAGTGTTGAAAGACGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGAGGATCCTAGCGCTTCTTTTATGTGTGCTGCTCTACTGTTGTACGACGAAGAAAGTGTAAAAGACTTATACACAGAAGATGAAACTCGGGACATGTAATTTTCATGATGAAGATCGGTGTGAGGAAAACAGATTGATCAGCCAGCTTCACGGCTAATGCTCGTCCGAAATATCGGAATGGATGTCGTTCCAGATATC
  5   1   3        nb Gas7      in                         XZG56711.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGTGTCTGTGCCAGAGGATCTGCCCAGTGGCCAAGTTGTTGCTACCTATACCGCACAGGATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGT
  5   1   2       add In54                            IMAGE:8942702.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCAAGAACCCCTAAAGAGCAATAAGATTCGAATTCGTCCATCCAGACAAGGAACAGAACCAGAAAATAAGTTACTTCATTGGAAATGACCCAGCAGGGTGGGTGTCTGTGAACAGAGATAATGGGATTGTCACTGGAAATGGAAACTTGGATCGGGAATCAAAGTTTGTGCTAAACAACACCTACAAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTTCTATGATGAAGATGCGTGTGAGAAGACAAGGATTTTGATCTAGCCAGCTTCACGTGTCTAGATGCTCGTTCAGATATAATTCAGTATGATGTCGTTCCCAGTTTAGCTGCTTTCCCAAGTATCGAACCCCGTCTGCAATTCAGATGAAATTGGACTTCATTGATGAAACCTTGGCATGCAGCTGACATTGACCTATGTCTCATACGGACTTCGCCTCTGGGTGCTGCCATAT
  5   1   2       add In54                            IMAGE:8944612.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTCTACTCTATTTTTTAACGACCCATCTATTCGATTCGTCCCAAAGTCATAATCTTGGCCGCTGACAGTGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTTCTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCATGATGAAGAAGCGGTGGTGAGGAAGACCAGGATTTTTGATCTAAGCCAGCTTCACGGTGGTCTAGATGCTCG
  5   1   2       add In62                            IMAGE:8956302.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTATTTAATTAAGGAATAAAAAATTATTTTTATTCGTCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGATGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCAACTCTTGATTTAGATCAGGATTACAGTGCTTTGATAACTGGGGGACCTCGTTTCACAACTGGGCGAGAATGGTATGGAAGGAAGATGAGAATTAGATGGTGCACTGCATACCTATTTGATTCAACAGGTAACATAAAACCATCAATGTATTATGCCGC
  5   1   2       ext Sto1      in                         CABG7490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACT
  5   1   3        nb Ski1 FLt5 in                         CABJ6698.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTCGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTT
  5   1   3        nb Tad5 5g3  in                         XZT68081.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTCGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGGAGAGATG
  5   1   3        nb Neu5 5g3  in                         ANHP2223.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGACCTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTT
  5   1   2       ext Tad0 5g3  in                     NISC_no18b08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTCGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATG
  5   1   3        nb Liv1 5g3  in                          CAAR625.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTG
  5   1   3        nb Panc      in                        CBTA5001.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAG
  5   1   0       chi Gas                            TGas026g10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTATTGGTTCAAGCCCCCCCCCTTATTTTTTGTGGTGCAGGATTTGGTCAGCCCCCAGCTCAGCTTAGGTCACATGAGCATAAAAACATGACCATTACAGCTATCCCACTTTAGAACTGCCTTCTGGTTTAAACATACAAAAGATAAAGGGTCACAGCTTGGACAGTCAGAAATGATGCCTCAATTAGTCTGTATTGCCCAGGGCCTTGCTACTACTAAAACAACACATACATATTTAAGCTTTGTTAAAATCCAAGATTACAAATTAGCATCTGCCCACAAAAATCACTATAGTTGGCCTTTAGTCTGGGCCCACCAATCTCCAAATAAGCAAATCTGCATTTAGGCAGTTTTTCCCATACTGGAATCTTACCAGCACTGTACTTCTGAGCCTTCTCCATACCAGGTTTGTAGTGTTCAGAACATAATTTTTTTGCCTATTCTATATTAAGTTTAGATAATTTACAAGGTTACTTTTATCTGGAGTTTCTAATGTTAAAATCCTATTTCTTGTACTTAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGA
  5   1   3        nb Liv1 5g3  in                         CAAR5118.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAANACAGTAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTG
  5   1   3        nb Ski1 5g3  in                         CABJ7470.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCANAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACA
  5   1   3        nb HdA  FLt5 in                  THdA025n18.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTAGATCTCATGTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCACGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTCGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAACGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGAT
  5   1   3        nb Gas7 5g3  in                         XZG24178.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTCGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAACAG
  5   1   3        nb Sto1 5g3  in                         CABG9284.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAAATTGTAATACA
  5   1   3        nb Gas7 5g3  in                         XZG56396.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTCGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAACAGAGATAAGGACTGCTCAAAAGTACTCCTCCTGCTTTTGTAAAATCGNNTCAAAATATTTTATGTATATGTATATATGAAAAAAATCGNATTTTTTGTACTAT
  5   1   3        nb Neu  5g3  in                   TNeu054c17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTGACCAAATGCAATGTGAGGAAAAGGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTCGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTG
  5   1   3        nb TpA       in                   TTpA001l12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGACCAAATGTACTGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTCGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGA
  5   1   3        nb Tad5 5g3  in                         XZT43795.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTCGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACA
  5   1   3        nb Neu                            TNeu138g22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTGGTGGTGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAAATGTGCACTGCAATACCATTTTGATTCTAAACAGTGAACTAAAAACCATAATTGTGTGTGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAA
  3   1   3        nb HdA  5g3  in                   THdA029i02.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCCGATATGATTCACTATGAAAAAAAAAAAAAAAAAAGCG
  5   1   3        nb Gas7      in                         XZG60286.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTA
  5   1   3        nb Spl2      in                        CBSS3352.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAAAGAAAGTGGTAAAAGANACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTCGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATT
  5   1   3        nb Tad5                                 XZT40904.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAA
  5   1   3        nb Sto1      in                         CABG4193.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGNAAGGGAATTCCATAAAAATAGAATTG
  5   1   3        nb Int1      in                        CAAP11360.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTCGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGGATCTTTATCTGCTTAATTATAAATATAAAATGCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGATTCCATAAAAATATAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCA
  3   1   2       add Gas       in                    TGas064n05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAAAAAAAA
  5   1   3        nb Tbd1      in                        CBXT14625.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATAATCCGTAATGATGTCGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACGGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTACATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATG
  3   1   3        nb Liv1 5g3  in                         CAAR5118.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGTCCTGCCAATCCAGATGAAATTTGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTG
  3   1   3        nb Ski1 5g3  in                         CABJ7470.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCCTGCCAATCCAGATGAAATGGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAAC
  3   1   2       add TbA  5g3  in                    TTbA018f22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGGATCTTTATCTGCTTAATTATAAATATAAAATGCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATATAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCGAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTAATTAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb TbA       out                   TTbA047a14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATAT
  3   1   4      seed TpA       in                   TTpA066k09.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Liv1 5g3  in                          CAAR625.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGATGAAATTGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCNCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACAT
  3   1   3        nb Sto1 5g3  in                         CABG9284.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGAAATTGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATAT
  3   1   3        nb Int1      in                        CAAP11360.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGGATCTTTATCTGCTTAATTATAAATATAAAATGCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATATAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCGAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTAATATACAAC
  5   1   3        nb Thy1      in                        CBST8000.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTATTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTANATGGGGCACAATTTTGATATCTCTGCATT
  3   1   2       ext Te4       in                         CAAN5641.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAAC
  3   1   3        nb Ski1 FLt5 in                         CABJ6698.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGGATCTTTATCTGCTTAATTATAAATATAAAATGCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATATAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCGAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTAATATACAAC
  3   1   3        nb Lun1      in                        CABD10392.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAAC
  5   1   3        nb Lun1      in                        CABD10392.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATANAGATATACATTGATATACAACAAAAAAAAAAAAAAAAA
  5  -1   3        nb Gas1                               IMAGE:6990341                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACTGCTCTNCCATAAGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTGCAAAG
  3   1   3        nb Sto1      in                         CABG4193.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGGATATACATTGATATAC
  3   1   2       ext Sto1      in                         CABG7490.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAACAAAAAAAA
  3   1   3        nb Tad5 5g3  in                         XZT68081.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATAC
  3   1   3        nb Neu  5g3  in                    TNeu054c17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGGATCTTTATCTGCTTAATTATAAATATAAAATGCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATATAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCGAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATGTTGATATCTCTGCATTTGTATTTTACTTGGCATCCCGGTTTAGTAATAAAATAAAGATATACATTAATTAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb HdA  FLt5 in                   THdA025n18.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGTTCGATTACGAAGGCAGTGGCTTTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGGATCTTTATCTGCTTAATTATAAATATAAAATGCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACCCCTGACGCTTGGAAGGGAATTCCATAAAAATATAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCCTATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCGAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTTTGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATTAAAGAGTATACATTAATATACAAAAAAAAAAAAAAAAAAGCG
  3   1   3        nb TpA       in                    TTpA001l12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACCGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTATTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATCCATTGATATACAACAAAAAAAAAAAAAAAAA
  3   1   3        nb Thy1      in                        CBST8000.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTATTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAAC
  3   1   3        nb Tbd1      in                        CBXT14625.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACGGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTACATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCA
  3   1   2       ext Met6      in                          CACY687.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAACAT
  5   1   2       ext Met6      in                          CACY687.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAACATAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu5 5g3  in                         ANHP2223.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATCC
  3   1   3        nb Gas7 5g3  in                         XZG24178.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTATTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGGATATACATTGATATAC
  3   1   3        nb Gas7 5g3  in                         XZG56396.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATTAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATAC
  3   1   3        nb Tad5 5g3  in                         XZT43795.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATAC
  3   1   2       ext Liv1      in                         CAAR6077.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGGATCTTTATCTGCTTAATTATAAATATAAAATGCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATATAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCGAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTAATATAC
  3   1   2       add TbA       in                    TTbA005m18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTCGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTCGGAATTCACTTTGTTTTCTCCGGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTACGCCGAGGTATTTATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTGACCTCCCTGCAATTTGTAATCCAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCCCTATGATTTTAATGGGTCGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTGGGAAGGGAATTCCTTAAAAATTGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGGTATACATTTTCCTATATATCCATTTGATCATTCACAGAGTACAGTCAACATTTGGAATCTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTCTTTTAGCTGGGGTAAAAATTAATTGTATGAGCTAAATGGGGCACAAATTTCGATATCTCAGCATTTGTATTTTACTTGGCAAGTATACTTTTGTAAAAAAAAAAAGATATCCATTGATTACAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Gas7      in                         XZG60286.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATTTCC
  3   1   3        nb Sto1      in                        CABG10008.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGGATCTTTATCTGCTTAATTATAAATATAAAATGCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATATAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCGAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGGATATACATTAATATAC
  3   1   2       add Gas8      in                          st18c08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCNGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGGATCTTTATCTGCTTAATTATAAATATAAAATGCCCGATATGATTCACTATGATTTTAATGTGNTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATATAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCGAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACCTTGGCATGTATACTTTG
  3   1   3        nb Neu       in                    TNeu134f15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG56711.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGGATATACATTG
  3   1   3        nb Tail      in                         CBSW8064.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAACAAAAAAAAAAAAAAA
  3   1   3        nb Panc      in                        CBTA5001.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATAC
  5   1   3        nb Gas0      in                         dad17g11.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGGGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAG
  3   1   2       ext TbA  5g3  in                    TTbA058e07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb TpA       out                   TTpA025l09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGGATCTTTATCTGCTTAATTATAAATATAAAATGCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATATAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCGAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTAATATACAACAAAAAAAAAAAAAAAAAA
  3   1   3        nb Spl2      in                        CBSS3352.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATAC
  5   1   3        nb Tad5      in                          XZT3261.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGGCAGAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAACAT
  5   1   2       ext Gas5      ?                            XZF281.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGGATCTTTATCTGCTTAATTATAAATATAAAATGCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATATAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCGAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTAATATACCAAAAAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTAATA
  5   1   3        nb TbA       in                  TTbA008k12.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTCTGATTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATAC
  3   1   3        nb TbA       in                    TTbA008k12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACCCCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Tad5      in                          XZT3261.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACCCCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATCCATTG
  5  -1   3        nb Neu       in                   TNeu061i10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGGATCTTTATCTGCTTAATTATAAATATAAAATGCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATATAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCGAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTAATATACAA
  3   1   2       ext Tad0 5g3  in                     NISC_no18b08.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCCCAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATCCATTGATATCCAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       ext Tbd0      in                     NISC_nl18c10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGGATCTTTATCTGCTTAATTATAAATATAAAATGCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATATAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTCCAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCGAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTCCTTGGCATGTATACTTTTGTAATAAAATAAAGATATCCATTAATATGCACCAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   3        nb Gas1      in                     NISC_mq01d01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTGGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGAT
  3   1   3        nb Tad0                             NISC_no13d01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAACATAAAAAAAAAAAAAAAAG
  5   1   3        nb Neu       in                   TNeu104g10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGGGGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAACAT
  3   1   3        nb Neu       in                    TNeu104g10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAACATAAAAAAAAAAAAAAAAAA
  5   1   2       add TbA       in                   TTbA005m18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACAATATGTATTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTACTTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGACGAGCGGTTTAGGATTTTGATGAAGCTTGCTGGTCAAACTGANAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCAT
  3   1   3        nb Gas0      in                         dad17g11.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAACAAAAAAA
  5  -1   2       add Gas                            TGas043i20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTGCGGCCGCGTCGACACTAGTTCTCGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTTATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCNATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTGA
  5   1   2  SIG                                      Xt7.1-CABG8589.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAGGCTCCAATTGCCTTTGAATTATTGAGACACATAGTCACCTGGATGGCAAATGGGACAAAGGAGCACACAATAGATTTACATTGTAAACCACTGTGTATACACAACTCAGATTCACTCACCTCAGCTAAAGATGAAAAGATTATAAAGAAATTGCAATTAGTACAAGATGGTGATCACATGATTTCATCATCATGGTCAAATCTAATACAGATTGCCAGATTTCATTGATTCCTGTGAAAATCACATTGATTTTTAAAAAAAAAAAAAAACTCCAAATACAATATAACAAATTGATATTTGAAACATAAATGTCTGCTGAATTTTAGTTCAATTGCTAGCTCACCCTAAAATTGAACTTTTAGTGTTACATAGACAGTGAAATTATCTTCATTTTTATTTTTTGTGGTTTTTGAAGTATTTACATTTTTACCGCAGCATTCCAGTTTGGAATAGCATCCATTATTGGTTGCTGGAATTCTGTTTAACTTGACAGCCTGGCATTGGTTTAAAGGACAGACTGGAAAATAAAGAGAAGAATATTTGTTTTTTTCTTGTTGCTGAATCTGCTGACACAACCATTTTGTTTACTTATAGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGAT
                                                  Xt7.1-CHK-1008276878                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCCAATTGCCTTTGAATTATTGAGACACATAGTCACCTGGATGGCAAATGGGACAAAGGAGCACACAATAGATTTACATTGTAAACCACTGTGTATACACAACTCAGATTCACTCACCTCAGCTAAAGATGAAAAGATTATAAAGAAATTGCAATTAGTACAAGATGGTGATCACATGATTTCATCATCATGGTCAAATCTAATACAGATTGCCAGATTTCATTGATTCCTGTGAAAATCACATTGATTTTTAAAAAAAAAAAAAAACTCCAAATACAATATAACAAATTGATATTTGAAACATAAATGTCTGCTGAATTTTAGTTCAATTGCTAGCTCACCCTAAAATTGAACTTTTAGTGTTACATAGACAGTGAAATTATCTTCATTTTTATTTTTTGTGGTTTTTGAAGTATTTACATTTTTACCGCAGCATTCCAGTTTGGAATAGCATCCATTATTGGTTGCTGGAATTCTGTTTAACTTGACAGCCTGGCATTGGTTTAAAGGACAGACTGGAAAATAAAGAGAAGAATATTTGTTTTTTTCTTGTTGCTGAATCTGCTGACACAACCATTTTGTTTACTTATAGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAA
  5   1   4      seed Sto1      in                         CABG8589.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAGGCTCCAATTGCCTTTGAATTATTGAGACACATAGTCACCTGGATGGCAAATGGGACAAAGGAGCACACAATAGATTTACATTGTAAACCACTGTGTATACACAACTCAGATTCACTCACCTCAGCTAAAGATGAAAAGATTATAAAGAAATTGCAATTAGTACAAGATGGTGATCACATGATTTCATCATCATGGTCAAATCTAATACAGATTGCCAGATTTCATTGATTCCTGTGAAAATCACATTGATTTTTAAAAAAAAAAAAAAACTCCAAATACAATATAACAAATTGATATTTGAAACATAAATGTCTGCTGAATTTTAGTTCAATTGCTAGCTCACCCTAAAATTGAACTTTTAGTGTTACATAGACAGTGAAATTATCTTCATTTTTATTTTTTGTGGTTTTTGAAGTATTTACATTTTTACCGCAGCATTCCAGTTTGGAATAGCATCCATTATTGGTTGCTGGAATTCTGTTTAACTTGACAGCCTGGCATTGGTTTAAAGGACAGACTGGAAAATAAAGAGAAGAATATTTGTTTTTTTCTTGTTGCTGAATCTGCTGACACAACCATTTTGTTTACTTATAGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTANAAAGGACTGGATATTGGACGATA
  5   1   2   10  ext Ski1 PIPE in                         CABJ6524.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTTAGTTCAATTGCTAGCTCACCCTAAAATTGAACTTTTAGTGTTACATAGACAGTGAAATTATCTTCATTTTTATTTTTTGTGGTTTTTGAAGTATTTACATTTTTACCGCAGCATTCCAGTTTGGAATAGCATCCATTATTGGTTGCTGGAATTCTGTTTAACTTGACAGCCTGGCATTGGTTTAAAGGACAGACTGGAAAATAAAGAGAAGAATATTTGTTTTTTTCTTGTTGCTGAATCTGCTGACACAACCATTTTGTTTACTTATAGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTC
  5   1   2   12  ext Tad5 5g3  in                         XZT33848.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AATAGCATCCATTATTGGTTGCTGGAATTCTGTTTAACTTGACAGCCTGGCATTGGTTTAAAGGACAGACTGGAAAATAAAGAGAAGAATATTTGTTTTTTTCTTGTTGCTGAATCTGCTGACACAACCATTTTGTTTACTTATAGGCACTCCTTCTGCCACTGGGACTGGAACCCTTGTGCTTAATCTCATTGATGTTAATGATAATGGCCCATTTTTGGATCCCCAACAAAATAGTTTCTGCCAGAAGGATCCAGGCTTTCGTGTATTTAATATCATTGACAAAGATCTTTACCCTAACACATACCCATATACAGTAGACCTGACTGGTGAATCCAATGAAAACTGGACTGCTACAGTGACAGAACAGAGTTTACTTGAGCTGAGACCTAAAAAGGAACTGGATATTGGACGATACGAAGTTTTGATCTCATTGAGAGACAATCAGGGACTGACAGATGTGACAAAGCTACAGATTACAATCTGTCAATGTAATGGTGACCAAATGCAATGTGAGGAAAAGGCTGCTCAAGCAGGAGGTTTGGGGATATCAGCCATAGTTGGAATCCTTGGAGGGATCCTAGCGCTTCTTTTATTGTTGTTGCTGCTCTTACTGTTTGTACGACGAAAGAAAGTGGTAAAAGAACCTTTATTACCACCAGAAGATGAGACTCGGGACAATGTATTTTTCTATGATGAAGAAGGCGGTGGTGAGGAAGACCAGGATTTTGATCTAAGCCAGCTTCACCGTGGTCTAGATGCTCGTCCAGATATAATCCGTAATGATGTTGTTCCAGTTTTAGCTGCTCCCCAGTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGC
  3   1   4      seed Sto1      in                         CABG8589.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTATCGACCCCGTCCTGCCAATCCAGATGAAATTGGAAATTTCATTGATGAGAACTTGCATGCAGCTGACAATGACCCCACTGCTCCTCCATACGACTCGCTCCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATACAACAAAAAAAAAAAA
  3   1   2       ext Ski1 PIPE in                         CABJ6524.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTTGTGTTCGATTACGAAGGCAGTGGCTCTGAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCCTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATATAC
  3   1   2       ext Tad5 5g3  in                         XZT33848.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGGCCGCATCACTCAGCTCTCTTAACTCTTCCAACTCTGATTTAGATCAGGATTACAGTGCTTTGAATAACTGGGGACCTCGTTTCACCAAACTGGCAGAAATGTATGGAGGAGATGAGGATTAGAATGTGCACTGCAATACCATTTTGATTCTAAACAGTAAACTAAAAACCATAATTGTGTATGCAGTCTTTGGAATTCACTTTGTTTTCTCCTGCTCTTAAAACAGAGATAAGGACTGCTCAAAAGTTACTCCTCCTGCTTTTGTAAAATCGTTCAAAAATATTTTATGTATATGTATATATGAAAAAAATCGTATTTTTTGTACTATTTGTGTTCTTATATCCCTGCAATTTGTAATACAAGAGAATCTTTATCTGCTTAATTATAAATATAAAATCCCCGATATGATTCACTATGATTTTAATGTGTTGAGAAATCTTTTTTTAAAAAGGTTTCCAGACACCTGACGCTTGGAAGGGAATTCCATAAAAATAGAATTGAATTGGGGGGAGATTGTGTTTTGCCATGGTCTGATATACATTTTCATATATATACATATGATCATTCACAGAGTACAGTCAACATTTGGAATTTGATGAGCTTGCTGGTCAAACTGAAAAAAAAATGTATTATAGCTGGGGTAAAAATTAATGTATGAGCTAAATGGGGCACAATTTTGATATCTCTGCATTTGTATTTTACTTGGCATGTATACTTTTGTAATAAAATAAAGATATACATTGATAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)