Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI12324.3.5                        77 END     1           1        1                hypothetical protein LOC89958 [Homo sapiens]
     2   2.0    0Xt7.1-CABK8435.3.5                         26 END     1           1        3                (no blast hit)

 This cluster: approximate FL confidence score = 90%

 1012071209 Xt7.1-XZT20764.5 - 92 ESTs
                                                                       .......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT20764.5                  AGAGGCGCTAGAGCGGTGAATGAGCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTATAAATTTTGTGTGTTAAGTCATCAAAAAAAAAAAAATTTTTTTTTTTTTGAAGCTAGTTCCTTCTGTTTGTAGTATCTGCCTTTAATTTTGTCGTAATATGATTTTTACTGGTTTAATTTTTTTTTTTAATATGCGTATGGTAAATTTAACCCATACCCTGAATTTGAAAAATCAGAAATTCCACATTGAAGAGAACAGAAATTTATAACATTCTGTTGTCCAGAGCTTTAAAGTCATATGACTTATACCACATGCATAAAGCAGAGTTTTTATGAATTGCTAAACTGCAAAGACCTTACTGGCCTACATAGAATCTTTACCTAAGCCCAACTGAAATGCCAAATGAGAATCTACCTTTCTGTTTGTCTGTGTTTGGGAGCATAACTAAATGTGTGCAGTGTTTAACCTTCTAGTGGAAAGCCCTTCTCAGCAGCATCCAAGCCCAAGACATTAACAGAATCTGCCATCACAACATCACTGTTCTTACTGAAAAACCACCTACGCTGCTTCAAATGAAAGTTAATGCTTGCACACTTTTTAGAATGTTATAA
                                                  Xt7.1-CHK-1008223483                        GCTAGAGCGGTGAATGAGCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTxxxxxATAAATTTTGTGTxxxxxxxxxxxAAAAAAAxxxxxxTTTTTTTTTTxxTGAAGCTAGTTCCTTCTGTTTGTAxxxxCxxxxxTTAATTTTGTCGTAATATGATTTTTACTGGTTxxxTxxTTTTTTTTAATATGCGTATGGTAAATTTAACCCATACCCTGAATTTGAAAAATCAxAxxTTCCACAxxxxxxAGAACAGAAATTTATAACATTCTGTTGTCCAGAGCTTTAAAGTCATATGACTTATACCACATGCATAAAGCAGAGTTTTTATGAATTGCTAAACTGCAAAGACCTTACTGGCCTACATAGAATCTTTACCTAAGCCCAACTGAAATGCCAAATGAGAATCTACCTTTCTGTTTGTCTGTGTTTGGGAGCATAACTAAATGTGTGCAGTGTTTAACCTTCTAGTGGAAAGCCCTTCTCAGCAGCATCCAAGCCCAAGACATTAACAGAATCTGCCATCACAACATCACTGTTCTTACTGAAAAACCACCTACGCTGCTTCAAATGAAAGTTAATGCTTGCACACTTTTTAGAATGTTATAAATACAC
                                                      consensus depths                       3     3     7     8    29    33    52    54    59    60    62    64    66    68    68    70    70    71    71    73    71    73    73    75    76    77    80    81    79    80    79    80    79    80    79    80    79    80    79    80    79    80    77    79    78    79    78    79    79    80    79    81    81    81    82    83    83    83    83    83    80    83    83    83    83    83    84    84    83    84    83    85    83    85    83    85    81    85    83    85    83    86    83    86    83    86    81    84    80    83    79    83    77    83    55    80    55    80    54    79    54    80    52    76    52    75    51    74    50    65    44    60    45    59    43    57    41    55    15    50    14    48    10    37    19    32    11    17     4    14     3    10     3    11     3    10     3    10     3    10     4    10     4    10     3     9     3     8     3     8     2     7     3     7     3     7     3     7     3     7     3     7     3     7     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     4     5     4     5     4     5     4     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTAACTTAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTCATGTTTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGTGAAGCTAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTGCCTTTCTT
                                                                   SNP                                                      ------A-----
                                                                   SNP                                                                              -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -G----------
                                               BLH ATG     123     462                  
                                               BLH MIN     123      48                  
                                               BLH MPR      15      48                  
                                               BLH OVR     123     111                  
                                               CDS MIN     123      73                  
                                               EST CLI      23      73                  
                                               ORF LNG     123       1                  
                                                                                                                                                                                                                   PROTEIN === Sc ==== 1e-028     NP_009527.1 Like Sm-D1 protein; Lsm2p [Saccharomyces cerevisiae] =============================================================================================================================================================================================
                                                                                                                                                                                                                   PROTEIN === Ce ==== 5e-041     NP_506348.2 GUT differentiation defective family member (gut-2) [Caenorhabditis elegans] ==================================================================================================================================================================
                                                                                                                                                                                                                   PREDICTED = Sp ==== 6e-043     XP_792582.2 PREDICTED: similar to lsm2 homolog, U6 small nuclear RNA associated [Strongylocentrotus purpuratus] ===========================================================================================================================================
                                                                                                                                                                                                                   PROTEIN === Bf ==== 2e-045     CAB05859.1 AmphiBrf43 [Branchiostoma floridae] ================================================================================================================================================================================================
                                                                                                                                                                                                                   PROTEIN === Dm ==== 5e-045     NP_648570.1 CG10418-PA [Drosophila melanogaster] =================================================================================================================================================================================================
                                                                                                       PROTEIN --- Mm ---- 2e-047     NP_085100.1 snRNP core protein SMX5 [Mus musculus] -----------------------------==========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                   PROTEIN === Dr ==== 5e-048     NP_571571.1 smx5 [Danio rerio] ===============================================================================================================================================================================================================================
                                                                                                                                                                                                                   PROTEIN === Hs ==== 4e-048     NP_067000.1 chromosome 6 open reading frame 28; U6 snRNA-associated Sm-like protein [Homosapiens] ============================================================================================================================================================
                                                                                                                                                                                                                   PROTEIN === Xl ==== 2e-048     AAH94397.1 Unknown (protein for MGC:84990) [Xenopus laevis] ==================================================================================================================================================================================================
                                                                                                                                                                                                                   PROTEIN === Xt ==== 2e-048     CAJ81423.1 LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Xenopus tropicalis] ================================================================================================================================================================
                                                      Xt7.1-XZT20764.5                                                            TAG---------------------------------------------TAG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------TGA------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------TAA---------------------------------------------TGA---TAG------------------------------------------TGA---------------------------------------TAA---TAA---------TGA---TGA------------------------------------------------------------------------------------ATG------------------TGA---------------------------------TAG------------------------ATG------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------ATG---------------------------ATG---TAA
                                                                   ORF                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                        ]
  0   1   1           Egg  FL                     TEgg127d09.FL-Sanger                                                                                                                            CGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATC
  5   1   2       bld HeRe 5g3  in                     EC2CAA31DC05.g1 GGTCGCGAGATTTATGCAGAGGCGCTAGAGCGGTGAATGAGCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGAT
  5   1   2       bld Gas1 CHI  out                   IMAGE:5309367.y2      GATGATTTATGCAGAGGCGCTAGAGCGGTGAATGAGCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGT
  5   1   2       bld HeRe 5g3  in                     EC2CAA40AE01.g1       GAGATTTATGCAGAGGCGCTAGAGCGGTGAATGAGCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCT
  5   1   2       bld HeRe 5g                          EC2CAA44DC04.g1                      GGGCTAGAGCGGTGAATGAGCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAG
  3   1   2       bld BrSp 5g3  in                     EC2BBA30AC06.b1                       GGGGAGAGCGGTGAATGAGCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTATCAGATAAGCAGAGTTAATTGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAA
  3   1   2       bld HeRe                             EC2CAA28CA11.b1                       GGAGAGAGCGGTGAATGAGCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAA
  5   1   2       bld BrSp 5g3  in                     EC2BBA30AC06.g1                        GGGAGAGCGGTGAATGAGCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATT
  5   1   2   32  bld Gas7 5g                              XZG61273.5p .........................CGGACGCGTGGGTGAGCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCTAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAGCTCATGTTTTTTTTTTTTTTTTTTAGTGAAGCTAGTTC
  5   1   2       bld Egg  5g                        TEgg050i10.p1kSP6                               AATCCCCGGGGCGGAAGGCATTTGGTGTGAAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTC
  5   1   2       bld Egg  5g                        TEgg095h19.p1kSP6                                GTGAATGAGCGGAAGGCGTTTCGGTGTGAATATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTC
  5   1   2       bld TpA  5g                        TTpA009f05.p1kSP6                                 GTGAATGAGCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCNTC
  5   1   2   12 seed Tad5 5g3  in                         XZT20764.5p .................................TGAATGAGCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAGCTCATGTTTTTTTTTTTTTTTAGTGAAGCTAGTTCCT
  3   1   2       bld Gas8 5g3  in                          st59k03.3p                                  GCTGCAGCCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATNTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTNTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCNCACTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCNAGCAATGCNTTTTGCTNTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACT
  3   1   2       bld Gas7 5g3  in                          XZG3590.3p                                    CCACGCGTCCGGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGTGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTAAAAAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTCTTTTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATC
  5   1   2       bld Egg  5g3  in                   TEgg031f15.p1kSP6                                      TGAGCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCCCACTTTTTTTTC
  5   1   2       bld Gas  5g                        TGas038a01.p1kSP6                                      GGAGCCGGAAGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTC
  5   1   2       bld Tad5      in                          XZT1013.5p                                      ATGAGCGGAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTNTTTTTAACTTAAATAAATTTTGTGTTAAGTCATCAAAAAAAAAAAAAAAGG
  5   1   2       bld Gas  5g                        TGas049f14.p1kSP6                                       AGCGGAAGGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTT
  3   1   2       bld Neu5 5g3  in                         ANHP2163.3p                                       CAGCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTAACTTAAATAAATTTTGTGTTAAGTC
  5   1   2   14  bld Neu5 5g3  in                         ANHP2163.5p ......................................CAGCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTAACTTAAATAAATTTTGTGTTAAGTCAAAAAAAAAAAAAAAAAAAA
  5   1   2   12  bld Gas7 5g3  in                         XZG39764.5p ........................................GCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTAACTTAAATAAATTTTGTGTTAAGTTAAAAA
  5   1   2   12  bld Gas7 5g3  in                         XZG58002.5p ........................................GCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACTGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAGCTCATGTTTTTTTTTTTTTTTTTTAGTGAAGCTAGTTCCTTCTGTTTGTATCTGCCTTTNCTAATTTT
  5   1   2   12  bld Tad5 5g3  in                         XZT31129.5p ........................................GCGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTTGTGTAAGTCATCAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5g3  in                   TEgg030g13.p1kSP6                                          CGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCCTTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTACGTGTTGTCAACTGCCTCTATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGT
  5   1   2       bld Egg  5g3  in                   TEgg033o22.p1kSP6                                          CGGAAGGCATTTGGTGTGAAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTACAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGATGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCAGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAAGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAA
  5   1   2       bld Egg  5g3  in                   TEgg033o23.p1kSP6                                          CGGAAGGCATTTGGTGTGAAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAG
  5   1   2       bld Gas  5g   ?                    TGas059d13.p1cSP6                                          CGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTAAGTGCAGTGACTTGTGTGTTC
  5   1   2       bld Gas  5x3  out                  TGas118a21.p1kSP6                                          CGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCT
  5   1   2       bld Neu  5g3  in                   TNeu095f13.p1cSP6                                          CGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGC
  3   1   2       bld Gas                             TGas086e01.q1kT7                                          CGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTTTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTTTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAGCTCATGTTTTTTTTTTTTTTAGTGAAGCTAGTTCCTTCTGTTTGTATCTGCCTTTCTTAATTTTGTCGTAATATGATTTTTACTGGTTTAATTTTTTTTTAATATGCGTATGGTAAATTTAACCCATACCCTGAATGGAAAAATCAGAAATTTTCCAACAGAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas107d02.q1kT7                                          CGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCCCACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTTTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAGCTCATGTTTTTTTTTTTTTTAGTGAAGCTAGTTCCTTCTGTTTGTATCTGCCTTTCTTAATTTTGTCGTAATATGATTTTTACTGGTTTAATTTTTTTTTAATATGCGAAAAAAAAATAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu095f13.q1kT7                                          CGGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTGGTTTTACTTAAATANNAATTTTGTGTTAAGGTCATCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5g                        TGas011d01.p1kSP6                                          CCGGAAGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTG
  5   1   2       bld Egg  5g                        TEgg104f21.p1kSP6                                           CGGAAGGATTTGGTGTGAAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCT
  5   1   2       bld Gas  5g3  in                   TGas107d02.p1kSP6                                           GGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCA
  5   1   2       bld Gas  5x3                       TGas005g05.p1kSP6                                           CGGAAGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGC
  5   1   2   12  bld Gas7 5g3  in                         XZG58863.5p ..........................................GGAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTAACTTAAATAAATTTTGTGTTAAGTCATCAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5 5g3  in                         XZT31129.3p                                            GAAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATC
  3   1   2       bld Gas  5g3  in                    TGas120i19.q1kT7                                             AAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTGTTACTTAAATAAATTTTGTGTTAAGTCATCAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas144d08.q1kT7                                             AAGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATANAATTTTGTGTTAAGTCATCAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                     EC2BBA22BA01.b1                                             GGGGATTTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTA
  3   1   2       bld BrSp 5g3  in                      EC2BBA9BH06.b1                                             GGGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAA
  5   1   2       bld Gas  5g3  in                   TGas120i19.p1kSP6                                              AGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCT
  5   1   2       bld Gas  5g3  in                   TGas144d08.p1kSP6                                              AGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGT
  5   1   2       bld BrSp 5g3  in                     EC2BBA22BA01.g1                                              GGGATTTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCCAGCAATGCATT
  5   1   2       bld BrSp 5g3  in                      EC2BBA9BH06.g1                                              GGGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTT
  5   1   2       bld Gas8 5g3  in                          st59k03.5p                                               GGCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGAT
  3   1   2       bld Ova1 5g3  in                        CABE13479.3p                                                GCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATC
  5   1   2   10  bld Ova1 5g3  in                        CABE13479.5p ...............................................GCATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5g                        TGas005l02.p1kSP6                                                 CATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTT
  5   1   2       bld Gas  5g                        TGas011a09.p1kSP6                                                 CATTTGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTT
  3   1   2       bld HeRe 5g3  in                     EC2CAA35AA03.b1                                                  AGGGGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTTTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATGGGAAAGACTGCCCTAACTTTTTTTTTAC
  3   1   2       bld Tad5 5g3  in                         XZT51546.3p                                                   CCACGCGTCCGGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATC
  5   1   2       bld HeRe 5g3  in                     EC2CAA35AA03.g1                                                     GGGTGTGTAGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCAGCAAAAAAA
  5   1   2   12  bld Gas7 5g3  in                          XZG3590.5p ...........................................................GTGATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGTGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTAAAAAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTCTTTTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAAAAAAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7 5g3  in                         XZG58863.3p                                                            TAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTAACTTAAATAAATTTTGTGTTAAGTCATC
  3   1   2       bld Egg  5g3  in                    TEgg030g13.q1kT7                                                              GATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTAACTTAAATAAATTTTGTGTTAAGTCATCAAAAAAAAAAAAAAAAAAGCGAGAGAACTAGGTCGACGC
  5   1   2       bld Gas  5x3                       TGas018c17.p1kSP6                                                              TAGATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTNTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACT
  5   1   2   12  bld Tad5 5g3  in                         XZT51546.5p .............................................................GATCTGTCGTTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAAAAAAAAAAAAAAAAAAGG
  5   1   2       bld TbA  5g                        TTbA047m18.p1kSP6                                                               ATCTGTCGTTGTCAGCGGCGTCCGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGGACTTNGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTC
  3   1   2       bld Gas  5g3  in                    TGas086a18.q1kT7                                                                       TTGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGAAAAGGGGAGTTAATTGGGAAAGACTNCCCTAACTTTCCAGTGGGGGCTTAAATAAATTTTGTGTTAAGTCATGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5g3  in                   TGas086a18.p1kSP6                                                                        TGTCAGCGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCT
  5   1   2   32  bld Gas7 5g                               XZG8370.5p ...........................................................................TAGCGGCGTCTGTTTTGTTCTTCGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGCGGCCCGC
  5   1   2   10  bld Ova1 5g3  in                         CABE9154.5p .............................................................................CGGCGTCTGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAGCTCATGTTTTTTTTTTTTTTAGTGAAGCTAGTTCCTTCTGTTTGTATCTGCCTTTCTTAATTTTGTCGTAATATGATTTTTACTGGTTTAATTTTTTTTTAATATGCGTATGGTAAATT
  5   1   2   10  bld Ova1 5g3  in                         CABE6402.5p ...............................................................................CCGAGGGTTTTGTTCTTCAGTTTCCGCATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1 5g3  in                         CABE6380.3p                                                                                     CGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTAACTTAAATAAATTTTGTGTTAAGTCATC
  5   1   2   10  bld Ova1 5g3  in                         CABE6380.5p ....................................................................................CGTTTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTAACTTAAATAAATTTTGTGTTAAGTCATCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1 5g3  in                         CABE6402.3p                                                                                        TTTGTTCTTCAGTTTCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATC
  3   1   2       bld Sto1      in                        CABG10659.3p                                                                                                      TCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTAACTTAAATAAANTTTTGTGTTAAGTCATC
  5   1   2       bld Sto1      in                        CABG10659.5p                                                                                                      TCCAGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTAACTTAAATAAATTTTGTGTTAAGTCATCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg031f15.q1kT7                                                                                                         AGATAGAGCTTGGGTGGTGCGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe 5g3  in                     EC2CAA40AE01.b1                                                                                                                         GCGACTGCAAACAGAAGCAATGCTTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACAAATAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGATAATCAGATAAGCAGAGTTAATGGGAAAGACTGCCCTAA
  5   1   2       bld Egg  FL                        TEgg127d09.p1kSP6                                                                                                                            CGACTGCAACAGAAGCAATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTA
  3   1   2       bld Ova1 5g3  in                         CABE5731.3p                                                                                                                                             ATGCTATTCTACTCCTTCTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATC
  5   1   2   10  bld Ova1 5g3  in                         CABE5731.5p .............................................................................................................................................ATGCTATTCTACTCCTTCTTCAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                         XZG39764.3p                                                                                                                                                              CTTCAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTCCAAGAGCTAGAAGGATGGAAGCAGGTTCCCAAGCAGCCCTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTAACTTAAATAAATTTTGTGTTAAGTT
  3   1   2       bld Egg  5g3  in                    TEgg033o22.q1kT7                                                                                                                                                                 CAAGTCTCTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGGGGTACTCTCCACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGCCCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGTTTCTCCAGGACGCTGCAGGGAAAGAAGCTGTCCAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCCCAAGCAGCACTAGGTGTGGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGGGTGGGCAGCAACTTGTTCCCTGTTATACAGGTTTTGCATTACATTTTTGTAAGAGACCCCCACTTTTTTTTTTTCATCCTAGTTCTGGAAACTTTTTTTAAGTGCAGTGACTGGGGTGTTCACTTTAGAATCCAAGCAATGCATTTTGTTTTGCAAAGAAGTGGTTTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg033o23.q1kT7                                                                                                                                                                        CTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGTTTTTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTTTTCATCCTAGTTCTGGAAACTTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGTTTTGCAAAGAAGTGGTTTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                          XZT1013.3p                                                                                                                                                                        CTTGTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTAACTTAAATAAA
  5  -1   2       bld Gas                            TGas039d08.p1kSP6                                                                                                                                                                           GTAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTGTAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTAACTTAAATAAATTTTGTGTTAAGTCAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Te1       out                        CBWN3397.b1                                                                                                                                                                           GAAGGAAAGGATGTGGTGGTAGAGCTGAAGAATGATCTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACAGACCCAGAAAAATATCCACACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAA
  5   1   2       bld Tad5                                 XZT43800.5p                                                                                                                                                                                                                                                                                                         CACATGTTGTCTGTAAAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGG
  5   1   2       bld Tbd1      in                        CBXT10685.b1                                                                                                                                                                                                                                                                                                                        AAGAATTGTTTCATTCGGGGATCTGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAAGTGCAGTGACTTGTG
  5   1   2       bld Gas7                                  XZG5850.5p                                                                                                                                                                                                                                                                                                                                               GGTGGTCCGCTATGTACAGCTCCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAGCTCATGGGTTTTTTTTTTTTTTTAGTGAAGCTAGTTCCTTCTGTTTGTATCTGCCTTTCTTAATTTTGTAGTAATATGATTTTTACTGGTTTAATTTTTTTTAATATGCGTATGGTAAATTTAACCCATACCCTGAATTTGAAAAATCAGAAATTTTCCACATTGAAGAACAGAAATTTATAACATTCTGTTGTCCAGAGCTTTAAAATCATATGACTTATACCACATGCATAAAGCAGAGTTTTTATGAATTGCTAAACTGCAAAGACCTTACTGGCCTACATAGAATCTTTACCTAAGCCCAACTGAAAAGCCAAATGTGAATCTACCTTTCTGTTTGTCTGTGTTTGGGAGCATAACTAAATGTGT
  3   1   2       bld Tbd1      in                        CBXT10685.g1                                                                                                                                                                                                                                                                                                                                                      CCGCTATGTACAGCTCCTGCTGATGAAGTAGACACTCAGCTTCTCCAGGACGCTGCACGGAAAGAAGCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTTTCATCCTAGTTTTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTTTGCAAAGAAGTGGTTTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAGCTCATGTTTTTTTTTTTTTTTAGTGAAGCTAGTTCCTTCTGTTTGTATCTGCCTTTCTTAATTTTGTCGTAATATGATTTTTACTGGTTTAATTTTTTTTTAATATGCGTATGGTAAATTTAACCCATACCCTGAATTTGAAAAATCAGAAATTTTCCACATTGAAGAACAGAAATTTATAACATTCTGTTGTCCAGAGCTTTAAAGTCATATGACTTATACCACATGCATAAAGCAGAGTTTTTATGAAAAAAAAAAAAAAA
  5   1   2       bld Gas7                                 XZG31945.5p                                                                                                                                                                                                                                                                                                                                                                                                                        GCTGTACAGCAAAAGCAGTGATGTACAAGAGCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAGCTCATGGGTTTTTTTTTTTTTTTTAGTGAAGCTAGTTCCTTCTGTTTGTATCTGCCTTTCTTAATTTTGTAGTAATATGATTTTTACTGGTTTAATTTTTTTTAATATGCGTATGGTAAATTTAACCCATACCCTGAATTTGAAAAATCAGAAATTTTCCACATTGAAGAACAGAAATTTATAACATTCTGTTGTCCAGAGCTTTAAAATCATATGACTTATACCACATGCATAAAGCAGAGTTTTTATGAATTGCTAAACTGCAAAGACCTTACTGGCCTACATAGAATCTTTACCTAAGCCCAACTGAAAAGCCAAATGTGAATCTACCTTTCTGTTTGTCTGTGTTTGGGAGCATAACTAAATGTGTG
  3   1   2       bld Gas       out                   TGas118c23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTAGAAGGATGGAAGCAGGTTCACAAGCAGCACTAGGTGTTGTCAACTGCCTATATTTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTTGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAGCTCATGTTTTTTTTTTTTTTTTTTAGTGAAGCTAGTTCCTTCTGTTTGTATCTGCCTTTCTTAATTTTGTCGTAATATGATTTTTACTGGTTTAATTTTTTTTAATATGCGTATGGTAAATTTAACCCATACCCTGAATTTGAAAAATCAGAAATTTTCCACATTGAAGAACAGAAATTTATAACATTCTGTTGTCCAGAGCTTTAAAGTCATATGACTTATACCACATGCATAAAGCAGAGTTTTTATGAATTGCTAAACTGCAAAGACCTTACTGGCCTACATAGAATCTTTACCTAAGCCCAACTGAAATGCCAAATGAGAATCTACCTTTCTGTTTGTCTGTGTTTGGGAGCATAACTAAATGTGTGCAGTGTTTAACCTTCTAGTGGAAAGCCCTTCTCAGCAGCATCCAAGCCCAAGACATTAACAGAATCTGCCATCACAACATCACTGTTCTTACTGAAAAACCACCTACACTGCTTCAAATGAAAGTTAATGCTTGCACACTTTTTAGAATGTTATAAATACACCCTATTCTAGGCAACTTAAGAAGAAAAATAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe 5g3  in                     EC2CAA31DC05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCAATAATTCTATAAGGCCAAATATAGGAGTGAGCAGCAACTTGTTACCTGTTATACAGGTTTAGCATTACATTTCTGTAAGAGACCCACACTTTTTTTTCTCATCCTAGTTCTGGAAACTTTTTTAAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTAAGATAAGCAGAGTTAATGGGAAAGACTGCCCTAA
  3   1   2       bld Tad5 5g3  in                         XZT20764.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGTGCAGTGACTTGTGTGTTCACTTTAGAATCCAAGCAATGCATTTTGCTCTGCAAAGAAGTGGTCTCAGATAAGCAGAGTTAATTGGGAAAGACTGCCCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAGCTCATGTTTTTTTTTTTTTTTAGTGAAGCTAGTTCCTTCTGTTTGTATCTGCCTTTCTTAATTTTGTCGTAATATGATTTTTACTGGCTTAATTTTTTTTTAATATGCGTATGGTAAATTTAACCCATACCCTGAATTTGAAAAATCAGAAATTTTCCACATTGAAGAACAGAAATTTATAACATTCTGTTGTCCAGAGCTTTAAAGTCATATGACTTATACCACATGCATAAAGCAGAGTTTTTATGAATTGCTAAAGTGCAAAGACCTTACTGGCCTACATAGAATCTTTACCTAAGCCCAACTGAAATGCCAAATGAGAATCTACCTTTCTGTTTGTCTGTGTTTGGGAGCATAACTAAATGTGTGCAGTGTTTAACCTTCTAGTGGAAAGCCCTTCTCAGCAGCATCCAAGCCCaagacattaacagaatctgccatcacaacatcactgttcttactgaaaaaccacctacgctgcttcaaatgaaagttAATGCTTGCACACTTTTTAGAATGTTATAAATACACCTATTCTAGGCAACTTTT
  3   1   2       bld Gas7 5g3  in                         XZG58002.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTAACTTTTTTTTTTTTTTACTTAAATAAATTTTGTGTTAAGTCATCAGCTCATGTTTTTTTTTTTTTTTTTTAGGGAAGCTAGTTCCTTCGGTTTGTATCTGCCTTTCTTAATTTTGTCGTAATATGATTTTTACGGGTTTAATTTTTTTTAATAGGGGTAGGGTAAATTTAACCCATCCCCTGAATTTGAAAAATCAGAAATTTTCCCCATTGAAGAACAGAAATTTATAACATTTTGTTGTCCAGAGCTTTAAAGTCATATGACTTATCCCCCATGCATAAAGCAGAGTTTTTATGAATTGCTAAACTGCAAAGCCCTTACTGGCCTACATAGAATCTTTACCTAAGCCCAACTGAAATGCCAAATGGGAATCTCCCTTTCTGTTTGTCTGTGTTTGGGAGCATAACTAAATGTGGGCAGTGTTTACCCTTCTAGGGGAAAGCCCTTTTCAGCGGCTTCCAAGCCCAAGACATTAACAGAATTTGCCATCCCAACATCACTGTTTTTACGGAAAAACCCCCTCCCCTGCTTCAAATGAAAGTTAAGGCTTGCCCCCTTTTTAGAATGTTATAAATACCCCTATTTTGGGCAACTTTTAAAAAAAAAAAAAAACTAATTAAGGT
  3   1   2       bld Ova1 5g3  in                         CABE9154.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATCTGCCTTTCTTAATTTTGTCGTAATATGATTTTTACTGGTTTAATTTTTTTTTAATATGCGTATGGTAAATTTAACCCATACCCTGAATTTGAAAAATCAGAAATNTTCCACATTGAAGAACAGAAATTTATAACATTCTGTTGTCCAGAGCTTTAAAGTCATATGACTTATACCACATGCATAAAGCAGAGTTTTTATGAATTGCTAAAGTGCAAAGACCTTACTGGCCTACATAGAATCTTTACCTAAGCCCAACTGAAATGCCAAATGAGAATCTACCTTTCTGTTTGTCTGTGTTTGGGAGCATAACTAAATGTGTGCAGTGTTTAACCTTCTAGTGGAAAGCCCTTCTCAGCAGCATCCAAGCCCaagacattaacagaatctgccatcacaacatcactgttcttactgaaaaaccacctacgctgcttcaaatgaaagttAATGCTTGCACACTTTTTAGAATGTTATAAATACACCTATTCTAGGCAACTTTTACATTATTTTGTATGGTTTTTATTAGCCTTTCTGTTTTAGAGTGCAGCAGACAATGTTTGAATCACTGACCCAGATGGGCTACCGTTGCCCTGCTCAGAAGAACATATAAGGCTTGATATGGAGTGCAAGATTAGTGGTCACTTATCCAGCACTTGGGCTGTGGGCTAAGCTGTGCTCTGCTCCTCCTGCAGAGCCTTATCCCACCACATAAGGCAGGAGGGAGGATTCCTCCTGTGCCACTCCCTCCCCTCAGCAATACAGTGCTGGTGAGCTAAGATGAT
  3   1   0       add Brn4                                CAAL20735.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCTACGCTGCTTCAAATGAAAGTTAATGCTTGCACACTTTTTAGAATGTTATAAATACACCTATTCTAGGCAACTTTTACATTATTGTGTATGGTTTTTATGAGCCTTTCTGTTTTAGAGTGCAGCAGACAATGTTTGAATCACTGGCCCAGATGGGCTACCGTTGCCCTGCTCAGAAGAACATATAAGGCTTGATATGGAGTGCAAGATTAGTGGTCACTTATCCAGCACTTGGGCGTGTGGGCTAAGCTGTGCTCTGCTCCTCCTGCAGAGCCTTATCCCACCACATAAGGCAGGAGGGAGGATTCCTCCTGTGCCACTCCCTCCCCTCAGCAATACAGTGCTGGTGAGCTAAGATGATTAACAGTTTAGTTTAAATTGGGGATACCCCATTAAATGGGACATGGGATA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)