Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAN5258.3                            2 END     2           1      100                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012071334 Xt7.1-CAAR539.3 - 125 ESTs
                                                                       -50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-CAAR539.3                                                   CTTCAGATTCTTCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCC
                                                  Xt7.1-CHK-1008222685                                                         ATTCTTCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGTTACC
                                                      consensus depths                                                        4     4     6     6     8     8    15    17    20    24    26    33    29    37    30    38    37    42    41    43    43    44    43    44    43    44    43    44    43    44    44    45    45    46    45    46    45    46    45    46    45    46    45    46    45    46    45    46    45    46    46    47    45    46    45    46    45    46    44    45    44    45    44    45    44    45    45    46    46    47    47    48    47    48    47    48    46    47    46    47    48    49    48    49    50    51    51    51    51    51    53    53    52    52    53    53    52    52    51    52    50    51    49    50    49    50    49    50    45    45    45    45    43    44    42    43    44    44    44    44    42    43    42    43    41    42    39    41    38    40    36    39    36    39    34    37    29    32    26    29    27    29    26    28    26    28    25    27    25    26    22    23    21    22    21    22    20    20    20    20    19    20    14    14    15    15    15    15    15    15    16    16    17    17    17    18    18    19    19    19    21    21    23    23    34    37    37    39    37    39    38    39    38    39    39    40    40    41    41    42    43    44    42    43    47    48    48    49    49    50    50    51    47    51    55    56    53    56    55    57    56    57    55    58    56    58    56    58    57    58    55    57    56    59    57    60    59    61    59    61    59    61    58    61    60    60    57    60    59    60    60    61    59    61    60    61    61    61    59    61    58    61    60    61    60    60    59    60    59    60    60    62    60    61    61    62    61    62    61    62    59    61    61    61    59    61    62    62    62    62    59    62    61    61    60    61    60    61    60    61    55    58    51    57    35    57    36    57    36    57    33    55    32    54    31    44    23    35    23    34    22    34    22    32    22    32    22    32    16    24
                                                                   SNP                                                                                                                                                   C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----AT-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------G----
                                               BLH ATG      13    1873                                                   
                                               BLH MIN      13     270                                                   
                                               BLH OVR      13      44                                                   
                                               EST CLI      41      28                                                   
                                               ORF LNG      13       4                                                   
                                                                                                                             PROTEIN --- Sc ---- 2e-094     NP_014779.1 NAD+-dependent isocitrate dehydrogenase; Idh2p [Saccharomyces cerevisiae] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PROTEIN --- Ce ---- 3e-132     NP_492330.2 F43G9.1 [Caenorhabditis elegans] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PROTEIN --- Dm ---- 2e-139     NP_573388.1 CG12233-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PREDICTED = Sp ==== 6e-144     XP_792505.2 PREDICTED: similar to isocitrate dehydrogenase [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 0          XP_413748.2 PREDICTED: isocitrate dehydrogenase 3 (NAD+) alpha [Gallus gallus] ----------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PROTEIN === Hs ==== 0          NP_005521.1 isocitrate dehydrogenase 3 (NAD+) alpha precursor; isocitrate dehydrogenase[NAD] subunit alpha, mitochondrial; NAD+-specific ICDH; NAD(H)-specificisocitrate dehydrogenase alpha subunit precursor; isocitrate dehydrogenase(NAD+) alpha chain precursor; H-IDH  ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PROTEIN === Mm ==== 0          NP_083849.1 isocitrate dehydrogenase 3 (NAD+) alpha [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN === Dr ==== 0          NP_957245.2 isocitrate dehydrogenase 3 (NAD+) alpha [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                      PROTEIN === Xl ==== 0          AAH73655.1 MGC82998 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                      PROTEIN === ?? ==== 0          NP_001085990.1 MGC82998 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PREDICTED = Xt ==== 0          AAH64220.1 Hypothetical protein MGC76128 [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-CAAR539.3                                                                ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------ATG------------ATG------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------ATG------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------TAG------------TGA---------------ATG------TGA------------------------------TGA---------------------------------------------------ATG------------------------------------------------------------------------------TAA------------------------ATG---------TGA---------------------------------------------------------------------------TGA---------ATG---------------------------TGA------------TAA---------------------ATG---------------------------------------------------------------------------------TAG------------------------------TGA---------------------TAA------------------------------------TAA---------------------------------------ATG---------TAA------TAA---------------------TAA---------------------------------------------------------------------------------------------TGAATG---------TGA------TAA---------------------------------TGA
                                                                   ORF                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   1           Gas1 FL                     IMAGE:5309202.FL-MGC                                                                  GAACATGGCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGTTAAAATATAGAAAAAAAAAAAAAAAA
  5   1   2   10  bld Te1  5g3  in                         CBWN1197.b1 ...................GGCATATACGTCAACAAGATTCCCCGCCTCTCTTCAGATTCTTCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGT
  5   1   2       bld TpA  5g3  in                   TTpA054i06.p1kSP6                                       CGGGCCGCCTCTCTTCAGATTCTTCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCC
  5   1   2       bld BrSp 5g3  in                    EC0CBA003AF05.g1                                             GGGTCTCTTCAGATTCTTCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACA
  5   1   2       bld BrSp 5g3  in                     EC2BBA22BF01.g1                                              GGGCTCTTCAGATTCTTCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAA
  5   1   2       bld Te5       in                         CAAO2346.5p                                                            CTTCATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTT
  5   1   2       bld TpA  5g                        TTpA061h21.p1kSP6                                                               CATGAACATGGCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCANGTTTAATTGGAGGCCT
  5   1   2       bld Gas1 FL   in                    IMAGE:5309202.y1                                                                   GACATGGCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAG
  5   1   2       bld TbA                            TTbA057e14.p1kSP6                                                                         GCTGGCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGC
  5   1   2       bld Neu                            TNeu012b22.p1kSP6                                                                             GCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAA
  5   1   2       bld Brn4      in                        CAAL18058.5p                                                                             GCAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCC
  5   1   2       bld TpA       in                   TTpA028c06.p1kSP6                                                                              CCCGGGCCCGGGGCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGNCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTNGGAAAGACTTGGCTAATCCCACTGCTCTTCTTTCTAGCGCAGTCATGATGTTGCGGCACATGGGTC
  5   1   2       bld Te1                                 CBWN11456.b1                                                                              CAGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAA
  5   1   2       bld TpA       in                   TTpA024e23.p1kSP6                                                                               AGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACC
  5   1   2       bld Te4       out                        CAAN5258.5p                                                                               AGCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTNGTAGTCATGCCAAACCCTTTATGGTGACATCTTGAGTGACCTTTGTGC
  5   1   2       bld Gas       in                   TGas108b19.p1kSP6                                                                                GCGCCTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAA
  5   1   2       bld Gas                            TGas011b18.p1kSP6                                                                                    CCTGGNAGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGGAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAA
  5   1   2       bld Te1       in                        CBWN13394.b1                                                                                    CTGGAGGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTCAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGGTGACATCTTGAGGTGACCTTTGTGCAGGGTTTAATTGGAGGGCCTGGGAGTGACGCCAAGTG
  5   1   2       bld Gas7      in                         XZG26188.5p                                                                                         GGTCACTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTG
  5   1   2       bld TbA       in                   TTbA055f15.p1kSP6                                                                                            CCCGGGGCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAANACTTTANAGACATTANATTTAATGANATGTATCTGGATACCGTGTGT
  5   1   2       bld Tad5      in                         XZT10255.5p                                                                                              CTGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAAT
  5   1   2       bld Neu       in                  TNeu067b12.p1caSP6                                                                                               TGATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGGGGGAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAAGAAGCACAGTGACTGCGGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAA
  5   1   2       bld Spl2      in                        CBSS9699.fwd                                                                                               GATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCC
  5   1   2       bld Tbd0                               IMAGE:6980137                                                                                                GATCTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTTATATGGTCCAGGATCCTACCCAGTTNGATGTGTTAGTCATGCCCAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTNNANTGGANGCN
  5   1   2       bld TpA       in                   TTpA051d17.p1kSP6                                                                                                  CTCTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGNCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGC
  5   1   2       bld Brn4                                  CAAL535.5p                                                                                                     CTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTATTTGGAGGCCTGGGAGTGA
  5   1   2       bld Gas7                                 XZG64345.5p                                                                                                     CTCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGGACTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTG
  5   1   2       bld Brn4      in                        CAAL21477.5p                                                                                                      TCGTGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCC
  5   1   2       bld Sto1      in                         CABG8831.5p                                                                                                        TGTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAA
  5   1   2       bld Ova1      in                         CABE8766.5p                                                                                                         CCGAGGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCT
  5   1   2       bld Liv1      in                          CAAR539.5p                                                                                                          GTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGAC
  5   1   2       bld Spl1      in                         CABK5940.5p                                                                                                          GTGGCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTT
  5   1   2       bld Tbd0                               IMAGE:6979640                                                                                                            TCGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCANGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTATTGGNNAGGCTGGGAGTN
  5   1   2       bld Hrt1      in                         CAAQ9383.5p                                                                                                              CGGGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCCAGTGGAAATATTGGTGCTAATGNGGTAGCAATCTTTGAATCGGTTCATGGCACAG
  5   1   2       bld Egg                            TEgg086f12.p1kSP6                                                                                                                GGGGCACTCACTGCACCACAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGCGGATGGAATTGGCCCACACATTTCAACAGCTGTCATGACAATTCTTCAGACTGCCAAAGCACCTGTACAGTGGGAAGAGACAAATGTCACACCAATTAAACGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAACAACAAGATGGGCTTAAAAGGACC
  5   1   2       bld Egg0      in                         dad57d05.y1                                                                                                                GGGGCACTCACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTG
  5   1   2       bld Tad5      in                         XZT15364.5p                                                                                                                  GCACTCACTGCACCAGAATATGGAGCCAGGCAGNCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTC
  5   1   2       bld TbA       in                   TTbA074g24.p1kSP6                                                                                                                        CACTGCACCAGAATATGGAGCCAGGCAGCTTTCTAACCCTGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGNGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCT
  5   1   2       bld Hrt1      in                         CAAQ4144.5p                                                                                                                                CAGAATATGGAGCCAGGCAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTG
  5   1   2       bld Spl1      in                         CABK9041.5p                                                                                                                                                CANGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGNGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCT
  5   1   2       bld Hrt1      in                         CAAQ9569.5p                                                                                                                                                 CAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTTGCGCACATGGGTC
  5   1   2       bld Ovi1      in                         CABI8256.5p                                                                                                                                                 CAGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAA
  5   1   2       bld Hrt1      in                         CAAQ3776.5p                                                                                                                                                  AGCTTTCTAACCATGTGCAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGNGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGGCGCACATGGGTC
  5   1   2       bld Int1      in                         CAAP2863.5p                                                                                                                                                             TCGGCACGAGGTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGC
  5   1   2       bld Ovi1      in                         CABI9955.5p                                                                                                                                                                   CAGACTGTCACTCTTATACCAGGGGATGGAATTGGCCCAGAGATTTCAACAGCTGTCATGAAAATTTTTGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACAT
  5   1   2       bld Spl1      ?                          CABK8743.5p                                                                                                                                                                                                                                      TGAGACTGCCAAAGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAAT
  5   1   2       bld Tad5      in                         XZT56991.5p                                                                                                                                                                                                                                         AGGATTTAACGGCACCTGTACAGTGGGAAGAGAGAAATGTCACAGCAATTAAAGGCCCTGGTGGAAAGTGGATGATTCCTCCTGAAGCCAAAGAATCCATGGATAAGAACAAGATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCGTCCATGAACTTGCTGCTCCGCAAGACATTTGATCTCTATGCAAATGTGCGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCT
  5   1   2       bld Ova1                                CABE13327.5p                                                                                                                                                                                                                                                                                                                                                         GATGGGCTTAAAAGGACCTTTAAAGACACCCATTGCTGCTGGGCATCCTTCCATGAACTTGCTGCTCCGCAAAACATTTGATCTCTATGCACATGTGCGACCCTGTGTTTCTATTGACGGCTACAGGACCCCATACACCCATGTAGACCTGGACACAATTCGTGAGAACACAGAGGAAGAATATACTGGTATCCAGCATGTGATTGTAGATGGTGTGGTGCATAGCATTAAGCTGATCACGGAGGAAGCCAGCCCTCGCATTGCACACTTTGCCTTTGAGTATGCTAGGAACAACCTGAGAAGCACAGTGACTGCATTGCACCAAGCTAAAATTATGAGGATGTCTGATGCGCTGTTCCTAAAAAAATGTCGAGAAGTTGCCTATCACTTTAGAGA
  3  -1   2       bld Int1      in                         CAAP6579.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGACCCTGTGTTTCTATTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATC
  5   1   2       bld Hrt1      in                         CAAQ4523.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGAGGGCTACAGGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCA
  5   1   2       bld Tad5      in                         XZT61223.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGACCCCATACACAGATGTAGACCTGGTCACAATTCGTGAGAACACAGAGGGAGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAAATCAATCTGGGAAGGCTCTGACTAAAGA
  5   1   2       bld Gas                            TGas054d07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAATATAGTGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGC
  5   1   2       bld TbA                            TTbA040o05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGTATCGAGCATGTGATTGTAGATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAAT
  5   1   2       bld Gas       in                   TGas106f09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGT
  5   1   2       bld Brn4                                 CAAL9895.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGGTGTGGTGCAAAGCATTAAGCTGATTACGGAGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGNGTAAACACGAGTGGGATCTCAGATTCATAATGCAGTGATCATCAATTAGAAATCATGCAGCAATGCTGATTAGAATCAAAGT
  5   1   2       bld BrSp      in                     EC2BBA35DA12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGT
  5   1   2       bld Te5                                  CAAO3982.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGCCAGCCATCGCATTGCACAGTTTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGNGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGNCATGCTGATTAGAATCAAAGTTATACATATACTGACAGTCGTATTTTTGTCAATTA
  5   1   2       bld Sto1      in                         CABG3463.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGCCTTTGAGTATGCAAGGAACAACCAGAGAAGCACAGTGACTGCAGTGCACAAAGCTAATATTATGAGGATGTCTGATGGGCTGTTCCTAAAAAAATGTCGAGAAGTTGCAGAAAACTTTAAAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAATATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGNGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAAATCAAGTTTATACATATACTGACAGTCGTATTTTTGTCATTTA
  5   1   2       bld Gas7      in                         XZG36685.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGACATTAAATTTAATGAAATGTATCTGGATACCGTGTGTCTTAACATGGTCCAGGATCCTACCCAGTTTGATGTGTTAGTCATGCCAAACCTTTATGGTGACATCTTGAGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATATTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGCCAGTTTTGTGATTTATCCTTATGCCAAGCAT
  5   1   2       bld Ova1      in                         CABE5565.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTGACCTTTGTGCAGGTTTAATTGGAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCCATGCAGCAATGCTGATTAGAATCAAAGTTTATACCATATACTGACCGTCGTATTTTTGTCAATTACCCAGCTT
  5   1   2       bld TbA       in                   TTbA011f01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGCCTGGGAGTGACGCCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCGTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGGCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAACATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATT
  5   1   2       bld Ova1      in                         CABE3284.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAAGTGGAAATATTGGTGCTAATGGGGTAGCAATCTTTGAATCGGTTCATGGCACAGCTCCAGATATTGCTGGAAAAGACTTGGCTAATCCCACTGCTCTTCTTCTAAGCGCAGTCATGATGTTGCGGCACATGGGTCTCCACGAACATGCACGCAAAATAGAAAATGCTTGCTTTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTANAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGC
  3   1   2       bld Sto1      in                         CABG8831.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACATGCACGCAAAATAGAAAATGCTTGCTNTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCC
  3   1   2       bld TpA       in                    TTpA028c06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATGCTTGCTNTGAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTAAAAAAAAAAAAAAAACCCCGGGCCCGGGGAATCCCCGGGGAA
  5  -1   2       bld Int1      in                         CAAP6579.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGACAATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCA
  5   1   2       bld Gas7      in                         XZG45618.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATGGCTATACA
  5   1   2       bld Tad5      in                         XZT28880.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCAAATCTGGGAAGGCTCTGACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGTAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATNAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCA
  3   1   2       bld Spl1      in                         CABK9041.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGGCTCTGACTAAAGACTTGGGTGTAACTCCAAGTGCTCTGAATTACCCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTC
  3   1   2       bld Hrt1      in                         CAAQ9569.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACTAAAGACTTGGGTGGTAACTCCAAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTGAATGTC
  5   1   2       bld TpA                            TTpA020b15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCGGGGACTCCAGTGCTCTGAATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACGTTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGT
  3   1   2       bld Te5       in                         CAAO2346.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTACCAATGAAATCTGTCGCAGAATACAGGATAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTC
  3   1   2       bld Hrt1      in                         CAAQ4523.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTACCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATGATTTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACNCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCGCGT
  3   1   2       bld Spl1      in                         CABK5940.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAATGAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTC
  3   1   2       bld BrSp      in                     EC2BBA35DA12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAATCTGTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACATGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCA
  3   1   2       bld Brn4      in                        CAAL18058.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATATTTTCCTGCTGTCTNTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTC
  3   1   2       bld Brn4      in                        CAAL21477.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTNTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTC
  3   1   2       bld Hrt1      in                         CAAQ3776.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCGCAGAATACAGGACAGTGATTAGCTTGCATCTATTTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGTANAACCTCTCGCCCTAT
  3   1   2       bld Ova1      in                         CABE8766.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCGCAGAATACAGAACAGTGATTAGCTTTGCATCTATGATTTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTT
  3   1   2       bld Ovi1      in                         CABI9955.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCGCAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTNTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTC
  5   1   2       bld Tad5                                 XZT20600.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGACGCGTGGGAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCNAAGTCCAAGAG
  3   1   2       bld Te1  5g3  in                         CBWN1197.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCAGAATACAGGACCAGTGATTAGCTTTGCATCTATTGATTTACTCCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGTTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAATGTTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAAAAAAAAAAAAAA
  3   1   2       bld Gas       ?                     TGas054b05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGGCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAAGTGTGCAAAGTCAAAGAGACATTGAATTCAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas108b19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTTCATAAAGCNTTTTATTTTTAAACCCCGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA055f15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAACNCCGTTAAAAAAAAAAAAAAAAAG
  3   1   2       bld Hrt1      in                         CAAQ9383.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAATACAGGACAGTGATTAGCTTTGCATCTATGATTTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTNTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCNTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGC
  3   1   2       bld Te1       in                        CBWN13394.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGGTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAAAAAAAAAAAA
  3   1   2      seed Liv1      in                          CAAR539.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCG
  5   1   2       bld Ova1                                 CABE1977.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATACAGGACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCCATTTTTCC
  3   1   2       bld Ova1      in                         CABE3284.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGACAGTGATTAGCTTTGCATCTATGATTTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTNTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCNTGCTATGCATGGCATGCTACNCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCC
  3   1   2       bld Ova1      in                         CABE5565.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAGTGATTAGCTTTGCATCTATTGATTTACTTCTGTCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTG
  3   1   2       bld Hrt1      in                         CAAQ4144.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCAAATGGTCAGCTGAATTGACAAGCACATAATTTCCTGCTGTCTNTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCNTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGTT
  3   1   2       bld TpA                             TTpA041d17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAATTGACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGGCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGTTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTGCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA074g24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAAGCACATAATTTCCTGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTGGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTGGAATTTATATTTATTTATAATTTCACTCCATTTTTCCGGGGTTTTTTTTTTTCTGGCTATTATGCACTTGGTGTTTGGCATTTTCATAAAGGGTGCAAAGTCAAGGAGACATGGAAGTCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Sto1      in                         CABG3463.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCTGTCTTTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACNCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGGCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCGCGT
  3   1   2       bld Tad5      out                        XZT13467.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGGCATTTGAAGGTC
  3   1   2       bld Tad5      in                         XZT15364.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATATGCATCAGTGCTTCATCTTCATCCCAGCAAACCAAAAGCCNTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Ovi1      in                         CABI8256.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGT
  3   1   2       bld Tad5      in                         XZT28880.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCATCCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGTAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCGGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTC
  3   1   2       bld TpA       in                    TTpA024e23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCAGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTGAAGTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas106f09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGGCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTGAATTCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA051d17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAAACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTTTTTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGGGGAATTTCAGATTCATAATGCAGGGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTGGTATTTTTGTCAATTACGCAGCTTTTTCCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTTAGGGCCCACTGAATTTGTTGTTTTTAAACATGGAATATATATCCCGGGAGGTTCATTTGCATAACCAAACTTGTTTTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGGGGTTTTTCAGGGGTTGCTCATTAACTGGGGCCCAGCAGAGGATGCTTGTTGTCAAGGAGGTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAAAGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCCCTCCCTTTTTCCTGGGTTTTTTTTTTCTTGCTATTATGCACTTTGGGTTTTGCATTTTCATTAAATGGGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCCTGATGCAGATAAGTATGTTTTGTTTTAGGGGAAATAAACTCCCGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld BrSp 5g3  in                     EC2BBA22BF01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACCAAAAGCCCTGCTATGCATGGCATGCTACCCAGTGTGTATAGGCTTCTCCGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCGGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGGTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGA
  3   1   2       bld Neu       in                    TNeu067b12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCATGGCATGCTACCCAGTGTGTATAGGCTTCTCTGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGGCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCCGTAAAAATAATGAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA011f01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCATGTTACCCAGTGTGTATAGGCTTTTTTGGCAGTGCAAGATTCCAGTGGGTAAACAGGAGGGGAATTTCAGATTCATAATGCGGTGATCATCAATTAGAATCAATGCAGCAAGGCTGATTAGAATCAAAGTTTATACATATACTGACAGTGGTATTTTTGTCAATTAGGCAGTTTTTACCAGGGCCAGTTTTGTGATTTTTCTTTAGGGCAAGCATTCCCTTTTTCAGGGCACAATGAATTTGTTGTTTTTAAACAGGGAATATATATCCAGGGATGTTCATTTGCATAACCAAACTGGTTCTATCCTTATATACCATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACGGGTGCAGTAAAAATATTGGCTATACAGGAGGTTTTTCGGGGGTTGCTCATTAACTGGTGCCCAGCAGGGGATGCTTGTTGTCAAGGAGTTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCAGGTTCAAGCCTTAAACATTGTAATTTGGAATTTATATTTATTTATAATTTCACTCCATTTTTCCGGGGTTTTTTTTTTTCTGGCTATAATGCACTTTGTGTTTTGCATTTTCATTAAAGGGGCAAAGTCAAAGGGACATTTGAAGGTCACAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG36685.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTAGTTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGTAAAAATAT
  3   1   2       bld Gas7      in                         XZG45618.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTC
  3   1   2       bld Tad5      in                         XZT56991.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7      in                         XZG26188.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTC
  3   1   2       bld TpA       out                  TTpA078i07.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGGCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACTCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAACCCGTTAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       out                   TTbA037b23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGTGCAAGATTCCAGTGGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACCGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTAATAGTGTAACAAGATAT
  3   1   2       bld Spl2      in                        CBSS9699.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGTAAACACGAGTGGAATCTCAGATTCATAATGCAGTGATCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCC
  3   1   2       bld Tad5      in                         XZT10255.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATGCAGTGTTCATCAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTTCTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATCTCTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGAAAATAAAAAAAAAA
  3   1   2       bld TpA  5g3  in                    TTpA054i06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAATTAGAATCAATGCAGCAATGCTGATTAGAATCAAAGTTTATACATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGGCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT16764.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGCAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTT
  3   1   2       bld Egg0      in                         dad57d05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATATACTGACAGTCGTATTTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGATTTTATTTTTAAACCCGTAAAAA
  5   1   2       bld Tad5      in                         XZT16764.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGTCGTATTTTTGTCAATTACGCACGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAAAA
  3   1   2       chi TbA                             TTbA043o12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTGTCAATTACGCGGCTTTTACCAGGGCCAGTTTTGGGATTTATCTTTAGGGCAGGCATTCCTTTTTTTGGGGCCCCCTGAATTTGTTGAAATAAAACAGGGGGTTTTTTTCCAGGGAGGTTCATTGGCATAACCAAACTTGTTTTTTCCTTATAAAACATTAATATTGTACCAAGATAGGGTTGGTTTTATTGTTGCAGTTAGAAAAGAGGCGGTAAAAATATGGGCTATACATGGGGTTTTTCAGGGGTTGTTCATAAAAGGGGGCCCACCAGGGGATGTTTGTTGTAAAGGGGGTAAAAAACATGCCGGAATCCGGAAATAAGGGTTTTAAATGTTATTTTCAAGCCTAAAACATGGTAAATTGGAATTAAATTTATTTTTAATTTCATTCCATTTTTCTTGGGTTTTTTTTTTTTATAGAAAATAAGTGCCGCTTGGGGTTTAGCAATTAAAAAAAAAAGAAAAATAAAAAGAGACATTTGAATGTCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld BrSp 5g3  in                    EC0CBA003AF05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGGTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp      in                     EC2BBA12BG11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGGTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTGTTATAGGAGA
  5   1   2       bld BrSp      in                     EC2BBA12BG11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGTCAATTACGCAGCTTTTACCAAGGCCAGTTTTGTGATTTATCCTTATGCCAAGCATTCCCTTTTTCAGCGCACACTGAATTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGGTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT61223.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGTTGTATTTAAACATGGAATATATATCCATGGATGTTCATTTGCATAACCAAACTTGTTCTATCCTTATATAACATTACTACTGTAACAAGATATGGTTTGTATTACTGCTGCAGTTAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTT
  3   1   2       bld Ski1      in                        CABJ12198.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGC
  5   1   2       bld Ski1      in                        CABJ12198.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGAACTGCTGCAGTAAAAATATTGGCTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Int1      in                         CAAP2863.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTATACATGAGGTCTTTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGT
  3   1   2       bld Gas1 FL   in                    IMAGE:5309202.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCAGTGGTTGCTCATTAACTGGTGCCCAGCAGAGGATGCTTGTTGTCAAGGAGCTAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGTTAAAATATAGAAAAAAAAAAAAAAAAG
  5   1   2       bld Tad5      out                         XZT4564.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAAACAACATGCCAGAATCCTGAAATAACTGTTATAAATGTCATGTTCAAGCCTTAAACATTGTAATTTAGAATTTATATTTATTTATAATTTCACTCCATTTTTCCTGTGTTTTTTTTTTTCTTGCTATTATGCACTTTGTGTTTTGCATTTTCATTAAATGTGCAAAGTCAAAGAGACATTTGAATGTCAAAAACCTGATGCAGATAAGTATGTTTTGTTATAGGAGAAATAGTTAATTGGTGACAGCTCATAAAGCTTTTATTTTTAAACCCGTTACCTGTGTCTACTGAATCTGATGGGGAAAAAAAAAACCAAGGGAGGAGGCTAGCAGTTAATAGACGTTTAGACAAATGTATGAATTTGGTGGACACGTCTATTTTTCCAACCCTTTACAACATTAAAGTGGTTGTAAATTCAAAATACAAAAGCTAATATCCGGTTCGCCCCTCAAAAACAAAGCTATCTACAATATATTTCCAGAGTTCTTCAGTTCTTGACTGAAGGAAGCAGGGAGAAACAAATACATAAAGCAACCCTTTacactaaggggcacatttactaacccacgaacgggccgaatgcgtccgattgcatttttttcgtaatgatcggtaattttgcngattttttcg

In case of problems mail me! (mike.gilchrist@crick.ac.uk)