Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012071234 Xt7.1-TNeu063m16.3.5 - 122 ESTs
                                                                       ......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TNeu063m16.3.5                           GCCCGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTAGAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222719                                 TTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATxAxAAxxAAAAAAAAAAAAAAAA
                                                      consensus depths                                4     4     8     8    13    13    14    14    16    16    16    16    16    16    17    17    18    18    19    19    19    19    19    20    20    20    20    20    20    20    21    21    21    21    21    21    21    22    22    23    22    23    23    23    23    23    23    23    24    25    25    26    25    26    26    27    26    27    26    27    26    27    26    27    26    27    26    27    26    27    26    27    26    27    26    27    26    27    25    26    25    26    25    26    25    26    24    25    24    25    25    26    25    26    25    26    25    26    16    26    13    23    14    24    13    23    13    22    12    21    11    20    11    20    11    20    11    21    11    21    11    21    11    21    10    22    11    23    10    22    10    20     9    20     9    20     9    20     9    20     9    20     9    20    11    18    11    17    11    17    12    18    12    18    11    16    11    16    11    16    10    16    12    17    11    16    11    16    11    16    11    16    11    15    11    15    10    13    10    12    10    12    10    11    10    13     9    13    10    13    10    12    10    12    10    12    10    12    10    12    10    12    11    13    12    15    12    14    14    18    14    18    14    18    14    18    16    20    20    22    20    22    19    22    19    22    19    22    19    21    19    21    21    21    21    23    22    23    23    24    25    27    26    28    28    28    28    28    28    28    27    29    28    30    30    30    33    35    34    36    35    41    35    41    35    41    38    43    45    49    47    50    47    51    48    52    52    59    57    68    58    69    59    70    59    71    62    74    63    74    65    75    65    75    65    76    64    75    66    77    66    77    65    77    65    77    66    77    70    76    72    76    72    77    72    76    71    77    73    77    71    77    73    78    71    76    71    76    70    76    71    76    70    75    71    75    69    73    69    73    67    72    67    71    67    71    65    71    66    69    66    69    63    69    60    66    57    61    57    60    54    58    50    55    48    54    41    54    41    53    41    53    41    54    41    54    41    54    40    52    40    52    39    50    37    48    33    45    33    44    33    42    29    41    26    38    24    35    21    33     7    18    10    13
  5   1   2  SIG                                    Xt7.1-TNeu063m16.3               GCCCTTGGCTGTGCCCGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAACATTAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAR5436.3                                      GCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGGTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCAGCAGCNTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTACCCCAAAATTTAAGTGTTATTGGGAGGAATTAACTCATAATAATAATTAACCTGAAATGCTTGTGTAATGCAGAGCATATTGCTGTAGGTAGTGAGCGGAAGGA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --T---------
                                               BLH ATG      48    2231                           
                                               BLH MIN      48     226                           
                                               BLH MPR      39     226                           
                                               BLH OVR      48     230                           
                                               CDS MIN      48       9                           
                                               EST CLI       1       9                           
                                               ORF LNG      48      28                           
                                                                                                                                                          PROTEIN --- Sc ---- 6e-012     NP_010055.1 Zn-finger-containing protein that functions as ADP-ribosylation factorGTPase-activating protein and is involved in regulating vesicle transport; Gcs1p[Saccharomyces cerevisiae] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                        PROTEIN --- Ce ---- 1e-016     NP_499364.1 GTPase activating protein (51.9 kD) [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                    PROTEIN === Dm ==== 6e-043     NP_477239.1 drongo CG3365-PB [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                       PROTEIN === Ci ==== 5e-060     BAE93285.1 zinc finger protein [Ciona intestinalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                       PREDICTED = Sp ==== 3e-065     XP_781727.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                 PROTEIN === Dr ==== 2e-170     NP_956129.1 HIV-1 Rev binding protein [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 0          XP_422611.2 PREDICTED: similar to HIV-1 Rev binding protein [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                 PROTEIN === Mm ==== 0          NP_034602.1 HIV-1 Rev binding protein [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                 PROTEIN === Hs ==== 0          NP_004495.2 HIV-1 Rev binding protein; Rab, Rev/Rex activation domain-binding protein; hRIP,Rev interacting protein; nucleoporin-like protein RIP [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                 PROTEIN === Xl ==== 0          AAH70736.1 MGC83726 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                 PREDICTED = ?? ==== 0          NP_001084973.1 hypothetical protein LOC432032 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                 PROTEIN === Xt ==== 0          CAJ81718.1 HIV-1 Rev binding protein [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu063m16.3.5                                                                           ATG------------------------------------------ATG---------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------TAG---TAG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------TAG---------------------------------------TAA---------------------TAA------TAA---------------------------------------------------------------TAA---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG
                                                                   ORF                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2  SIG                                    Xt7.1-TNeu063m16.3               GCCCTTGGCTGTGCCCGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAACATTAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008276502                     GGCTGTGCCCGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAAxATxAAAAxxAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg036d05.FL-Sanger                                                 TTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAACTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAACATTAGAAAAAAAAAAAAAAAAAAA
  5   1   1           Tbd0 FL                     IMAGE:6977392.FL-MGC                                                     CCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTTCGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGGTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCACATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACTGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTAGAAAAAAAAAAAAAAAAAAA
  5   1   2       ext BrSp 5g3  in                     EC2BBA29AG01.g1 GGGACACGTCACTGGCCCTTGGCTGTGCCCGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAA
  5   1   2       ext Neu  5g3  in                   TNeu086e18.p1cSP6   CCCACGTCACTGGCCCTTGGCTGTGCCCGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCGGAGATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATT
  5   1   3        nb Gas8 5g3  in                          st15g14.5p                         GTGCCCGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCA
  5   1   3        nb Egg  5g                        TEgg136i14.p1kSP6                          TGCCCGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGG
  5   1   3        nb TbA  5g3  in                   TTbA018a12.p1kSP6                            CCCGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTTCGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACT
  5   1   3   12   nb Gas7 5g3  in                         XZG24498.5p ..............................CGGACGCGTGGGCCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCA
  5   1   3        nb Gas  5g                        TGas055g06.p1cSP6                                             GGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTTCGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAA
  5   1   4      seed Egg  FL   in                   TEgg036d05.p1kSP6                                                 TTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAG
  3  -1   3        nb TbA       in                    TTbA075b14.q1kT7                                                  TTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTANACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGANCATTTTCCCCAGTCATCGAGTGCTGACTTTGG
  5   1   2       add Tbd0 FL   in                       IMAGE:6977392                                                     CCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTTCGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGGTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCACATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAAATTTGATGCATTCGGACAATCCAGTGGTGTGAATAATTTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCCGCCCTTAAACACGGGCCCAAACGCCCATGGCCAATTTTGGCTCAGTTTTGACAATTTTTCCCAAAGTCACCGAAGGGGCTGAACCTTTTGGCGCCCCTTTAAATTTAACGGGCAACAAAGCAACTGGGGGCCAAAGGCAAAAACAGGTGCCTTGGAAAAAT
  5   1   3   10   nb Int1 5g3  in                          CAAP746.5p .........................................................................GATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGANAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGGTGCCCAGGCGCATCACG
  5   1   3        nb Int1      in                         CAAP9589.5p                                                                                                                                     AGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATG
  3  -1   3        nb Int1      in                         CAAP3066.3p                                                                                                                                                             GAGAGGCCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAAATCAACGGCACACAGCACGGCGCCCAGCAAAACTGTCTTGA
  5   1   3        nb Tad5      in                          XZT5458.5p                                                                                                                                                                                                            TCGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAACTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTC
  3  -1   3        nb Te5       out                        CAAO4554.3p                                                                                                                                                                                                                                           TCGCGATCTAGAACTAGAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACTGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTC
  5   1   2       add In66                            IMAGE:8963635.5p                                                                                                                                                                                                                                                             CATCCCTGAGGTGGAATGCCAATTCTCTTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAACTTTGCTCAGTTTGACAATTTCCCAGTCATCGAGTGCTGACTTTGGCGCTTCAATTCACGCACACAGCACGCGCAGCAAACTGCTTGATAAATGATCAGCTGCACTGATAAATACCGGCACTCCCTGTCTAACAAATGTTACCCTGTCAGGTGATGGGGTCATCAGCAGCTAGCAAGTTCTGTTTCCTGCACCGTCTGCCAAGGTAAGTCT
  5   1   2       add In66                            IMAGE:8964410.5p                                                                                                                                                                                                                                                                                                                       CTTTTTTTTTTACCCTACATAAAATAAATAAAAAATGTTCTGAGGACGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGGTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAACTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCTGCACGTTCTGGCCCAGCGGTACAAGCCCTTACAGACAACATTGTTTCGGATTGGTTCAGCAGTCTACAGCACACACGCACCTGATGCATCAGCAGCGGAACGTTGCAGCTCTTGCTCTCTACAAATCCGATGTC
  5   1   3        nb TbA                            TTbA042h16.p1kSP6                                                                                                                                                                                                                                                                                                                                  AACATGGCAATGATGTATGCAAACGAATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTGTACATACCCTCAGAGAGTAAAAGAATTCCTCCCGGACAAGTATGAAAAGAATAGGTGGTACGTTCCTCGAAAACAAGCCAAGGTGGTCCCGTCTGTTCATGCTTCTATTTCAAGGTCTTCTGCTAGCAGTGCAAGAAGAACACCGGAGGTCA
  3  -1   3        nb Int1      in                         CAAP7925.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGTCTCCGGTCGTCACACGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCATTCCATGCTTTCAACCAGACCGACTAGCGACAGCCGC
  5   1   2       ext Neu       in                   TNeu063m16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTG
  5   1   2       add Tad5      in                         XZT27121.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTTTGATATAAAGCATTTATGGGAATCAAAACCTATTTCTGATTGGCTGCCTTTGCAGGGTCAGTATTAGCACTAAGAATCATACTCCCCAGGGCACACTCTCTCTCAGCTTGCTTTGCTGTAAATCCATAAATGTGTTCTTAGGAGGTTTTGAGTTATCACCGCTTTTCTTTCAGGCACAAACGCCAATGCAAACTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCC
  5   1   2       add Int1      in                        CAAP14973.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTGCTTTCATTGTTTTTACCCAAGCCTTGACTATAGAAAGGAAATGGCACAGATGCTCTCTCTTGTGCTTCAAAATTAAATCCAGCTCATAAAGCAGATCTATATTTGCTTTTATTTCTTAAGCTTGCATGTTAGCTGCTCTGTTATGCATTGTGTGTCATTTTCACTGCACCCTTCCTGCCGGAGGGTATATGTACCTTATCTTAAATTCCATCAAGTTCTCAAAGCAAATATCTGTTAGTGCTACAGCAGAATCAGCCCTGTGTGTCTGAGTGCAGTGCCACCCAATGCCAGAACTTTGTTCTTATTCATTTAATGTTTTGTAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGC
  5   1   2       ext Ovi1      in                         CABI5895.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGT
  5   1   2       add TpA                            TTpA076d21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCTGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACTGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCNAGTTGCAGCTCCCTCAACAGCCTTTCCCCAACAGACTGCTTTCTCGCAGCAGCCTA
  3  -1   3        nb Liv1      in                        CAAR10497.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCAATGCAAACTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTTCAACTGG
  5   1   2       ext Ski1      in                         CABJ3323.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCACTGGAANGTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAG
  5   1   3        nb Gas7      in                         XZG18958.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACACACACCATACAGTCTTCCCACAAGCTTTGGTGGGAGTTTCCACCAACCTGCCTTCGCCCATCAAAACAACCTTCCCCCAACA
  5  -1   0       chi Int1      out                        CAAP8862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAATGTTATCCCAGAGTAACATCAGACAACATATGTCCTGCTTATATTACTTGGCAATGTGGCAGGGTTTGCTGAATGTTTTGTAAAATATATGGATATTATAAGTTCCATGACCATAGAAATGCATATTACATAGGTAAAAATACAGGTCATGGTAACATAACACAATTTATAGAATATAATTTACAGGATAATTATGGCTCTTGTGTATTATATAAGTTTTACCCCCCTCCCCTTGTAAAAGATGAGGATATTATGACTAACCAGGGCATTCCATTACCATTTCAAGCTACCATTGCTTTTATATAGGTCACAAAACTCCAAGGTGGTGTTGAGTATCCTCCCATTTCACTTTTTTAGGTACATTATCTCTTATAATACACAAGATTTAGAGAGTCATCTGACACAGTTTATATACTGTATATATGTAATAGTTTACCGTGTATTTCAAATTAGAAGGATTTTAGAAGCCACGTGGTAGTGATGGCTGAGAAAAATGAATGGATTTGTCTTTACATTTTACTGGCTGTAAGAACCAGTAACTCCTAAACCCTTATTTTAAATTGGGATAAAAAGCTACATGAACTAAGTGACCCATAAGCTAAACGAAGGCAGAGAAAGCAAAGCATACTGATTCTGTCTGTCTGTCTGTCTTTGCAGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATT
  5   1   2       ext Lun1      in                        CABD10464.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTTCCTGCACCGTCTGGCCCAGCGGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTC
  5   1   2       add Te1       in                         CBWN5187.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTATTGTTATCATATTATTAATAATTATAAAGGCTGCCTTTGATTGTCTTTCAGTAAAAGAAAAAAGTAGTAAAACAACCTAAAGTACTGAACAAATAGTCTGACATTTTAGAGAAATACATATTAAAAAGAATGTGCCTTTATTTCTTGTGCCTATATATCTCTGGGCTGTTATTTCATATGTTGCTGTTAGTTCATTAATGATATGGCCTATTGCTATATGATCTAGGCATAACCATATTCTGAGAAACCTTTTGCAGTAGAATGAGTTATTTATCTTCTCTCCACAGCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTACCCCAAAATTTAAGTGTTATTGGGAGGAATTAACTCATAATAATAATTAACCTGAAATGCTTGTGTAATGCAGAGCATATTGCTGTAGGTAGTGAGCGGAAGGATATAATTGTAGTTAAGCAAGGACATTCCCTGATGCGCAGCTGAAATTCAGTGAGAGATTGTGGAATATCCGCTTACCCCT
  5   1   2       add In63                            IMAGE:8960566.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCTCGGGCCCCTTCTGTGTACCAGCCCCTACAGACAACAATGTTTTCGGATTGGGTTCAGCAGTTCCCACAGCACACACGCACCCTGTTGCATCAGCAGCGGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTTCTTTCAGAGCCTGCAATTATATATAATATTTTTTTTGTTTAAACAAAAAGAGGACAACAGGTAATATGTTGCAATTGGAAAGCTTTTAGCATCAAACCTTCACTGCTGAGTTTGACTGTAATCTTAGACAGATGAAAATCATAGCTCTTTCAGCACGCGAAGGCTCAACCTGAGAGCTGTATAC
  5   1   3        nb HeRe                             EC2CAA29AC12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGACCCTTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCCAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAAGCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTC
  5   1   3        nb Gas                            TGas050l18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTGCAGCTCCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAAGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTT
  5   1   2       add Tad5                                 XZT53848.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGCCTCTACAAATCCGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTACCCCAAAATTTAAGTGTTATTGGGAGGAATTAACTCATAATAATAATTAACCTGAAATGCTTGTGTAATGCAGAGCATATTGCTGTAGGTAGTGAGCGGAAGGATATAATTGTAGTTAAGCAAGGACATTCCCTGATGCGCAGCTGAAATTCAGTGAGAGATTGTGGAATATCCGCTTACCCCTGAAATTACATTTTTCTGAGCCCCAAATTAGCACTACATTAGTAGAAACTGTGATTTAACTACTCTCTAAGCCAAGTTGCTTTAATCCAGAAAACTGATCCTTGGGGCAGGTTATTTTTGGGATCCCTTAAATTCATTTGCATTATAGAAATCATGCACAGTGAAACTGAAGATAACCTCTGTTTTTGTCTCTTAGTTTAGTGTATGTCTTGTGTTAGCCTGAGGCAAGTTTGATTTTGCAGGTAAAGCCGGCCATACACTTAAAGATCCACTTGTTCCATGAGGTCCAAAGATCAAATAATAATGCTG
  5   1   3        nb HeRe                             EC2CAA14CD02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACCAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAAC
  5   1   3        nb HeRe      in                     EC2CAA14DD02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGTTTGTCTCAGCCTCTGTGGCCCCTGCAGTTAATCCATTCCAGACTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATG
  5   1   2       add In66                            IMAGE:8966089.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGTATTTTTTAAACACCCAAAAAAAAAAATTTTCCCTTTCAGACTAATGGCCGCGCACCTCCAGGCTGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTCTAGGACTAGTTATTATTCATATCCAGTATTTCTAACTTCTTAACACCGTACCGGATGCTGGAGGCTGGAGCAGTTCGGAATCATTCACTAAAATGAGTACACATGCTACATCTGTCTCAAAGCGAAGTGAGAGTACC
  5   1   2       add Thy1      in                       CBST12846.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCACTTTGGTATATTAACTGAATAAGTGGTTTCTTTTGTTACAACTGCTTTTCCATTGCTAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTA
  5   1   3        nb Brn4                                CAAL23500.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTAATGGCCGCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTTACACCGTA
  5   1   0       chi Spl1      in                        CABK10509.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCATCGCATTCGGAGAAAATAATAAATGACAATGTTTTATATTACAAAATGTAATAAATTGGTCAAACTTGATAAAACATATAAAAAGAGAATATATGCCACAATGGAATAAAAACATTGCGTTATTTAGCTAAAGGGGGATGCAGTATGTTTCAGTGTCAGTGACCATGCCTTTGCAATGTACCATCCAGTTTTAATGTGTAATTCAAGCCGATTCAGAATATTTTGCTGAAATATTGATTCTTTCTGTTTTGGTATTTTTTGTGCCTAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCT
  3  -1   3        nb Int1      in                         CAAP8077.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGCACCTCCAGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCT
  5   1   2       add Int1      in                        CAAP12998.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCATTAATCATATGGCCTATTGCTATATGATCTAGGCATAACCATATTCTGAGAAACCTTTTGCAGTAGAATGAGTTATTTATCTTCTCTCCACAGCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTACCCCAAAATTTAAGTGTTATTGGGAGGAATTAACTCATAATAATAATTAACCTGAAATGCTTGTGTAATGCAGAGCATATTGCTGTAGGTAGTGAGCGGAAGGATATAATTGTAGTTAAGCAAGGACATTCCCTGATGCGCAGCTGAAATTCAGTGAGAGATTGTGGAATATCCGCTTACCCCTGAAATTACATTTTTCTGAGCCCCAAATTAGCACTACATTAGTAGAAACTGTGATTTAACTACTCTCTAAGCCAAGTTGCTTTAATCCAGAAAACTGATCCTTGGGGCAGGTTATTTTTGGGATCCCTTAAATTCATTTGCATTATAGAAATCATGCACAGTGAAACTGAAGATAACCTCTGTTTTTGTCTCTTAGTTTAGTGTATGTCTTGTGTTAGCCTGAGGCAAGTTTGATTTTGCAGGTAAAGCCGGCCATACACTTAAAGATCCACTTGTTCCATGAGGTCCAAAGATCANATAATAATGCTGCTTTTCCTTTGATTGAGGACCGCATCAACACACAGATCCAGTCCTTGATTTCACAGGAATATCAAATGTGCCCGACACCTGGCTGATTTGTGTCCAG
  3   1   3        nb TbA  5g3  in                    TTbA018a12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGGTACGAGACGGCCACGCGGCAGAAGCCCCATTCCATGCTTTCCACCAGACCCGACTAGCGACAGCCGCAGGAGCATTGGATGTCTCTTCCTTTGGCACAGCATCTCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTAAAAAAAAAAAAAAAAAAAGCG
  5   1   3        nb Egg                            TEgg139c19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGAATCCCCCCTAAGCATGCCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTG
  3   1   3        nb Gas8 5g3  in                          st15g14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCACAGCATCTCTAAGCATGCCGCTGGCTTTGGAACACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTG
  3   1   0       chi Spl1      in                        CABK10509.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGGGGATGCAGTATGTTTCAGTGTCAGTGACCATGCCTTTGCAATGTACCATCCAGTTNTAATGTGTAATTCAAGCCGATTCAGAATATTTTGCTGAAATATTGATTCTTTCTGTTTTGGTATTTTTTGTGCCTAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCC
  5   1   2       ext Gas       in                   TGas143h15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCTTTGGAACACAGACACCATACAGTCTTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATAT
  5   1   3        nb Brn4      in                         CAAL9466.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGNGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTG
  3   1   3        nb Gas7      in                         XZG18958.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACAGACACCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGTTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAAAAAAAAAAAAAGG
  5   1   2       ext Lun1      in                        CABD12432.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGACACNCATACAGTCTTCCTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAA
  3   1   3        nb HeRe      in                     EC2CAA14DD02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGACACCATACAGTTCTCTTACAAGCTTTAGTGGGAGTTTCCACCAACCTGCCTTCGCCCCTCAAACAGCCTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATT
  5   1   3        nb Gas7      in                         XZG37046.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCCCCTCAAACAGCTCTTCCCCCAACAGACTGGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAA
  3   1   3        nb HdA       in                    THdA049c15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTCCCCCAANCAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCAC
  5   1   3        nb HdA       in                   THdA049c15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTCCCCCAACAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGG
  5  -1   3        nb Int1      in                         CAAP7925.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGACTGCTTTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGCGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACA
  3   1   2       add Tbd0 FL   in                       IMAGE:6977392                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTCGCAGGCAGCCTTAATGGGAAATATACAAAGGTGCAGGGTTTTGCTGTATTTGGGCAGACCCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCGTA
  3   1   2       add Int1      in                        CAAP14973.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCTCGCAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTGCTACAGTTT
  3   1   4      seed Egg  FL   in                    TEgg036d05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAACATTGAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Neu       in                    TNeu063m16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGCAGCCTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTGAAAAAAAAAAAAAAAAAA
  5   1   3        nb Tad5                                 XZT45345.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTAGAAAAAA
  5  -1   3        nb Liv1      in                        CAAR10497.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATACAGGTGGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTGTTACTCCGTTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAACATTAAAAC
  5  -1   3        nb Int1      in                         CAAP8077.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CANGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTG
  3   1   2       ext Ski1      in                         CABJ3323.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTAG
  3   1   2       ext Ovi1      in                         CABI5895.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGGTTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATT
  3   1   2       ext Neu  5g3  in                    TNeu086e18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGACCAAGCCTGTTGTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAACATTGAAAATGAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7 5g3  in                         XZG24498.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCAAAAAAAAAAAAAAAGG
  3   1   3        nb Int1      in                         CAAP9589.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTAG
  3   1   3        nb Gas                             TGas056h23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTTTTCAGCAGCGAAGGGTCTAACCTGAGGGGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTTTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAACATTGAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas       in                    TGas143h15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACNTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAANNTAAATATTAAAACATTAGAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Lun1      in                        CABD12432.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAAC
  3   1   2       add Tad5      in                         XZT27121.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAACATT
  3   1   2       ext Lun1      in                        CABD10464.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAACATTAG
  3   1   2       ext BrSp 5g3  in                     EC2BBA29AG01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAA
  3   1   3        nb Gas                             TGas113k22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTAGAAAAAAAAAAAAAAAAAA
  3   1   2       add Thy1      in                       CBST12846.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATT
  3   1   3        nb BrSp      in                     EC2BBA16DC12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATATTTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAACATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCGGA
  5   1   3        nb BrSp      in                     EC2BBA16DC12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATATTTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAACATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb BrSp                             EC2BBA21AG08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCG
  3   1   3        nb BrSp      in                     EC2BBA19BF11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTTTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACA
  3   1   3        nb BrSp      in                     EC2BBA34BA01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACC
  5   1   3        nb BrSp      in                     EC2BBA16BB12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGGACCCCATGCTGGAGAGCT
  5   1   3        nb BrSp      in                     EC2BBA25DH11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGGTGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAAATTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAAT
  3   1   3        nb BrSp      in                     EC2BBA27CH04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATCCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCACATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTAAA
  5   1   3        nb BrSp      in                     EC2BBA34BA01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb BrSp      in                      EC2BBA9DG05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTTTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTTCATTAAGCTGCAGTACTGTACATATATTTTCTTTAGGGA
  5   1   3        nb BrSp      in                     EC2BBA27CH04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATCCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCACATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATATTAAAGCTAAT
  5   1   3        nb BrSp                             EC2BBA35BH08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATGTTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTA
  3   1   3        nb Tad5      in                          XZT5458.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAACTTG
  3   1   3        nb BrSp      in                     EC2BBA16BB12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTATGCTACAGTTTGCAG
  5   1   3        nb BrSp      in                     EC2BBA19BF11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAGCTCATCCACGAACCCTTTCTTATAGCCTTACACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCC
  5   1   3        nb BrSp      in                      EC2BBA9DG05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTTTTATAGCCTTATACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTATCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCATAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGAACCATCACTTAAAATGGAAAAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCA
  5  -1   3        nb Int1      in                         CAAP3066.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAACCTCGTGCCGA
  3   1   3        nb BrSp      in                     EC2BBA25DH11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGGTGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAAATTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTAA
  3   1   3        nb Gas7      in                         XZG37046.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCGGCAATTATATATATATTTTTTGGTATTTAACCAAAAAAGGAGGCCAACCAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACCCCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTGGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACC
  3   1   2       add HdA  5x3  out                   THdA001k23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCTTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGTTTTTCAGCAGCGAAGGGTCTAACTTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGGTGCAGTACTGTACATATATTTTTTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACCTCTTAACACCGTACCCGATGTTGGAGAGGTGGAGCCGGTTCCGGATCCATCATTTAAAATGGAAAGAAAAAAAAAAATTTGTTTTTACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTGTTTGCCCAATAAAGCTACCCATTTATATGCGCCTAATTTCCaaaaaaaaagaataatataaaaataaaaaaaaaaaaaataaaatacaataagcaggtgaaaataaatattaaaatataaaaaaaaaaaaaaaaaaaaGC
  3   1   2       add Te1       in                         CBWN5187.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTAGAAAAAAAAAAAAAAA
  3   1   1       add Int1      in                        CAAP12998.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGCCCCAAATTAGCACTACATTAGTAGAAACTGTGATTTAACTACTCTCTAAGCCAAGTGCTTNNAATCCAGAAAACTGATCCTTGGGGCAGGTTATTTTTGGGATCCCCTAAATTCATTTGCATTATAGAAATCATGCACAGTGAAACTGAAGATAACCTCTGTTTTGATCTCTTAGTTTAGTGTATGTCTTGTGTTAGCCTGAGGCAAGTTTGATTTTGCAGGTAAAGCCGGCCATACACTTAAAGATCCACTTGTTCCATGAGGTCCAAAGATCAAATAATAATGCTGCTTTTCCTTTGATTGAGGACCGCATCAACACACAGATCCAGTCCTTGATTCAACAGGAATATCAAATGTGCCCGACACCTGGCTGATTTGTGTCCAGATATTGGATGAGTAGGCCCAGACATAGGCCAATTAGCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCATTAGTGCTTGGATGTCTCTAGAATCTTGTCTGCTCCTTTATGGCATCTTCTGACTTCTTACAGTACAGAGATATTAAAATGTACATGCTCCTTACAAAGAAAATCCCAGTGATAACTGCAAAGTAGCATCCGTACACCAAAAACTGAGTAACAATGTCCAATGCCAGGCCTCGAGGATCAACCACAATGAGTGTCAGGATGGTCTGAAGAGCCAGAGCCACAAAGGTGTTAACCCCAAACATTAGAGCATAACGTTCCATGCTCAGATTAACAGCAATCTGGAACGTAGCAATGGTGATGAGGAGCATGTATGATGCTTTGAATATCAGGTACCCAGCATAGCACATCCAGATATTGGTGCTATAATCCATAAGGAATAGGGCTCCCGCATCCACCGCAGAGAAGATGGCAAGCGCCAGGCTCTCGCCCTATAG
  5   1   2       ext Gas7      in                         XZG46155.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAACATTAAAAAAAAAAAAAAAAATAAATAAAAAAAAAAAAAAAAGG
  3   1   2       ext Gas7      in                         XZG46155.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGTGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAACCCTT
  5  -1   2       ext Neu                            TNeu038n05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTAGAAAATGAAAAAAAAAAAATAAAAAAAAAAAAAAAAAAGCGGC
  3   1   3        nb Brn4      in                         CAAL9466.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTAG
  3   1   3        nb Int1 5g3  in                          CAAP746.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CANTTGAAAGCCCTTTTAGCATCAAAACCCTTCACTGCTGAAGGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTAGAAAATG
  5  -1   3        nb TbA       in                   TTbA075b14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAAGGAAAGAAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCGGGTGAAAATAAATATTAAAATATTGAAAAAAAAAAAAAAAAAAAAAGCGG
  5   1   0       add Tad5      in                          XZT1448.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACCCCAGTGCAAGCAGATAGAAGAAGACCCTTATCCAAAGCCTACAATTCAGAGTTTGTGTGATTGTCCATTACAAACACTGGGGGTCGTTTATCAACACTGAGTAAATTTGCCCATGGGCAGTAACGCTTAGTTGCTCTACCCAAACCTGGCTGCTGAAAAAATGCAATTGCTGATTGGTTGCTGGTGGGTTACTGCCCATGGGCAGGTTTACCCAGTGTTGATAATTGCCCACTACTAATACCTTTAAACATATGTTCCTTGAATAGCAGGGACCTTACTTAGTGCTTGGATGTCTCTAGAATCTTGTCTGCTCCTTTATGGCATCTTCTGACTTCTTACAGTACAGAGATATTAAAATGTACATGCTCCTTACAAAGAAAATCCCAGTGATAACTGCAAAGTAGCATCCGTACACCAAAAACTGTAGAGAAAGAAGACAAACAGGCTGTCAGTTACAAAAATGGGCTTCTAATTGGGAGAAATCGGTACTAAACCACAGATCAGATCAGTCACTGGGCAGCAGGACATGTCCTTCAGCATGAGATGCCATATAATAATATTACTGGATCTTTGTTTAGACGTGTGGCTTTGGAATTAATGCATAGTGTTTTGATTCAGTCAGATAAATGCCACTTTACCAACGTGAGGCTTCAGTCTAGATTGGCGATTCTTCTAGGTGCCATAATGTTTGATTGTTGGCCCTGTGTCATGCAGGT
  3   1   0       add Tad5      in                          XZT1448.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTGTCAGGCAGGTGTAATAAATCTCCTATCTCTGCATATTTTTTAATTATGCCACAGTTTGGTGTCTAAAAAAGCAGTACAAAATATAAATACCTCTGTAGGAAAAAGTCACTGCCATCGGAGCAGTGGAAATGCATTCTTTGGAGTGATAAGTGGCATGTCTCCATTTACAAGTCTGATGGAAAAGTCTTTATTCAAAATGCCGCAGAAACATTCCTTGTATGAATGAATAATGTCAACACTAAAGTTTGATGGAAATATATAATGGTCTGGGGCTGTTCTAAATCTTGTAACACTTCTAAGAAAATTTTTTTTACAGAGTATTTGACTTTGGTTTTTTTTTGTTTTTTTTTAAATATTGGTTTCCACACCTGAGTAACAATGTCCAATGCCAGGCCTCGAGGATCAACCACAATGAGTGTCAGGATGGTCTGAAGAGCCAGAGCCACAAAGGTGTTAACCCCAAACATTAGAGCATAACGTTCCATGCTCAGATTAACAGCAATCTGGAACCTAAGGAGAGAGCATTATTTGTCATTTTAACCCACTCCACTCTGATTTGTCCTTGTGTGAAATAGTAGCTTAGTTTTATTAAATATAAATATGATATTGTTTTATAATGTAATAGCAATAAAAGGG
  5   1   3        nb Gas                            TGas043a14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAR5436.3                                      GCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGGTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCAGCAGCNTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTAGA
                                                  Xt7.1-CHK-1008276506                                            CGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGGTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCNTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAAT
  5   1   2       ext Egg  5g                        TEgg092m24.p1kSP6                            CCCGCTTGGTGCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGGTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCAT
  5   1   2   12  ext Tad5 5g3  in                         XZT45925.5p .....................................GCCGCCCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGGTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAAAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACC
  5   1   4   10 seed Hrt1 5g3  in                        CAAQ11676.5p ..........................................CCGGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGGTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGAAGCTTTCCCCCATCAAGTCAGACACCCACCC
  5   1   3   12   nb Gas7 5g3  in                         XZG44830.5p ............................................GGTGTTTCCCGGTGTGAGTTGCCCCCAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGGTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTA
  5   1   3        nb TbA  5g3  in                   TTbA060g16.p1kSP6                                                                      CAAGGATGGCGGCCAGCGCGAAACGAAAGCAGGAGGAGAAGCATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGGTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGC
  3  -1   3        nb Ovi1                                 CABI8062.3p                                                                                                     AGGAGGAGAACATCTCAAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGGTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACA
  5   1   2       ext Ovi1      in                         CABI7430.5p                                                                                                                     AAAATGCTTCGGGAGATGACCAGCCTCCCGCACAACCGCAAATGTTTCGACTGTGATCAGCGCGGCCCGACATACGCCAATATGACTACGGGGGCCTTCGTGTGCACGTCCTGTTCCGGAATCCTGCGCGGTCTTAACCCACCCCACAGAGTGAAGTCAATCTCTATGACTACGTTTACACAGCAAGAAATAGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGGTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAA
  5   1   2       ext Int1      in                         CAAP9590.5p                                                                                                                                                                                                                                                                                                                    AGAATTCCTACAGAAGCATGGCAATGATGTATGCAAACAGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGGTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTTAGACATATGTTTAGCACTGTTC
  5   1   2       ext Liv1      in                         CAAR5436.5p                                                                                                                                                                                                                                                                                                                                                          AGATATGGCTAGGATTATTTGATGACAGATCTTCTGCAATCCCAGATTTTAGAGACCCACAGAAAGTAAAAGAATTCCTCCAGGAAAAGTATGAAAAGAAGAGGTGGTACGTTCCTCCAGAGCAAGCGAAGGTGGTCGCGTCTGTTCATGCTTCTATTTCAGGGTCTTCTGCTAGCAGTGCCAGCAGTACACCGGAGGTCAAACCACTGAAAACACTTTTAGGCGAGGGTGCACCAGCACTGCAGTTGAACAAAGGGACCCCTAGCCAGGTGAATGCTAGAGAGTCTCCGGTCGTCACTCGAAATCAGGTGCCCCAGGCGCATCACGAGAAGAAACAGTTTGACCTTCTGAGTGACCTTGGAACAGATATCTTTGCTGCCCCTGCCTCCCAGCCCGCTGCCAGCGCCAACTTCGCCAATTTTGCTAATTTCAACAGTCACACAGCTCACAATTCTGCCCATGCAGACTTTGCAAACTTTGATGCATTCGGACAATCTAGTGGTGTGAATAATTTTGGAGCTTTCCCCCCATCAAGTCAGACACCCACCCCGCCCTTAAACACAGGCACAAACGCCAATGCAAATTTTGCTCAGTTTGACAATTTTCCCAAGTCATCGAGTGCTGACTTTGGCGCCTTCAATTCAACGGCACACAGCACGGCGCCAAGCAAAACTGTCTTGAGTAAAATGAGCCAGCCTGCAGCTGATAAATACGCGGCACTCGCTGATCTAGACAATATGTTTAGCACTGTTCAAGGTGGAGGTGGTGGTCAATCAAGCAGCTATAGCAGCACGTCTGTTCCTGCACCGTCTGGCCCAGCGGTACC
  3   1   4      seed Hrt1 5g3  in                        CAAQ11676.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCTCGCAGCAGCNTAATGGGAATATACAAGGTGCAGGGTTTGCTGTATTTGGGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAANTGTTTTGCTACAGTTTGCAGGTGAAAATAAACCTCTCGCCCTATA
  3   1   2       ext Liv1      in                         CAAR5436.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCAGACCAAGCCTGTTGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATT
  3   1   2       ext Ovi1      in                         CABI7430.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTTACTCCGTTTGGCCAGGTTGCAGCTCCTGGAGTCTCTAGCAATCCTTTCATGGCCGGGGCACCTTCGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTAGAAAATG
  3   1   3        nb Gas7 5g3  in                         XZG44830.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCGGGGGCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATT
  3   1   2       ext Int1      in                         CAAP9590.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGCAGTTCCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGACTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTAGAAAATGC
  3   1   2       ext Tad5 5g3  in                         XZT45925.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAGTTTCCAACTGGAAGTTCATCCACGAACCCTTTCTTATAGCCTTAGACTAACACAGGAGATTACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTCTTCAGCAGCGAAGGGTCTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTCTTAGGGATTAGTTAATTATTCATATCAGTATTTCTAACTCTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTCTATGCGCCTAATCTCCATACTAAAGACTCATCTCTGCATAATAAAGCTAATGTTTTGCTACAGTTTGCAGGTGAAAATAAATATTAAAATATTAG
  3   1   3        nb TbA  5g3  in                    TTbA060g16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACCGGGCATCACCGTACATGTACTGCCTCTTGCACTGTTTGTCTTGTTTAACCAGCGTAAGCTTTAAACACAGGGAGTTCTTTCAGAGCCTGCAATTATATATATATTTTTTTGTATTTAAACAAAAAAGGAGGACAAACAAGGTAATATGTGCAATTGGAAAGCCTTTTAGCATCAAAACCCTTCACTGCCTGAAGGTTTGACTGGTAATTTCCTAGCAGAGCGGAGAGTCAATAGCTTTTCAGCAGCGAAGGGTTTAACCTGAGGCGTATCATGTATATTAAATTTGGTAAGTTATTGCAGATTCCATATTCATTAAGCTGCAGTACTGTACATATATTTTTTTAGGGGCTAGTTAATTATTCATATCAGTATTTTTAACTTTTAACACCGTACCCGATGCTGGAGAGCTGAAGCAGGTTCCGGATCCATCACTTAAAATGGAAAGAAAAAAAAAATTTGTTTTAACAATCTGGTTTCAAAGGGAGTGGGGATTGCAAAAGCAATGTGGTCTTTATTACAAATTTTATTTGTTGACAAAAGACAAACTTTTATTTTGCCCAATAAAGCTACCCATTTTTATGAAAAAAAAAAAAAAAAAAAAAAAGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)