Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 28 Feb 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CBWN10351.5                           2 END     2           1      100                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 754.0    0Xt7.1-TEgg043f14.3.5                       31 PI      96       1946     2387                MGC79554 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 97%

 1012071333 Xt7.1-XZG33061.3.5 - 115 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                             7     7     7     7    12    13    15    16    17    18    17    18    18    19    18    20    19    20    20    21    20    21    21    22    21    22    21    22    20    21    20    21    20    21    20    21    21    21    22    22    22    22    22    22    22    22    24    24    24    24    24    24    24    24    25    25    25    25    25    25    27    27    27    27    28    28    28    28    28    28    29    29    23    29    23    29    21    29    21    29    21    29    22    30    22    30    22    30    22    30    22    30    22    30    22    31    24    33    24    33    24    33    24    33    24    33    24    33    26    34    26    34    26    34    24    32    23    32    21    29    22    29    23    30    23    30    23    31    23    30    23    30    21    27    20    24    20    24    20    24    18    22    16    23    20    24    20    23    20    23    20    23    20    23    18    22    18    22    19    23    19    23    19    22    19    22    20    23    20    23    19    22    19    22    19    24    20    25    19    24    23    25    23    25    23    25    23    25    23    25    23    24    23    24    23    24    23    24    24    25    25    25    25    25    25    25    25    25    26    26    24    25    25    25    25    25    25    25    24    25    25    25    24    24    24    24    22    23    22    23    22    23    22    23    21    23    22    23    22    22    22    22    20    20    20    20    16    17    17    18    17    17    16    18    16    18    16    17    16    17    13    16    15    19    16    19    19    21    23    27    26    30    26    31    28    32    34    38    33    38    37    40    35    39    45    46    45    46    46    49    44    49    48    52    53    56    52    57    54    57    52    55    53    56    54    58    54    57    53    56    53    56    54    58    56    59    56    59    55    59    55    60    56    59    53    59    55    59    55    58    54    58    57    58    54    55    54    55    52    54    53    55    51    55    54    55    53    55    53    55    54    55    49    54    53    55    54    55    53    55    53    55    53    55    53    55    54    55    54    55    54    55    55    55    54    54    53    53    53    53    53    53    51    53    53    53    53    53    53    53    52    53    53    53    52    53    53    53    49    50    49    49    48    48    48    48    40    42    18    20     3     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTGATTGGAATAATTCTGGTGAAGGAGAGGAGCGTCCTCGTGGTTTTGGGAGAGGTGGTTTTAACAACTTTGACTCTGATACTGGTGGAAGAGGACATAGAGGCGGCCGTGGTGGCAGGGGTGGATACAAAGGAAGAAATGAAGAAGTTGGTGTTGAATCTGGAAAAAATCAAGAAGAGGGAACAGAAAAAGAAGTAAAAAAGGTGATCTATGTTCCCCTACCGCCATCTGATAGTGAAGATGATATATTCCGGCACTACCAGTCTGGAATCAATTTTGATAAATATGATGAGATTCTTGTTGATGTGACAGGAAAGGATGTTCCTCCAGCCATATTGACTTTTGAAGAAGCTAACTTT
                                                                   SNP                                                                T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    T-----------
                                               BLH ATG     108    1944                                        
                                               BLH MIN     108     294                                        
                                               BLH MPR     102     294                                        
                                               BLH OVR     108      26                                        
                                               CDS MIN     108      14                                        
                                               EST CLI      21      14                                        
                                               ORF LNG     108       4                                        
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Bf ---- 9e-039     AAM18861.1 unknown [Branchiostoma floridae] ---------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sc ---- 2e-119     NP_014847.1 ATP-dependent RNA helicase of DEAD box family; suppressor of a pre-mRNA splicingmutation, prp8-1; Ded1p [Saccharomyces cerevisiae] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 5e-121     NP_497615.2 Y71H2AM.19 [Caenorhabditis elegans] --------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 5e-138     NP_723899.1 vasa CG3506-PA [Drosophila melanogaster] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PREDICTED - Sp ---- 5e-147     XP_781494.2 PREDICTED: similar to vasa homolog [Strongylocentrotus purpuratus] -------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ---- 4e-152     BAA36711.1 DEAD-Box Protein [Ciona intestinalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Cs ---- 7e-160     BAB12216.1 vasa homolog [Ciona savignyi] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PROTEIN === Gg ==== 9e-172     NP_990039.1 Cvh [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PROTEIN === Mm ==== 0          NP_034159.1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 4; D-E-A-D(aspartate-glutamate-alanine-aspartate) box polypeptide 4; DEAD(aspartate-glutamate-alanine-aspartate) box polypeptide 4; mvh / m'vasa; DEAD/H(Asp-Glu-Ala-Asp/His) box polypeptide 4 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                    PROTEIN --- Dr ---- 0          NP_571132.1 vasa homolog; vasa-like gene [Danio rerio] ----------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PROTEIN === Hs ==== 0          NP_077726.1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PROTEIN === Xl ==== 0          AAC03114.1 DEAD box protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PROTEIN === ?? ==== 0          NP_001081728.1 DEAD box protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PROTEIN === Xt ==== 0          CAJ82187.1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZG33061.3.5                                                          TAG---------TGA---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------ATG------ATG---------------ATG------------------------ATG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------TAA------TAA------------------TAA---------------------------------------------------------TAA------------TAATAG------------------------------------------------------TGA---------------------TAG------------------------------------TGA---------------------------------------------------------TAA------------ATG
                                                                   ORF                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   3        nb Ova1      in                         CABE2567.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAAATCAAGAAGAGGGAACAGAAAAAGAAGTAAAAAAGGTGATCTATGTTCCCCTACCGCCATCTGATAGTGAAGATGATATATTCCGGCACTACCAGTCTGGAATCAATTTTGATAAATATGATGAGATTCTTGTTGATGTGACAGGAAAGGATGTTCCTCCAGCCATATTGACTTTTGAAGAAGCTAACTTTTGTGAGACACTAAGCAGGAATGTCACTAAAGCTGGATATGTAAAACTAACACCAGTGCAGAAACACAGTATACCTATTATATTGGCTGGTCGTGATTTAATGGCTTGTGCCCAGACCGGTTCTGGTAAAACTGCTGCTTTTCTGTTGCCAATCCTAAGTCATATGATGAATGAAGGCATTACAGCTAGCCAGTTTTTACCACTTCAGGAGCCGCAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCCCGAAAATTTTCATATGGAACCTGTGTTCGTCCAGTAGTTGTATATGGAGGTATACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTC
  5   1   3        nb Gas7                                 XZG35978.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAAAGGTGATCTATGTTCCCCTACCGCCATCTGATAGTGAAGATGATATATTCCGGCACTACCAGTCTGGAATCAATTTTGATAAATATGATGAGATTCTTGTTGATGTGACAGGAAAGGATGTTCCTCCAGCCATATTGACTTTTGAAGAAGCTAACTTTTGTGAGACACTAAGCAGGAATGTCACTAAAGCTGGATATGTAAAACTAACACCAGTGCAGAAACACAGTATACCTATTATATTGGCTGGTCGTGATTTAATGGCTTGTGCCCAGACCGGTTCTGGTAAAACTGCTGCTTTTCTGTTGCCAATCCTAAGTCATATGATGAATGAAGGCATTACAGCTAGCCAGTTTTTACCACTTCAGGAGCCGCAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCCCGAAAATTTTCATATGGAACCTGTGTTCGTCCAGTAGTTGTATATGGAGGTTTACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAATATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGNCAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATAGTTGGAGGAGCTGTAGTGAT
  3   1   3        nb Te5       in                        CAAO11220.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTACCGCCATCTGATAGTGAAGATGATATATTCCGGCACTACCAGTCTGGAATCAATTTTGATAAATATGATGAGATTCTTGTTGATGTGACAGGAAAGGATGTTCCTCCAGCCATATTGACTTTTGAAGAAGCTAACTTTTGTGAGACACTAAGCAGGAATGTCACTAAAGCTGGATATGTAAAACTAACACCAGTGCAGAAACACAGTATACCTATTATATTGGCTGGCCGTGATTTAATGGCTTGTGCCCAGACCGGTTCTGGTAAAACTGCTGCTTTTCTGTTGCCAATCCTAAGTCATATGATGAATGAAGGCATTACAGCTAGCCAGTTTTTACCACTTCAGGAGCCGCAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCCCGAAAATTTTCATATGGAACCTGTGTTCGTCCAGTAGTTGTATATGGAGGTATACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACAATCCTTGAAATAC
  5   1   3        nb Te6       in                          CABM646.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGCCATCTGATAGTGAAGATGATATATTCCGGCACTACCAGTCTGGAATCAATTTTGATAAATATGATGAGATTCTTGTTGATGTGACAGGAAAGGATGTTCCTCCAGCCATATTGACTTTTGAAGAAGCTAACTTTTGTGAGACACTAAGCAGGAATGTCACTAAAGCTGGATATGTAAAACTAACACCAGTGCAGAAACACAGTATACCTATTATATTGGCTGGTCGTGATTTAATGGCTTGTGCCCAGACCGGTTCTGGTAAAACTGCTGCTTTTCTGTTGCCAATCCTAAGTCATATGATGAATGAAGGCATTACAGCTAGCCAGTTTTACCACTTCAGGAGCCGCAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCCCGAAAATTTTCATATGGAACCTGTGTTCGTCCAGTAGTTGTATATGGAGGTATACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACATCCCTTGAATACAAGAATATCGAANAAGGGNACAGCTGGT
  5   1   3        nb Ova1      in                         CABE6550.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAATTCGGCACGAGGCTTTTGAAGAAGCTAACTTTTGTGAGACACTAAGCAGGAATGTCACTAAAGCTGGATATGTAAAACTAACACCAGTGCAGAAACACAGTATACCTATTATATTGGCTGGTCGTGATTTAATGGCTTGTGCCCAGACCGGTTCTGGTAAAACTGCTGCTTTTCTGTTGCCAATCCTAAGTCATATGATGAATGAAGGCATTACAGCTAGCCAGTTTTTACCACTTCAGGAGCCGCAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCCCGAAAATTTTCATATGGAACATGTGTTCGTCCAGTAGTTGTATATGGAGGTATACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGGTTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACAATCCTTGAAATACAAGAATATCGAANAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTNCAGAACATT
  5   1   3        nb Ova1      in                         CABE3905.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCATATTGACTTTTGAAGAAGCTAACTTTTGTGAGACACTAAGCAGGAATGTCACTAAAGCTGGATATGTAAAACTAACACCAGTGCAGAAACACAGTATACCTATTATATTGGCTGGTCGTGATTTAATGGCTTGTGCCCAGACCGGTTCTGGTAAAACTGCTGCTTTTCTGTTGCCAATCCTAAGTCATATGATGAATGAAGGCATTACAGCTAGCCAGTTTTTACCACTTCAGGAGCCGCAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCCCGAAAATTTTCATATGGAACATGTGTTCGTCCAGTAGTTGTATATGGAGGTATACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCC
  5   1   3        nb Tbd0      in                     NISC_nl04g02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTAAAACTAACACCAGTGCAGAAACACAGTATACCTATTATATTGGCTGGTCGTGATTTAATGGCTTGTGCCCAGACCGGTTCTGGTAAAACTGCTGCTTTTCTGTTGCCAATCCTAAGTCATATGATGAATGAAGGCATTACAGCTAGCCAGTTTTTACCACTTCAGGAGCCGCAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCCCGAAAATTTTCATATGGAACATGTGTTCGTCCAGTAGTTGTATATGGAGGTATACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGGTTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCNAGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAA
  3  -1   3        nb Ovi1      in                        CABI12274.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAAACACAGTATACCTATTATATTGGCTGGTCGTGATTTAATGGCTTGTGCCCAGACCGGTTCTGGTAAAACTGCTGCTTTTCTGTTGCCAATCCTAAGTCATATGATGAATGAAGGCATTACAGCTAGCCAGTTTTTACCACTTCAGGAGCCGCAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCCCGAAAATTTTCATATGGAACATGTGTTCGTCCAGTAGTTGTATATGGAGGTATACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGGTTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACAATCCTTGAAATACAAGAATATCGAAAAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAAACATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGGTTATGTCTGTACAGCAGTTGCTGCGAGAGGC
  5   1   3        nb Neu       in                   TNeu089j11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACACAGTATACCTATTATATTGGCTGGTCGTGATTTAATGGCTTGTGCCCAGACCGGTTCTGGTAAAACTGCTGCTTTTCTGTTGCCAATCCTAAGTCATATGATGAATGAAGGCATTACAGCTAGCCAGTTTTTACCACTTCAGGAGCCGCAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCCCGAAAATTTTCATATGGAACATGTGTTCGTCCAGTAGTTGTATATGGAGGTATACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGGTTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACAATCCTTGAAATAC
  5   1   3        nb Ova1      in                        CABE11508.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGCACTAGCCCAGACCGGTTCTGGTAAAACTGCTGCTTTTCTGTTGCCAATCCTAAGTCATATGATGAATGAAGGCATTACAGCTAGCCAGTTTTTACCACTTCAGGAGCCGCAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCCCGAAAATTTTCATATGGAACATGTGTTCGTCCAGTAGTTGTATATGGAGGTATACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGGTTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACAATCCTTGAAATACAAGAATATCGAAAAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTG
  5   1   2       add Te1       in                         CBWN8582.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATCCTAAGTCATATGATGAATGAAGGCATTACAGCTAGCCANGTTTTTACCACTTCAGGAGCCGCAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCCCGAAAATTTTCATATGGAACCTGTGTTCGTCCAGTAGTTGTATATGGAGGTATACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACAATCCTTGAAATACAAGAATATCGAAAAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATT
  5   1   3        nb Gas7      in                         XZG24252.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATATGATGAATGAAGGCATTACACGCTAGCCAGGTTTTTACCACTTCAGGAGCCGCAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCCCGAAAATTTTCATATGGAACCTGTGTTCGTCCAGTAGTTGTATATGGAGGTATACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACAATCCTTGAAATACAAGAATATCGAAAAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAAACATGTCAAAGAGAGGAAGCTAT
  5   1   3        nb Gas7      in                         XZG33061.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAATGAAGGCATTACAGCTAGCCAGTTTTTACCACTTCAGGAGCCGCAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCCCGAAAATTTTCATATGGAACCTGTGTTCGTCCAGTAGTTGTATATGGAGGTATACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACAATCCTTGAAATACAAGAATATCGAAAAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTT
  5   1   3        nb Te6       in                          CABM619.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAGGGTTTTTACCACTTCAGGAGCCGCAAGCCATAATTATTGCCCCTACCAGAGAACTTATTAACCAGATATATCTCGATGCCCGAAAATTTTCATATGGAACCTGTGTTCGTCCAGTAGTTGTATATGGAGGTATACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACAATCCTTGAAATACAAGAATATCGAAAAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGTTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTGGAAAGCAACTTCATTTTTTAATGTTAATGA
  5   1   2       ext Ova1      in                          CABE819.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATCGATTGAATTCGGCCGAGGGTATATGGAGGTATACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGGTTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACAATCCTTGAAATACAAGAATATCGAAAAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTNGTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTG
  5   1   3        nb Gas7      in                         XZG51118.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTAGTTGTATATGGAGGTATACATCCTGTGCATGCAATGAGGGATGTTGAAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACAATCCTTGAAATACAAGAATATCGAAAAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCCCATGTGTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTC
  5   1   3        nb Ova1      in                         CABE8558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAGAGGGTGCAATATACTTTGTGCAACCCCTGGAAGATTGATGGACATAATAGGTAGAGAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGGTTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACAATCCTTGAAATACAAGAATATCGAAAAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGA
  5   1   3        nb Gas7      in                         XZG36883.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAAAGATTGGCTTAAGTAAGCTAAAATATCTAGTTCTGGATGAAGCGGATCGCATGTTGGATATGGGATTTGCCCCAGTAATGGAGAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGATGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACAATCCTTGAAATACAAGAATATCGAAAAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCC
  5   1   3        nb Te1       in                         CBWN9295.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACTTAATAGGAAGTCCAGGAATGCCAGCAAAAGAGGAGCGACAAACACTGATGTTCAGTGCTACCTATCCTGCTGAAATCCAGAGGCTGGCTTCGAAGTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACAATCCTTGAAATACAAGAATATCGAAAAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATAGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGT
  5   1   3        nb Gas7                                 XZG19503.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTTCTGAAATCTGATCATTTGTTTGTCGTGGTCGGATTAGTTGGAGGAGCTTGTAGTGATGTGGAACAAACAATCCTTGAAATACAAGAATATCGAAAAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCA
  3  -1   2       add TpA       out                  TTpA070l17.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTTTTTTTTTTTTTTTTACTCTGCGCCTTTATCATTTTGTGCTACCGCTAAAATAATGGTTCCCTCCTTACATTACAATAGATGCCAACACATGAAATTCCCCTTTCCTGGTGAAATAACTGGCCCAAAATAAACTACTGACCTTGGTGGATTGATTTAACCGACTTTAATCAAAACAACCTGGATCTTGGCCCACGAAATCTTGCTGAGATCCAGACTTTTATAAATTGCGACATTGGTTGGCTAATATTCATAATTTAACTAGTTTATAAATGAACATGGGAATGTTGGTATTTTTTGCCTCCCATAGGTTTACACCTTGGACCCCCAACCTTTCTTACCCTTGAGCCGCAATGAAATGAAAAAACCTACGTGTTGCCCCCCTAGCCTCTGATTTATACTGACCATATCGCGGATGTGTATATTAACTTTACCATTTACCATGTTGTTGCTCGTCCCCTTGGGAAAATCCTTACTGATGCTCATCACTAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATATAGCTTTCAACAGCTTATATGCAGCGGACTCTATGGGCGTGATAGGCTGGAGAAAACTACGTCAGTGCTCCTTCATTTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCGAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTA
  5  -1   2       add Gas1      in                       IMAGE:6989317                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAGAGTGATGATTGACACATCCTGAATACAGATTCGAAAGGACAGCTGTGAATCTGCAGCTCAGTATGAGCGCACATGATTTGTAAATACAAAAAGAAAGCAGATGTCATGCTGGGTTACNTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCCA
  3   1   3        nb Gas       in                    TGas119k23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACAAGAATATCGAAAAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACATCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATAT
  3   1   3        nb Neu       in                    TNeu089j11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACAAGAATATCGAAAAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATAT
  3   1   2       ext Ova1      in                        CABE12066.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGNCTGGTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGG
  3   1   2       ext Ova1      in                          CABE819.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGG
  5  -1   2       ext Ovi1      in                         CABI1931.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGG
  3   1   3        nb Te6       in                          CABM646.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATGNCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGTTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGG
  3   1   3        nb Te4       in                         CAAN2625.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTAT
  3   1   2       ext Te5       in                        CAAO12348.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGG
  3   1   3        nb Te5       in                         CAAO7864.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTGTCAAGAACATTTCGGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGG
  3   1   3        nb Ova1      in                        CABE11508.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGG
  5  -1   3        nb Ovi1      in                        CABI12274.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCG
  3   1   0       chi Te1       in                         CBWN8582.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTCACTAACTATTTGCACTGGTACCAGTATGGCTTCCGCTTATATACAGGGATACGTGCTTGAGTGCAAATGTTCCATCGCTTCAGGATTCAAATGGACAGACTTGCGGCTGCTAGAACGACCCCCCCGTCAGTATTTTCCTGAAGATATTGGGAGCTGCACATCAATAGCTGAAAGGCACATATTTTACTGGTTTAGAAGCCAGACAATACTTTCTGGAATAACTTGAACTTGAGAAGGAATGTAGAACAGGCAGATTAATTCTATAATGTGTGGGTAGGGTGCCATCTAGTGGTAGGAAGTGTGATTATTTGTTAAAGGGACAGCCCACTTTGTTACAAGTTTCTCGTGACTGTGAAAGAACATGCAATAGGAAAATAGAGCGTCAACCTAGGGTCATTCTGCATGTTACTGACTGAATAAATTTTATATTTTAGCTAAAAAAAAAAAAAAA
  3   1   4      seed TpA       in                    TTpA042n17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTATCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGTTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATAGGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Ova1      in                         CABE8558.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGATTTTTGTAAATCAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGG
  3   1   3        nb Ova1      in                         CABE6550.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAAT
  3   1   3        nb Gas7      in                         XZG51118.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGT
  3   1   3        nb Gas7      in                         XZG33061.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAAGAAAGCGGAGGTCATTGCTGGTTACCTTTGTCAGAAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGAAAAAAAAAAAAAAAGG
  3   1   3        nb Te6       in                          CABM619.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGTTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATG
  3   1   2       ext Te4  5g3  in                         CAAN7714.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACACNAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGG
  5  -1   3        nb Ova1      in                        CABE13146.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTGTCAAGAACATTTTCCGACACANAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGTTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGG
  3   1   2       ext Te4  5g3  in                         CAAN9394.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACACNAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGG
  3   1   3        nb Te5       in                         CAAO8110.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGG
  3   1   3        nb Ova1      in                         CABE2567.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGTTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGG
  3   1   3        nb Te5  5g3  in                         CAAO6580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGG
  3   1   2       ext Gas       in                    TGas104p23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGAAAAAAAAAAAAAAAAAA
  5   1   2       ext Gas       in                   TGas104p23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCATTCACGGTGATAGAGAACAATGTCGAAGAGAGGGGGGGGTGCGGGATTTCATAAGTGGGAAGTGTCCTGTGATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTATATATTGAAAATGTGCAACATGTGATAAATTA
  3   1   2       add Te1       out                       CBWN10159.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTAAGCACCTTTTTCAGATTAAAATGAAGTGATTTGCTAGGGCGAGGCATGTTAAAAACAGTGTAAAATGCGGGAAATGTAAAATCCGTGAAGAGAGCCCATAGGAATGCATACAAATTGGTGGGACCACAACAAAATGGTGTAAATGGCGGGAAAACGTTAAATCCGGGGATGTAAATTCGGGGTTCTACTGTACTTTCATCTGTTTCTTTAAAATTTGCAAAGCCTTGTCTTCTTGCAAGTACCTCATGTTAATATTTTTTTCAGGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCGGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGAAAAAAAAAAAAAAA
  3   1   3        nb Te1  5g3  in                        CBWN15225.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTCAAAGAGAGGAAGCTATCCCGGGATTTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGAAAAAAAAAAAAAAA
  3   1   2       add Te1       out                       CBWN10351.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTAAAATGAAGTGATTTGCTAGGGCGAGGCATGTTAAAAACAGTGTAAAATGCGGGAAATGTAAAATCCGTGAAGAGAGCCCATAGGAATGCATACAAATTGGTGGGACCACAACAAAATGGTGTAAATGGCGGGAAAACGTTAAATCCGGGGATGTAAATTCGGGGTTCTACTGTACTTTCATCTGTTTCTTTAAAATTTGCAAAGCCTTGTCTTCTTGCAAGTACCTCATGTTAATATTTTTTTCAGGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCGGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGAAAAAAAAAAAAAAA
  3   1   3        nb Gas7 PIPE in                         XZG58222.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGTTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCCCTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATTTGCCCAAGAGGAGGGGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCCCTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTTTTCCAAACAAGCATCAATAAACTTGGGTAAATTTGGG
  3   1   2       ext Te1  5g3  in                         CBWN4455.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGGAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG36883.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGG
  3   1   3        nb Te1  5g3  in                        CBWN13859.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGAAAAAAAAAAAAAAA
  3   1   2       add Te1       in                         CBWN4532.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGAAAAAAAAAAAAAAA
  3   1   3        nb Te1  5g3  in                         CBWN7392.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGAAAAAAAAAAAAAAA
  3   1   3        nb Te1       in                         CBWN6682.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGAAAAAAAAAAAAAAA
  3   1   3        nb Te1       in                         CBWN9295.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGTCCTGTTATAGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATAATGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGAAAAAAAAAAAAAAA
  3   1   2       ext Te1       in                        CBWN10541.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGAAAAAAAAAAAAAAGAAAAAAAAAAAAAAA
  3   1   3        nb Tad5      in                         XZT39691.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATATTGAAAATGTTCCACCTGTGGTAAATTATGGCGTTCCTAAGGAAATTGGCGGGTATGTCCCTAGAATTGGTCGCCCTGGTCGCTGTGGGAACGTTGGAAAGGCAACTTCCTTTTTTAATGTTAATGAAGGCCCTGGTGTTGCTTGTCCCCTTGGGAAAATCCTTACTGATGCTCCTCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGGGGCCCTGGGGCTTTGGACCGGTTATATGCCGCCGGCTCTTTGGGGGGGGGGGGTGGGGAAAAGTACGTCAGGGCTCCTTTATTTGCCCCAGAGGGGGGGGCCCGCTGGGGTTTAATTGTTTAAGCCGGATTCCAATTTTGTTAAAATTTTTTGTTTGGAAGCCTTTTTTCCCAGGGCCCAAAAGGCCCAAGTTGCCCTACGTAAGAATTCCTACTTTAATAGCCAACCGCGCCGGGTATTTTATTTCCTTTACCTTGTTTCCATATTGGGTCTGTATGGGAATTTGTTTGCTTTCCCACCTAGGTTTTTTCCTTGAAAAATATATTGTTTAACCGGGAAAGAAAAGTTTTACTTTTGCCTTTTAAACCCAGGTGGGTTTTTTTTTCCA
  3   1   2       add Gas  5x   in                    TGas051k19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACATCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCCTATTA
  3   1   3        nb Gas7      in                         XZG24252.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATGTCCATAGAATTGGTCGCCCTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGGGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTTTATGCAGCAGGCTCTTTGGGGGGGGGGGCTGGGGAAAAGTACGTCAGGGCTCCTTCATCTGCCCAAGAGGGGGGGGCCCGCTGGGGTTAAATAGTTTAAGCCGAATTCAAATTTTGTTAAAATTTCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCCCTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGGGTCTGTATGGGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAAAATATATTGTTTAACCGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTTTTCCAAACAAGCCTCAATAAACTTGGG
  3   1   2       ext Gas7      in                         XZG56125.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACGCGTCCGATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCCCAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCCCTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTTTTCCAAACAAGCATCAATAAACTTGGGTAAATATGGG
  5   1   2       ext Gas7      in                         XZG56125.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANNAAGG
  3   1   3        nb Egg                             TEgg057b05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGAAAGGCAACTTCATTTTTCAATGTTAATGAAGCCCATGTTGTTGTTTGTCCCCTTGTGAAAATCCTTTTTGAAGGTCATCAAGAAGTCCCTGCTTGGTTCGAAGAAATTGCCTTGGGAGGCCCTGGAGCTTTGAACAGTTTATAGGCACCAGACTCTATGGGTGGAGAGGCTGGAGAAAACTATGTCAGGGCTCCTTCATTGGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGCATAAGCGGAATTCAAATATTGCTATAATATCTTGTTCGAAAGCATCTTTTCCGAGAGCCAAAAAGGCCAAAGTTGCAGTACGTAAGAATTCCTTCTTTAATAGCAAACA
  3   1   3        nb Tbd0      in                     NISC_nl04g02.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   3        nb Ova1      in                         CABE3905.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATG
  3   1   3        nb Gas1 5g3  in                     NISC_mq13h01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGAAAAAAAAAAAAAAAG
  3   1   4      seed Te5       in                         CAAO2279.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAAGCAGATGTCATGCTGGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGG
  3   1   2       ext Te1       in                         CBWN1630.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATAGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATAATGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGAAAAAAAAAAAAAAA
  3   1   2       ext Te5  PIPE in                         CAAO5965.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATATCGAAAAAGGGACAGCTGGGTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTAT
  3   1   2       ext Ova1      in                        CABE12175.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAAGGGACAAGCTGGTTGAAATTCTGCAAAGCTCAGGTAATGAGCGCACAATGATTTTTGTAAATACAAAAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGG
  3   1   2       ext Egg  FLsh in                    TEgg071o12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAGAAAGCAGATGTCATTGCTGGTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATTTGCACAAGAGGAGGGGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATTTTTTGTTTGAAAGCATTTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTTTGCCTATTAAACCAAGTTGTGTTTTTTTTCCAAACAAGCATCAATAAACTTGGGTAAATTTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   4      seed Te1  5g3  in                        CBWN15802.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTACCTTTGTCAAGAACATTTTCCGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGAAAAAAAAAAAAAAA
  3   1   2       ext Te1  5g3  in                         CBWN6986.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGACAACAAGCATTCACGGTGATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGGGAAAAAAAAAAAAAAA
  3   1   3        nb Te5       in                         CAAO2480.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATAGAGAACAATGTCAAAGAGAGGAAGCTATCCGGGATTTCAGAAGTGGGAAGTGTCCTGTTATTGTCTGTACAGCAGTTGCTGCGAGAGGCTTAGATATTGAAAATGTTCAACATGTGATAAATTATGACGTTCCTAAGGAAATCGACGAGTATGTCCATAGAATTGGTCGCACTGGTCGCTGTGGTAACGTTGGAAAGGCAACTTCATTTTTTAATGTTAATGAAGACCATGTTGTTGCTCGTCCCCTTGTGAAAATCCTTACTGATGCTCATCAAGAAGTCCCTGCTTGGTTAGAAGAAATTGCCTTTGGTGGCCATGGAGCTTTGAACAGCTTATATGCAGCAGACTCTATGGGTGGAGAGGCTGGAGAAAAGTACGTCAGTGCTCCTTCATCTGCACAAGAGGAGGAGGCCAGCTGGGATTAAATAGTATAAGCAGAATTCAAATATTGTTAAAATATCTTGTTTGAAAGCATCTTTTCCAAGAGCCAAAAAGGCCAAAGTTGCACTACGTAAGAATTCCTACTTTAATAGCAAACAGCGCAGGTTATTTTATTTCATTTACATTGTTTCAATATTGAGTCTGTATGAGAATTTGTTTGCTTTCCAACATAGTTTATTTCATTGAAATATATATTGTTTAACTGGAAATGAAAAGTTTTACTTCTGCCTATTAAACCAAGTTGTGTTTTTCTTCCAAACAAGCATCAATAAACTTGCGTAAATATGG

In case of problems mail me! (