Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 95%

 1012071261 Xt7.1-TTpA016f19.5 - 125 ESTs
                                                                       .........-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA016f19.5                                                                                                                                                                                              TTCTGTGTCGCTGTGGTTTGTGTTGCGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACTTTTTTTGTGTTTTATTTTTTTGCTCTGGAATAAATAACGGTCATTAAATGTGCAGCCCCCAAAAACACTAGTCATCTTTGATGACTAAAAGAATCCTGCACCTTAACAGATGCTCACATTATTGATTAATTTGTAGGGATGCACCAAATCCACTATTTTGGGATTTGGCTGAATGCTGTACTGAATCCGAATTCTAATTTGCATGTGCAAACTAAGGCAGGGAAGCTTAAAAAAAAAACTGGGCGTGCAGTATGCGGAAAAAAACCTTCCAATTTCCGCATTTATGTGGTGAAAAGACGCATCATTTTAAGGATTCTGTCCAGCCAGGACAATGGATTCAGCCGAATCCTGCTGAAAAAGCCTGAATCCCAAAGCAAATTCTGGATTCGGTGCATCCCTATTGATTTGCCACTGTTCATTTTCTGACGTGACATCCAGATGAGTAGAAAAAGAATGTCCTTGAATTTGACATCCATGTTCTTTAGATACATTAGGTTAATTATTAGTCATAATTGGATGTGGAATCTCTGAAATATTATCCAGCTGAAAAGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAAATTTAATCAGACCGTCTTTACCCACATTTACTTTCAAGGACATTGAGAAATTGGCTTTCTGTCAGTGACTTTCTTTACTGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAGTACTCAAAATTTTCATGGCAATAAAAGGCTTTGATTAATATTAGGAGAATTAAATAATTGTTAAAAAAAGGTAACATTAGCCATCATCATAATTCGCAGTTGGATAGGCCTGCCCCAGCCGCCCGTTATTGTTTCATTTATTTATTTTATAACATTCAGCCCTCTCTCTGCATCTAATTGTTTTGTGACGGGGCCCTGAATGTCAAGTTCTGTGGGGAGCCCTAAGAGGCCCTAACAGTCTCTTTCTAGGTTTGTTTTCTCAGTTTCTATATGCAAATCAAAGAAAAAGTTATGTTCACTGCAACACAACAAAGTGAAAATGCAATTATTAGATTTCCTTTATGTAAATATATAGATATTGAGCAGTTTAGGCCTCTAAATGTCAATTTTAATAGGTTGTTCACCTATAAATTAACTTTGAT
                                                  Xt7.1-CHK-1008222672                                                                                                                                                                                                    GTCGCTGTGGTTTGTGTTGCGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACTTTTTTTGTGTTTTATTTTTTTGCTCTGGAATAAATAACGGTCATTAAATGTGCAGCCCCCAAAAACACTAGTCATCTTTGATGACTAAAAGAATCCTGCACCTTAACAGATGCTCACATTATTGATTAATTTGTAGGGATGCACCAAATCCACTATTTTGGGATTTGGCTGAATGCTGTACTGAATCCGAATTCTAATTTGCATGTGCAAACTAAGGCAGGGAAGCTTAAAAAAAAAACTGGGCGTGCAGTATGCGGAAAAAAACCTTCCAATTTCCGCATTTATGTGGTGAAAAGACGCATCATTTTAAGGATTCTGTCCAGCCAGGACAATGGATTCAGCCGAATCCTGCTGAAAAAGCCTGAATCCCAAAGCAAATTCTGGATTCGGTGCATCCCTATTGATTTGCCACTGTTCATTTTCTGACGTGACATCCAGATGAGTAGAAAAAGAATGTCCTTGAATTTGACATCCATGTTCTTTAGATACATTAGGTTAATTATTAGTCATAATTGGATGTGGAATCTCTGAAATATTATCCAGCTGAAAAGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAAATTTAATCAGACCGTCTTTACCCACATTTACTTTCAAGGACATTGAGAAATTGGCTTTCTGTCAGTGACTTTCTTTACTGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAGTACTCAAAATTTTCATGGCAATAAAAGGCTTTGATTAATATTAGGAGAATTAAATAATTGTTAAAAAAAGGTAACATTAGCCATCATCATAATTCGCAGTTGGATAGGCCTGCCCCAGCCGCCCGTTATTGTTTCATTTATTTATTTTATAACATTCAGCCCTCTCTCTGCATCTAATTGTTTTGTGACGGGGCCCTGAATGTCAAGTTCTGTGGGGAGCCCTAAGAGGCCCTAACAGTCTCTTTCTAGGTTTGTTTTCTCAGTTTCTATATGCAAATCAAAGAAAAAGTTATGTTCACTGCAACACAACAAAGTGAAAATGCAATTATTAGATTTCCTTTATGTAAATATATAGATATTGAGCAGTTTAGGCCTCTAAATGTCAATTTTAATAGGTTGTTCACCTATAAATTAACTTTGATGTAGAT
                                                      consensus depths                                                                                                                                                                                                   5     5     6     6    12    12    22    24    28    35    33    39    37    43    37    46    38    47    45    47    45    47    45    48    45    49    48    49    48    50    48    51    49    51    50    51    50    51    50    51    51    52    51    52    52    53    52    53    53    54    53    54    53    54    54    54    54    54    54    54    54    54    54    54    55    55    54    54    54    54    54    54    55    55    55    55    55    55    56    56    58    58    59    59    55    59    55    59    55    58    55    57    54    57    54    56    52    54    49    51    49    50    45    47    45    47    45    48    46    48    46    48    45    47    44    46    45    46    43    45    40    42    39    40    37    38    37    38    34    36    32    35    31    33    29    32    28    31    27    30    23    26    22    25    22    25    21    25    18    23    23    27    24    29    26    29    25    28    27    29    27    29    28    30    28    30    30    31    29    30    30    31    30    31    30    31    30    30    31    31    32    32    32    32    32    32    35    35    36    36    35    35    35    36    36    38    32    34    33    34    32    34    32    34    33    35    34    35    34    35    35    35    34    34    34    34    33    34    34    35    34    35    34    36    33    36    35    35    35    35    35    35    34    34    34    34    33    34    34    35    35    36    36    36    36    36    35    36    35    35    34    34    34    34    32    34    31    34    33    34    33    34    32    34    32    33    31    32    31    32    31    33    32    33    31    32    30    31    30    30    29    30    12    13    11    12    13    13    13    13    11    11     9    10     8     8     8     8     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    10    10     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    14    14    14    14    15    15    14    17    17    19    17    19    18    19    18    19    20    21    20    21    20    21    20    21    20    20    19    20    20    20    19    20    19    20    19    20    18    19    19    19    17    20    19    21    19    21    14    16    15    16    11    16    12    16    12    16    11    16    11    16    11    16    10    15    11    15    11    15    10    15    10    15    11    15    11    15    10    15    11    15    10    15     6    12     4    11     4     8     5     7     4     6     4     6     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          G-----------
                                               BLH ATG      42    1057                                                                                                                                                                                              
                                               BLH MIN      42     140                                                                                                                                                                                              
                                               BLH OVR      42      52                                                                                                                                                                                              
                                               CDS MIN      42      37                                                                                                                                                                                              
                                               EST CLI      35      37                                                                                                                                                                                              
                                               ORF LNG      42       8                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Cs ---- 4e-007     BAC05519.1 putative TCF coactivator [Ciona savignyi] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 3e-009     NP_573325.1 CG6961-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                 PREDICTED = Sp ==== 1e-023     XP_787816.1 PREDICTED: similar to DNA polymerase delta interacting protein 3 isoform 2 [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 4e-131     NP_848742.1 polymerase delta interacting protein 46 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PROTEIN === Gg ==== 3e-133     NP_001012832.1 DNA polymerase delta interacting protein 3 [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 1e-134     NP_115687.2 polymerase delta interacting protein 46 isoform 1 [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 0          AAH73024.1 MGC82630 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === ?? ==== 0          NP_001085615.1 MGC82630 protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 0          CAJ83463.1 polymerase (DNA-directed), delta interacting protein 3 [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA016f19.5                                                                                                                                                                                                                                        ATG---------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------ATG------------------------------------------------------------------------TAA---------------------------------------------TGATGA------------------------------------------TAA---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------ATG------------ATG------------------ATG---------------------------------------ATG---------TGA---------------------------------------------TAATAG------------------------------------------------ATGTAA---------------------TAGTAA---------------TAG---------------------------------------------------------------------------------TAA------------ATG---------TAA---------------------------------------------------ATGTAA---------TGA---------------------TAA---------------------------------------------------------------------------------------------------------------------------ATG------------------TAA---TAG------TAA------------------TAA---TAG---------TAA------------TAG------------------------------------------TAA---------------------------------TGA------------------------------------------------------------------------------------------------------------------------------TGA------------TAG---------ATGTAA------------TGA------TAG------------------TAATAG------------TAA
                                                                   ORF                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  0   1   1           Gas  FL                     TGas108p19.FL-Sanger                                                                                                                                                                                                                                     AAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACTTTTTTTGTGTTTTATTTTTTTGCTCTGGAATAAATAACGGTCATTAAATGTGCAGCCCCCAAAAAAAAAAAAAAAAAA
  5   1   1           Tbd0 FLq                    IMAGE:5336359.FL-MGC                                                                                                                                                                                                                                                                          GATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5g3  in                  TGas090o15.p1kaSP6                                                                                                                                                                    ACACGGTGAGTGGACACTCCCACAAGTTCTGTGTCGCTGTGGTTTGTGTTGCGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTG
  5   1   2       bld Gas7      in                          XZG4358.5p                                                                                                                                                                                  CACGCCCACAAGTTCTGTGTCGCTGTGGTTTGTGTTGCGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATTCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTTAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACAC
  5   1   2       bld Gas  5g                        TGas012l05.p1kSP6                                                                                                                                                                                   ACGCCCACAAGTTCTGTGTCGCTGTGGTTTGTGTTGCGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCT
  5   1   2       bld Neu  5g3  in                   TNeu106n01.p1cSP6                                                                                                                                                                                     GCCCACAAGTTCTGTGTCGCTGTGGTTTGTGTTGCGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATA
  5   1   2       bld Gas  5g                        TGas013a24.p1kSP6                                                                                                                                                                                              TTCTGTGTCGCTGTGGTTTGTGTTGCGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCAC
  5   1   2       bld Te1       in                         CBWN4136.b1                                                                                                                                                                                                      CGCTGTGGTTTGTGTTGCGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGTGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTC
  5   1   2   22  bld Gas7 5g                              XZG25528.5p ............................................................................................................................................................................................................GTTTGTGTTGCGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTCCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAA
  5   1   2   10  bld Spl2 5g3  in                       CBSS10515.fwd ............................................................................................................................................................................................................GTTTGTGTTGCGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAGAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAAT
  5   1   2   14  bld Brn4 5g3  in                         CAAL8049.5p .............................................................................................................................................................................................................TTTGTGTTGCGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTTCACTGCAGCCCCCTTACTTCGCACAAAGACTTTG
  5   1   2   20  bld Te1  5g                             CBWN10286.b1 .............................................................................................................................................................................................................GTTGTGTTGCGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGTGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACGTATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTT
  5   1   2       bld Te5       in                         CAAO2448.5p                                                                                                                                                                                                                    TTGCGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAANGAAGATAA
  5   1   2   10  bld Te1  5g3  in                         CBWN7482.b1 ....................................................................................................................................................................................................................TGCGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGTGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACGTATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGANAATTACAGCCACAAACACATTGCAGA
  5   1   2       bld Neu  5g                        TNeu021a02.p1kSP6                                                                                                                                                                                                                       CGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTTGGAGCTCTC
  5   1   2   10  bld Sto1 5g3  in                         CABG8328.5p ......................................................................................................................................................................................................................CGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAG
  5   1   2       bld Gas7      in                         XZG54830.5p                                                                                                                                                                                                                        GGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTT
  5   1   2   14  bld Brn3 5g3  in                         CAAK1861.5p ........................................................................................................................................................................................................................GATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTA
  5   1   2      seed TpA  5g3  in                   TTpA016f19.p1kSP6                                                                                                                                                                                                                          ATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCT
  5   1   2   12  bld Gas7 5g3  in                         XZG48367.5p .........................................................................................................................................................................................................................ATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGTGGCAGTAACTCAAACCTAGCACAGTCTATTAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCCAACAAAA
  5   1   2       bld Gas0      in                         dad19e12.y1                                                                                                                                                                                                                             CCCGGGGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCTGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGTGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAA
  3  -1   2       bld Mus1      in                         CABH4756.3p                                                                                                                                                                                                                             TCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCT
  5   1   2       bld Neu  5g                        TNeu027m02.p1kSP6                                                                                                                                                                                                                                AGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGGTTCGGGCTCGGGGATGTACAGNCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATC
  5   1   2   22  bld Gas7 5g                              XZG26965.5p ................................................................................................................................................................................................................................GAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGTGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTCAATAAAATAAACTATAAAAGACCAACAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   22  bld Tad5 5g                              XZT67712.5p .................................................................................................................................................................................................................................AGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAANGAAGATAACACTCCACTACAGGTGGCATC
  5   1   2       bld Te1       in                        CBWN17979.b1                                                                                                                                                                                                                                  GGAGAGAGCTAAGCGCGTATTGGCAGTGCTGGTGTGTCAGTCAGGAATGGAGGCGCCTAGGGCCTAGTCAGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGTGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAAC
  5   1   2       bld Gas  FL   in                   TGas108p19.p1kSP6                                                                                                                                                                                                                                      AGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGC
  5   1   2       bld Neu       in                   TNeu131f07.p1cSP6                                                                                                                                                                                                                                          GCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACCAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAGTGCGAATAAATGTAGTAAATAACAAGC
  5   1   2       bld Neu                            TNeu018e20.p1kSP6                                                                                                                                                                                                                                          GCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGNCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCCTAGATCCTCTAGAGGAGGAGCC
  5   1   2       bld Neu                            TNeu032c14.p1kSP6                                                                                                                                                                                                                                           CTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACANGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTAC
  5   1   2       bld Gas                            TGas057b09.p1cSP6                                                                                                                                                                                                                                            CTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACA
  5   1   2       bld Gas1                               IMAGE:6987377                                                                                                                                                                                                                                            CTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTTCACTGCAGCCCCCTTACTTCGCANCAAGACTTTGACCCACATGTCACGGACACTTTGTACTAAGGAGATAACCTC
  5   1   2       bld Neu0                               IMAGE:6993687                                                                                                                                                                                                                                            CTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGANAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGGCTGCTTCAACTGCAGCCCCCCTTACTTCGCACAAAGACTTTTGACCAACATGGTCACGGGACACTTGGTAACCTAAAGGAAGATAACCACTTCCACTTACAGGGTGGGCCATCTAAAAGGAGCCCGGTTCTTTCAGGCCCCCTCCTAGGA
  5   1   2       bld Neu       in                   TNeu109j20.p1cSP6                                                                                                                                                                                                                                             GACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACCAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGTGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCG
  5   1   2       bld Spl2      in                        CBSS1150.fwd                                                                                                                                                                                                                                             TGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATG
  5   1   2       chi Te1       in                        CBWN12824.b1                                                                                                                                                                                                                                             TGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAATTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATATACAAGCCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGGACTCTGACACCATCCTCAAGCCTTGTTTAAATCTTCGGGGCTCTTCGGGCAGTTGATCAGCCAACTTGCGTTTACGATCAAACTCTG
  5   1   2       bld Tad5      in                         XZT18615.5p                                                                                                                                                                                                                                              CGGACGCGTGGGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCG
  5   1   2       bld Te1       in                        CBWN12949.b1                                                                                                                                                                                                                                                  TGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGTGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACGTATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTTGACCAACATGTCACGGACACTTGTAACTAAAG
  5   1   2       bld TbA       in                   TTbA002c12.p1kSP6                                                                                                                                                                                                                                                       CTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTC
  5   1   2       bld Te5       in                         CAAO5085.5p                                                                                                                                                                                                                                                       CTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCTCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGA
  5   1   2       bld Te1       in                         CBWN3287.b1                                                                                                                                                                                                                                                       CTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGTGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGAT
  5   1   2       bld Ski1      in                         CABJ6042.5p                                                                                                                                                                                                                                                            TGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGGTGACTCACTGTGCATATTATAAAGAAGCAGGATTAGTTTAAATTTGTGTTGCAGACTGATAGGATGT
  5   1   2       bld HdA       in                   THdA034e22.p1kSP6                                                                                                                                                                                                                                                                TTGATCAAGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAAGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGTGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAAGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTC
  5   1   2       bld Te5       in                         CAAO5791.5p                                                                                                                                                                                                                                                                    TCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACATTTG
  3  -1   2       bld Spl1      in                         CABK5393.3p                                                                                                                                                                                                                                                                      AGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGT
  5   1   2       bld Tbd0 FLq  in                    IMAGE:5336359.y1                                                                                                                                                                                                                                                                       GATGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACC
  5   1   2       bld BrSp      in                     EC2BBA35DF01.g1                                                                                                                                                                                                                                                                             GGGGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGTGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTT
  5   1   2       bld Neu                            TNeu029g23.p1kSP6                                                                                                                                                                                                                                                                              GTTCGGGCTCGGGGGATGTACANGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCT
  5   1   2       bld Gas8      in                          st18p11.5p                                                                                                                                                                                                                                                                                   GGGCTCGGGGAATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCANAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCNCACAGGCTGCTT
  5   1   2       chi Gas       ?                    TGas064e21.p1cSP6                                                                                                                                                                                                                                                                                                                        GCGGATTTCGGGAGCAAGATGGCTGACGTGTCGCTGGATGAATTGATCAGGAAGCGAGGTTCGGGCTCGGGGATGTACAGCCGAATTAACAGTCGTGCAGGTACAGGAAATAATATGAGGTCCCGGTTACAGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGT
  5   1   2       bld Tad5                                 XZT46837.5p                                                                                                                                                                                                                                                                                                                                             CGGACGCGTGGGGCTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGTGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGTAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACGTATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGC
  5   1   2       bld Gas                            TGas002h11.p1kSP6                                                                                                                                                                                                                                                                                                                                                           CTTCCTGTCTCCAGTCGTCCAGTTGCTACCAGCTTCCAAGGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACA
  5   1   2       bld Gas                            TGas024p04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                         TCGTCCAGTTGCTACCAGCTTCCAAAGACTTTTGATGCCCGTCAGAAGATTGGGGTGACAGATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAG
  5   1   2       bld Gas7      in                         XZG12194.5p                                                                                                                                                                                                                                                                                                                                                                                                                                     GATGCCCGAATGAAGTTGGGTGTGAAGGATGCACGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCCTTAAGCGAGCCAGACTGCTAAGTCC
  5   1   2       bld Tad5                                 XZT39075.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATGCCGGGAGAAGCTGGTAGCCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGA
  5   1   2       chi Brn3      out                        CAAK2377.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAAAGATGCTCGATTCCGCATCACAGGCAAAGTGCAGGATGCACGGGAGATGCTGAATTCAAGGAAACAGCACGGCTCTGGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGTAAGTAATGTTTCTGGCATTTTTTTGGTATATAGTCTACTGCTTACAGGGATTGCATATAAGTatgtacactatggggctgatttactaatccacgaatccgacccgaattggaaaagttccgacttgaacttaacgctacgaaaaatgcgcaacttttcgcgtaagttttaacgctacaaaaaatgcgcaactttttacgcaactttcgtaatggataggaaaactcgcgtttttacgcaaaaatcgtattggtaacGAAAAATTCGTAAAGAATCCGAAAAAAATCGCAAAACATACGAAAAAATCGCAAAATACCGATCATTACGAAAAAAACGCGATCGGAC
  5  -1   2       bld Spl1      in                         CABK5393.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGGGAGAAAACCCAGCCAAAGTGATGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAAC
  3   1   2       bld Gas7      in                          XZG4358.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGAGGGATGCTCGTGAGAAGCTCAGTCTAAAGAGGAGTGCCCCTTCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATTCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCGCAAAAAAAAAAAAAAAGGGCGC
  3   1   2       bld Te5       in                         CAAO5085.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCAGTGGCTGTCAGTCCAACATTGACATCTGGATCTTCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGC
  3   1   2       bld Gas7      in                         XZG54830.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAACCATAAACCTTACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGC
  3   1   2       bld Te1       in                         CBWN4136.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAAAAAAAAA
  5   1   2       bld Ova1      in                          CABE879.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAAGACCATACAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACATATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCANACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTAT
  5   1   2       bld Gas7      in                         XZG32304.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGATTCCACAGCAAAGGGGCAGTAACTCAAACCTAGCACAGTCTATGAAAGGAATGCGAATAAATGTAGTAAATAACAAGCCAACAAAACAGGAACACGTATCTCTATCCCGCCAGCTTCCATCACGGCTTGAGGAGGAAGATGAAGAAGATGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCA
  5   1   2       bld Gas                            TGas027e03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGAAGAGACGAGTTGGAGCTCTCCTCTATCCCAGCTAAGCAGATGAAAATTACAGCCACAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTC
  3   1   2       bld Gas0      in                         dad19e12.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCTTCTCCTCTATCCCAGGTAAGCAGATGAAAATACAGCCCCCAAACACATTGCAGAAACGGGCTCTACCTTTCACAAAGGTTGTCCAGAATGACACCTACACTGCACCTGCTGTCACACAGGCTGCTTCAACTGCAGCCCCCTTACTTCGCACAAAGACTTTGACCAACATGTCACGGACACTTGTAACTAAGGAAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAA
  5  -1   2       bld Mus1      in                         CABH4756.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGATAACACTCCACTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTAT
  5   1   2       bld Tad0      in                     NISC_no20c12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTACAGGTGGCATCTAAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTT
  3   1   2       bld Neu       in                    TNeu109j20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas090o15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAGCCGGTCTTCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAAGGTTCTGTTTCCAATATCATTGTTTATACTAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg                            TEgg098e08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGCAACAGTATTATAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGGGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGG
  3   1   2       bld Neu  5g3  in                    TNeu106n01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTACAAAAAAAAA
  3   1   2       bld Sto1 5g3  in                         CABG8328.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAGCCCTCTAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTAAAAAAA
  3   1   2       bld Gas8      out                         st31p01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATG
  3   1   2       bld Neu       in                    TNeu131f07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAAGGTACTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCANATATCATTGTTTATACTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA002c12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTAAAATGACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATGTTTATACTAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Gas  FL   in                    TGas108p19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAATGACAGTTAACAATTGCACCCCTCGTGTCACAGAAGAAGATATGTGGGAGTTGTTCTGTGTATGTGGAGCCTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACTTTTTTTGTGTTTTATTTTTTTGCTCTGGAATAAATAACGGTCATTAAATGTGCA
  3   1   2       bld Ova1      in                          CABE879.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACAGTTAACAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACTTTTTTTGTGTTTTATTTTTTTGCTCTGGAATAAATAACGGTCAT
  3   1   2       bld BrSp      in                     EC2BBA35DF01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAGGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATG
  3   1   2       bld Ski1      in                         CABJ6042.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTGCACCCTCGTGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTT
  3   1   2       bld Gas8      in                          st18p11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTCACAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGT
  3   1   2       bld Te1       in                        CBWN12949.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAAGAAGATATTGTGGAGTTGTTCTGTGTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTAAAAAAAAAAAAAAA
  3   1   2       bld Te5       in                         CAAO5791.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTATGTGGAGCCTTAAAGCGAGCCAGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACTTTTTTTGTGTTTTATTTTTTTGCTCTGGAATAAATAACGGTCATTAAATGTGCAGCCCCC
  3   1   2       bld Spl2 5g3  in                       CBSS10515.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGACTGCTAAGTCCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTAC
  3   1   2       bld Spl2      in                        CBSS1150.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTGGTGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTT
  3   1   2       bld Te1  5g3  in                         CBWN7482.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCGGCAGAAGTTGTTTTTGTGAGGAAGGACGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG58169.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGACGCAGTTGGTGCTTATAAAAAGTACAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGTAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTAC
  3   1   2       bld Gas7      in                         XZG28716.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACGCGTCCGAACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTAAAAAAAAAAAAAAAGG
  5   1   2       bld Gas7      in                         XZG28716.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACAACAGATACCTGGATGGGCAACCCATGAAGTGTAATCTTCATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7      in                         XZG58169.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAATCTTCTTCTGAAGGGCAGTGTCATAACATCAGACCAACCTTTCTTATTGGGATTCAGGGACACCCCTTTTGCAACAAAAAAAGAAGGGTAGACTGGAAGTTCAAACCCATTATTTTCATCCAGGGCATCCAACCCCCCTGTTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATTTTGGGGTTTTTGGGCAGTTGTTCAGCCAACTGGGTTTAAGATCAAATTTTGATGGGGCCAGTATGAACTAAAGTGGGGGAGTTTGGGAGTGAATCACAAAGATGACTTTCAGAGTGCCCAATGTTATGATTCCCCTAGAGAGACTAGATTTTTGTTTCAGAGAAAATTTGTTAGACCCGCTCATCAGGGGATTAGTTCTTGTTGGCCAAGAGTGGGGGATAATTGGACTTTGGGCGGTATAACTGAACCCCCTCCCCTTTGGGACGGTAGCATTACAGTTTCACTTTTTTTTATGTTAAGAGGTTCCG
  3   1   2       bld Tad0      in                     NISC_no20c12.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACAAAAAAAAAAAAAAAAG
  3   1   2       bld Te1       in                         CBWN3287.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATCTGAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTAAAAAAAAAAAAAAA
  3   1   2       bld Tbd0 FLq  in                    IMAGE:5336359.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAATGGCAGTGTCATAACATCAGACCAACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Te1       in                        CBWN17979.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACCTATCTTACTGCGACTCAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACTTTTTTTGTGTTTTATTTTTTTGCTCTGGAATAAATAACGGTCATTAAATGTGCAGCCCCCAAAAACACTAGTCATCTTTGATGACTAAAAGAATCCTGCACCTTAACAGATGCTCACATTATTGATTAATTTGTAGGGATGCACCAAATCCACTATTTTGGGATTTGGCTGAATGCTGTACTGAATCCGAATTCTAATTTGCATGTGCAAACTAAGGCAGGGAAGCAAAAAAAAAAAAAAA
  5   1   2       bld Neu                            TNeu077p01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCGACTAGCGACCACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCGAGGATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTGATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTGTAACTGAACACCCTACCCTTTGCGACTGTGGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACAT
  3   1   2       bld Tad5      in                         XZT18615.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCGACACACCATCTGCAACAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACTTTTTTTGTGTTTTATTTTTTTGCTCTGGAATAAATAACGGTCATTAAATGTGCAGCCCCCAAAAACACTAGTCATCTTTGATGACTAAAAGAATCCTGCACCTTAACAGATGCTCACATTATTGATTAATTTGTAGGGATGCACCAAATCCACTATTTTGGGATTTGGCTGAATGCTGTACTGAATCCGAATTCTAATTTGCATGTGCAAACTAAGGCAGGGAAGCTTAAAAAAAAAAAAAAAGGGCGGCCGCAAGGCCTG
  3   1   2       bld TbA                            TTbA010b05.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCATTTGCCACAAAAAAAGAAGGGGAGTCTCGAAGATCAAACACATTATCTTCATGCAGCGCATCCAACCCACCTGCTGAAGGGGGCCCTGACACCATCCTCAAAGCCTCGTTTAAATCTTCGGGCTATTCGGCAGGTGTTCAGCCAACTGCGTTTAAGATCAATCTGTGATGCGGCCAGTACGTACTAAAGGGGAGGAGTTCTGGAGTGAATCGCAAAG
  3   1   2       bld Gas7      in                         XZG12194.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCATCAAAAAAAGAAGGGGAGACTCGAAGATCAAACACATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACAACATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTCGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTTCCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTCTATGTTAAGAGG
  5   1   2       bld Neu                            TNeu049e24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTATCTTCATCCAGTGCATCCAACCCACCTGCTGAAGTGGACCCTGACACCATCCTCAAAGCCTTGTTTAAATCTTCGGGCTCTTCGGCAGTTGTTCAGCCAACTGCGTTTAAGATCAAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACTTTTTTTGTGTTTTATTTTTTTGCTCTGGAATAAATAACGGTCNTT
  3   1   2       bld Gas7      in                         XZG32304.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGTGTTCAGCCAACTGCGTTAAGATCAACTCTGATGCGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACTTTTTTTGTGTTTTATTTTTTTGCTCTGGAATAAATAACGGTCATTAAATGTGCAGCCCCCAAAAACACTAGTCATCTTTGATGACTAAAAGAATCCTGCACCTTAACAGATGCTCACATTATTGATTAATTTGTAGGGATGCACCAAATCCACTATTTTGGGATTTGGCTGAATGCTGTACTGAATCCGAATTCTAATTTGCATGTGCAAACTAAGGCAGGGAAGCTTAAAAAAAAAAAAAAAGG
  3   1   2       bld Te1       in                        CBWN12824.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTAAGATCAAACTCTGATGTGGCCAGTATGAACTAAAGTGGAGGAGTTCTGGAGTGAATCACAAAGATGACTCTCAGAGTGACCAATGTTATGATTCACCTAGAGAGACTAGACTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATGAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACTCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTAAAAAAAAAAAAAAA
  3   1   2       bld Gas8      in                          st79m07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAAAGGGCTCGAGTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTG
  5   1   2       bld Gas8      in                          st79m07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCTCGAGGTTTTGTTTCAGAGAAAATTTGTTAGAACCGCTCATCAGTGGATTAGTTCTTGTTGGCCAAGAGTGAGGGATAATTGGACTTTTGGCTGTATAACTGAACACCCTACCCTTTGCGACTGTAGCATTACAGTTTCACTTTTCTTTATGTTAAGATGTTCCTGCAGCGCACATGCTGGTTCCTCTCCCAGGATCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACTTTTTTTGTGTTTTATTTTTTTGCTCTGGAATAAATAACGGTCATTAAATGTGAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                         XZG48367.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGGTTCCTCTCCCAGGATCAAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACTTTTTTTGTGTTTTATTTTTTTGCTCTGGAATAAATAACGGTCATTAAATGTGCAGCCCCCAAAAACACTAGTCATCTTTGATGACTAAAAGAATCCTGCACCTTAACAGATGCTCACATTATTGATTAATTTGTAGGGATGCACCAAATCCACTATTTTGGGATTTGGCTGAATGCTGTACTGAATCCGAATTCTAATTTGCATGTGCAAACTAAGGCAGGGAAGCTTAAAAAAAAAAAAAAAGG
  3   1   2       bld Brn4 5g3  in                         CAAL8049.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAAGTACATGTACATACAGTTTCCTGCCATGCTGTTTAATGTTCTGTTTCCAATATCATTGTTTATACTTACTTTTTTTGTGTTTTATTTTTTTGCTCTGGAATAAATAACGGTCATTAAATGTGCAGCCCCCAAAAACACTAGTCATCTTTGATGACTAAAAGAATCCTGCACCTTAACAGATGCTCACATTATTGATTAATTTGTAGGGATGCACCAAATCCACTATTTTGGGATTTGGCTGAATGCTGTACTGAATCCGAATTCTAATTTGCATGTGCAAACTAAGGCAGGGAAGCTTAAAAAAAAAACTGGGCGTGCAGTATGCGGAAAAAAACCTTCCAATTTCCGCATTTATGTGGTGAAAAGACGCATCATTTTAAGGATTCTGTCCAGCCAGGACAATggattcagccgaatcctgctgaaaaagcctgaatcccaaagcaaattctggattcggtgcatccctaTTGATTTGCCACTGTTCATTTTCTGACGTGACATCCAGATGAGTAGAAAAAGAATGTCCTTGAATTTGACATCCATGTTCTTTAGATACATTAGGTTAATTATTAGTCATAATTGGATGTGGAATCTCTGAAATATTATCCAGCTGAAAAGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGAT
  3   1   2       bld TbA                             TTbA069j13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTATACTTACTTTTTTTGTGTTTTATTTTTTTGCTCTGGAATAAATAACGGTCATTAAATGTGCAGCCCCCAAAAACACTAGTCATCTTTGATGACTAAAAGAATCCTGCACCTTAACAGATGCTCACATTATTGATTAATTTGTAGGGATGCACCAAATCCACTATTTTGGGATTTGGCTGAATGCTGTACTGAATCCGAATTTTAATTTGCATGTGCAAACTAAGGCAGGGAAGCTTAAAAAAAAAACTGGGCGTGCAGTATGCGGAAAAAAACCTTCCAATTTCCGCATTTATGTGGTGAAAAGACGCATCATTTTAAGGATTCTGTCCAGCCAGGACAATggattcagccgaatcctgctgaaaaagcctgaatcccaaagcaaattctggattcggtgcatccctaTTGATTTGCCACTGTTCATTTTCTGACGTGACATCCAGATGAGTAGAAAAAGAATGTCCTTGAATTTGACATCCATGTTCTTTAGATACATTAGGTTAATTATTAGTCATAATTGGATGTGGAATCTTTGAAATATTATCCAGCTGAAAAGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCAT
  3   1   2       bld Te5       out                        CAAO2060.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACTTTTTTTGTGTTTATTTTTTTGCTCTGGAATAAATAACGGTCATTAAATGTGCAGCCCCCAAAAACACTAGTCATCTTTGATGACTAAAAGAATCCTGCACCTTAACAGATGCTCACATTATTGATTAATTTGTAGGGATGCACCAAATCCACTATTTTGGGATTTGGCTGAATGCTGTACTGAATCCGAATTCTAATTTGCATGTGCAAACTAAGGCAGGGAAGCTTAAAAAAAAAACTGGGCGTGCAGTATGCGGAAAAAAACCTTCCAATTTCCGCATTTATGTGGTGAAAAGACGCATCATTTTAAGGATTCTGTCCAGCCAGGACAATggattcagccgaatcctgctgaaaaagcctgaatcccaaagcaaattctggattcggtgcatccctaTTGATTTGCCACTGTTCATTTTCTGACGTGACATCCAGATGAGTAGAAAAAGAATGTCCTTGAATTTGACATCCATGTTCTTTAGATACATTAGGTTAATTATTAGTCATAATTGGATGTGGAATCTCTGAAATATTATCCAGCTGAAAAGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGT
  3   1   2       bld Brn3 5g3  in                         CAAK1861.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTATTTTTTTTGCTCTGGAATAAATAACGGTCATTAAATGTGCAGCCCCCAAAAACACTAGTCATCTTTGATGACTAAAAGAATCCTGCACCTTAACAGATGCTCACATTATTGATTAATTTGTAGGGATGCACCAAATCCACTATTTTGGGATTTGGCTGAATGCTGTACTGAATCCGAATTCTAATTTGCATGTGCAAACTAAGGCAGGGAAGCTTAAAAAAAAAACTGGGCGTGCAGTATGCGGAAAAAAACCTTCCAATTTCCGCATTTATGTGGTGAAAAGACGCATCATTTTAAGGATTCTGTCCAGCCAGGACAATggattcagccgaatcctgctgaaaaagcctgaatcccaaagcaaattctggattcggtgcatccctaTTGATTTGCCACTGTTCATTTTCTGACGTGACATCCAGATGAGTAGAAAAAGAATGTCCTTGAATTTGACATCCATGTTCTTTAGATACATTAGGTTAATTATTAGTCATAATTGGATGTGGAATCTCTGAAATATTATCCAGCTGAAAAGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGT
  3   1   2       bld Te5       in                         CAAO2448.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATGACTAAAAGAATCCTGCACCTTAACAGATGCTCACATTATTGATTAATTTGTAGGGATGCACCAAATCCACTATTTTGGGATTTGGCTGAATGCTGTACTGAATCCGAATTCTAATTTGCATGTGCAAACTAAGGCAGGGAAGCTTAAAAAAAAAACTGGGCGTGCAGTATGCGGAAAAAAACCTTCCAATTTCCGCATTTATGTGGTGAAAAGACGCATCATTTTAAGGATTCTGTCCAGCCAGGACAATggattcagccgaatcctgctgaaaaagcctgaatcccaaagcaaattctggattcggtgcatccctaTTGATTTGCCACTGTTCATTTTCTGACGTGACATCCAGATGAGTAGAAAAAGAATGTCCTTGAATTTGACATCCATGTTCTTTAGATACATTAGGTTAATTATTAGTCATAATTGGATGTGGAATCTCTGAAATATTATCCAGCTGAAAAGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGT
  5   1   2       bld Gas7      in                         XZG19864.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATGCTCACATTATTGATTAATTTGTAGGGATGCACCAAATCCACTATTTTGGGATTTGGCTGAATGCTGTACTGAATCCGAATTCTAATTTGCATGTGCAAACTAAGGCAGGGAAGCTTAAAAAAAAAACTGGGCGTGCAGTATGCGGAAAAAAACCTTCCAATTTCCGCATTTATGTGGTGAAAAGACGCATCATTTTAAGGATTCTGTCCAGCCAGGACAATggattcagccgaatcctgctgaaaaagcctgaatcccaaagcaaattctggattcggtgcatccctaTTGATTTGCCACTGTTCATTTTCTGACGTGACATCCAGATGAGTAGAAAAAGAATGTCCTTGAATTTGACATCCATGTTCTTTAGATACATTAGGTTAATTATTAGTCATAATTGGATGTGGAATCTCTGAAATATTATCCAGCTGAAAAGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATG
  5   1   2       bld BrSp      in                    EC1CBA002ZG04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGTGCAAACTAAGGCAGGGAAGCGTAAAAAAAAAACTGGGCGTGCAGTATGCGGAAAAAAACCTTCCAATTTCCGCATTTATGTGGTGAAAAGACGCATCATTTTAAGGATTCTGTCCAGCCAGGACAATggattcagccgaatcctgctgaaaaagcctgaatcccaaagcaaattctggattcggtgcatccctaTTGATTTGCCACTGTTCATTTTCTGACGTGACATCCAGATGAGTAGAAAAAGAATGTCCTTGAATTTGACATCCATGTTCTTTAGATACATTAGGTTAATTATTAGTCATAATTGGATGTGGAATCTCTGAAATATTATCCAGCTGAAAAGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAA
  3   1   2       bld TpA  5g3  in                    TTpA016f19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAAAAAAAAACTGGGCGTGCAGTATGCGGAAAAAAACCTTCCAATTTCCGCATTTATGTGGTGAAAAGACGCATCATTTTAAGGATTCTGTCCAGCCAGGACAATggattcagccgaatcctgctgaaaaagcctgaatcccaaagcaaattctggattcggtgcatccctaTTGATTTGCCACTGTTCATTTTCTGACGTGACATCCAGATGAGTAGAAAAAGAATGTCCTTGAATTTGACATCCATGTTCTTTAGATACATTAGGTTAATTATTAGTCATAATTGGATGTGGAATCTCTGAAATATTATCCAGCTGAAAAGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAAATTTAATCAGACCGTCTTTACCCACATTTACTTTCAAGGACATTGAGAAATTGGCTTTCTGTCAGTGACTTTCTTTACTGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAGTACTAAAAATTTTCATGGCAATAAAAGGCTTGATAAAAAAAAAAAAAAAA
  3   1   2       bld HdA       in                    THdA034e22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCATCATTTTAAGGATTCTGTCCAGCCAGGACAATggattcagccgaatcctgctgaaaaagcctgaatcccaaagcaaattctggattcggtgcatccctaTTGATTTGCCACTGTTCATTTTCTGACGTGACATCCAGATGAGTAGAAAAAGAATGTCCTTGAATTTGACATCCATGTTCTTTAGATACATTAGGTTAATTATTAGTCATAATTGGATGTGGAATCTCTGAAATATTATCCAGCTGAAAAGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAGCCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAAGGGCATAGCCAGTGCAGTTGCTTAAAAAACAGTTTCACCATGCAGGCAGCTTAAGTGCAGCACGCA
  5   1   2       bld HdA       in                  THdA028h11.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCGGGCCCGGGGAATggattcagccgaatcctgctgaaaaagcctgaatcccaaagcaaattctggattcggtgcatccctaTTGATTTGCCACTGTTCATTTTCTGACGTGACATCCAGATGAGTAGAAAAAGAATGTCCTTGAATTTGACATCCATGTTCTTTAGATACATTAGGTTAATTATTAGTCATAATTGGATGTGGAATCTCTGAAATATTATCCAGCTGAAAAGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAAATTTAATCAGACCGTCTTTACCCACATTTACTTTCAAGGACATTGAGAAATTGGCTTTCTGTCAGTGACTTTCTTTACTGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAGTACTCAAAATTTTCATGGCAATAAAAGGCTTTGATTAATATTANGGAGAATTAAATAATTGTTAAAAAAAGGTAACATTAGCCATCATCATAATTCGCANGTTGGATAGGCCTGCCCCAGCCGCCCGNNNTATGTTTCATTTATTTTATTTTATAACATTCAGCCCTCTCTCTGCATC
  5   1   2       bld Neu       in                   TNeu106a23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGATTTGCCACTGTTCATTTTCTGACGTGACATCCAGATGAGTAGAAAAAGAATGTCCTTGAATTTGACATCCATGTTCTTTAGATACATTAGGTTAATTATTAGTCATAATTGGATGTGGAATCTCTGAAATATTATCCAGCTGAAAAGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAAATTTAATCAGACCGTCTTTACCCACATTTACTTTCAAGGACATTGAGAAATTGGCTTTCTGTCAGTGACTTTCTTTACTGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAGTACTCAAAATTTTCATGGCAATAAAAG
  5   1   2       bld Gas                            TGas116g09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGACGTGACATCCAGATGAGTAGAAAAAGAATGTCCTTGAATTTGACATCCATGTTCTTTAGATACATTAGGTTAATTATTAGTCATAATTGGATGTGGAATCTCTGAAATATTATCCAGCTGAAAAGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAATTTAATCAGACCGTCTTTACCCACATTTAC
  3   1   2       bld Gas7      in                         XZG19864.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTGACATCCATGTTCTTTAGATACATTAGGTTAATTATTAGTCATAATTGGATGTGGAATCTCTGAAATATTATCCAGCTGAAAAGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAAATTTAATCAGACCGTCTTTACCCACATTTACTTTCAAGGACATTGAGAAATTGGCTTTCTGTCAGTGACTTTCTTTACTGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAGTACTCAAAATTTTCATGGCAATAAAAGGCTTTGATT
  3   1   2       bld Neu       in                    TNeu106a23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGGATTTTTGAAATATTCTCCAGCTGAAAATTTTTGAACCTTTTTACCGGGGGGGAAAATACCAATCTTTGGGGGATATAAAATCCGGCCAGATTTGCAAAGGCACCTTAACGTAAAGTACCCGGGGTTTTTTTTTGTAAGAACCCAAGGGTTTGTTTTAAATAAATTGGGGGACAGGCATTTTTGTTCCCCCCCCCCGGAATTCAGGGGGGGTTTTTAAGGGGCATGCCAGGGCGGTTTTTTAAAAACAGTTTCTCTTGCAGGCAGTTTAAGTGCAGCCCGCAGTTCTTTTAAAAAAAAAAAAAAGAAAGCCCCTTTTCATTATGTAAAAACGGCAAAGAAATTTTTTTTGGGGGCAAATTTATTAAGCCCGTCTTTACCCCCATTTGCTTTTAAGGGCACTGAGAAATTGGCTTTTTGTCAGAGACTTTTTTTTATGGTCAATTGTTAACGTTGCATTCCATACTAGGGCGGAGCTCAAAATTTTCCTGGCAAAAAAAGGGGTTTGGTTTCTAGaaaacaaaaaaaaaaaaccaagcgaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld BrSp      in                    EC1CBA002ZG04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTTTTGAACCTATTTACACGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAAATTTAATCAGACCGTCTTTACCCACATTTACTTTCAAGGACATTGAGAAATTGGCTCTCTGTCAGTGACTTTCTTTACTGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAGTACTCAAAATTTTCATGGCAATAAAAGGCTTTGATTAGTAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld HdA       in                  THdA026h06.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTATTTACACGTGGTTATAATAGCAATATTTCGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAAATTTAATCAGACCGTCTTTACCCACATTTACTTTCAAGGACATTGAGAAATTGGCTTTCTGTCAGTGACTTTCTTTACTGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAGTACTCAAAATTTTCATGGCAATAAAAGGCTTTGATTAATATTAGGAGAATTAAATAATTGTTAAAAAAAGGTAACATTAGCCATCATCATAATTCGCAGTTGGATAGGCCTGCCCCAGCCGCCCGTTATTGTTTCATTTATTTATTTTATAACATTCAGCCCTCTCTCTGCATCTAATTGTTTTGTGACGGGGCCCTGAATGTCAAGTTNCTGTGGGGAGCCCTAAGAGGCCCTAACAGTCTNCTTTCTAGGTTTGTTTTCTCAGTTTCTATATGCAAATCAAAGAAAAAGTTATGTTCACTGCAACACAACAAAGTGAAAATGCAATTTATTAGATTTCCTTTATGTAAATATAT
  3   1   2       bld Tad5      in                         XZT69672.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACGCGTCCGGGGGGTTATAATAGCAATATTTGGGGAATATAAAATCAGTCCAGACTTCCAAATCACCATTAATGTAAACTACCAGGCTTTTTTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCGGGCTACGGGCATTTTTGTTCCCCTCCCTTGCTTTTCAGGGTTGGATTATAATGGCATAGCCAGGGCAGTTGCTTAAAAACAGTTTCCCATGCATGCAGCTTAAGTGCAGCACGCAGCTTTTGTAAAAAAAAAAAAAAGAAATCCCCTTTTCCTTATGTAAAAACTGCAATGAAATGTCTTTTGGGGGCAAATTTAATCAGACCGTCTTTACCCCCATTTACTTTCAAGGACATTGAGAAATTGGCTTTCTGTCAGGGACTTTCTTTACGGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAGTACTCAAAATTTTCAGGGCAATAAAAGGCTTTGTTTT
  5   1   2       bld Tad5      in                         XZT69672.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGTGGTTATAATAGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAAATTTAATCAGACCGTCTTTACCCACATTTACTTTCAAGGACATTGAGAAATTGGCTTTCTGTCAGTGACTTTCTTTACTGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAGTACTCAAAATTTTCATGGCAATAAAAGGCTTTGATTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGG
  5   1   2       bld Neu       in                   TNeu122c09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGGGGCAATATTTGGTGAATATAAAATCAGTACAGACTTCCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAAATTTAATCAGACCGTCTTTACCCACATTTACTTTCAAGGACATTGAGAAATTGGCTCTCTGTCAGTGACTTTCTTTACTGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAGTACTCAAAATTTTCATGGCAATAAAAGGCTTTGATTAATATTAGGAGAATTAAATAATTGTTAAAAAAAGGTAACATTAGCCATCATCATAATTCGCAGTTGG
  3   1   2       bld Gas       in                    TGas116k05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAAATTTAATCAGACCGTCTTTACCCACATTTACTTTCAAGGACATTGAGAAATTGGCTCTCTGTCAGTGACTTTCTTTACTGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAAAACGCAAAATTTTCATGGCAATAAAAGGCTTTGATAAAAAAAAAAAAAAAA
  5   1   2       bld Gas       in                   TGas116k05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAATCAACATTAATGTAAACTAACAGGCTTTATTTTTCATAGTAAACCATAGATTTGTTTTAGATATATCTGGCTACTGGCATTTTTGTTCCACTGCCTTGCTATTCAGGGTTGGATTATAATGGCATAGCCAGTGCAGTTGCTTAAAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAAATTTAATCAGACCGTCTTTACCCACATTTACTTTCAAGGACATTGAGAAATTGGCTCTCTGTCAGTGACTTTCTTTACTGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAGTACTCAAAATTTTCATGGCAATAAAAGGCTTTGATT
  3   1   2       bld Neu       in                    TNeu122c09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAACAGTTTCACATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAAATTTAATCAGACCGTCTTTACCCACATTTACTTTCAAGGACATTGAGAAATTGGCTCTCTGTCAGTGACTTTCTTTACTGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAGTACTCAAAATTTTCATGGCAATAAAAGGCTTTGATTAATATTAGGAGAATTAAATAATTGTTAAAAAAAGGTAACATTAGCCATCATCATAATTCGCAGTTGGATAGGCCTGCCCCAGCCGCCCGTTATTGTTTCATTTATTTATTTTATAACATTCAGCCCTCTCTCTGCATCTAATTGTTTTGTGACGGGGCCCTGAATGTCAAGTTCTGTGGGGAGCCCTAAGAGGCCCTAACAGTCTCTTTCTAGGTTTGTTTTCTCAGTTTCTATATGCAAATCAAAGAAAAAGTTATGTTCACTGCAACACAACAAAGTGAAAATCCAATTATTAGATTTCCTTTATGTAAATATATAGATATTGAGCTGTGTAGGCCTCTAAATGTCAATTTTAATAGGTTGTTCACCTATAAATTAACTTTGATgtttgaaattccagcagctattgggttgctagagttcagttaaccatagcaaccaggcagtggtatgaatgcgagactggaagatgaatagaAAGGTGATACAAATTAACATAAAAAAAAAATGAAGACCAGTTGCACAGAACATTCTATATAACAAACTAAATGTTAAATGACAAGGAACNGGTTAATAAAAATTAAAAGTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA       in                   THdA026h06.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATGCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAAATTTAATCAGACCGTCTTTACCCACATTTACTTTCAAGGACATTGAGAAATTGGCTTTCTGTCAGTGACTTTCTTTACTGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAGTACTCAAAATTTTCATGGCAATAAAAGGCTTTGATTAATATTAGGAGAATTAAATAATTGTTAAAAAAAGGTAACATTAGCCATCATCATAATTCGCAGTTGGATAGGCCTGCCCCAGCCGCCCGTTATTGTTTCATTTATTTATTTTATAACATTCAGCCCTCTCTCTGCATCTAATTGTTTTGTGACGGGGCCCTGAATGTCAAGTTCTGTGGGGAGCCCTAAGAGGCCCTAACAGTCTCTTTCTAGGTTTGTTTTCTCAGTTTCTATATGCAAATCAAAGAAAAAGTTATGTTCACTGCAACACAACAAAGTGAAAATGCAATTATTAGATTTCCTTTATGTAAATATATAGATATTGAGCAGTTTAGGCCTCTAAATGTCAATTTTAATAGGTTGTTCACCTATAAATTAACTTTGATGTAGATAGAGGTTTTATTTTTTTGTGGTCTTCATAagtttgaaattccagcagctattgggttgctagagtacagttaaccatagcaaccaggcagtggtatgaatgcgagactggaagatgaatagaaaagggcatgaatagaaaggTGATACAAATTAACATTAAAAAAAAAAGAAGACCAGTTGCACAGAACATTCTATATAACAAATTAAATGTTAAAGGACCAAGGAACNGGTTAATAAAAATTAAAAGTAAGTCTAAAAAAAAAAAAAAAAGC
  3   1   2       bld HdA       in                   THdA028h11.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCATGCAGCTTAAGTGCAGCACGCAGCTATTGTAAAAAAAAAAAAAAGAAATACCATTTTCATTATGTAAAAACTGCAATGAAATGTCTTTTGGGTGCAAATTTAATCAGACCGTCTTTACCCACATTTACTTTCAAGGACATTGAGAAATTGGCTTTCTGTCAGTGACTTTCTTTACTGGTTAATTGTTAACGTTGTATTTCATACTAAGGCAGTACTCAAAATTTTCATGGCAATAAAAGGCTTTGATTAATATTAGGAGAATTAAATAATTGTTAAAAAAAGGTAACATTAGCCATCATCATAATTCGCAGTTGGATAGGCCTGCCCCAGCCGCCCGTTATTGTTTCATTTATTTATTTTATAACATTCAGCCCTCTCTTTGCATTTAATTGTTTTGTGACGGGGCCCTGAATGTCAAGTTCTGTGGGGAGCCCTAAGAGGCCCTAACAGTCTCTTTCTAGGTTTGTTTTCTCAGTTTCTATATGCAAATCAAAGAAAAAGTTATGTTCACTGCAACACAACAAAGTGAAAATGCAATTATTAGATTTCCTTTATGTAAATATATAGATATTGAGCAGTTTAGGCCTCTAAATGTCAATTTTAATAGGTTGTTCACCTATAAATTAACTTTGATGTAGATAGAGGTTTTATTTTTTTGTGGTCTTCATAagtttgaaattccagcagctattgggttgctagagtacagttaaccatagcaaccaggcagtggtatgaatgcgagactggaagatgaatagaaaagggcatgaatagaaaggTGATACAAATTAACATTAAAAAAAAAAGAAGACCAGTTGCACAGAACATTCTATATAACAAATTAAATGTTAAAGGACAAGGAACGGTTAATAAAAATTAAAGTAAAAAAAAAAAAAAAAGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)