Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-XZT59050.3                            2 END     2           1      100                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012071387 Xt7.1-TEgg079h22.5.5 - 119 ESTs
                                                                       -50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TEgg079h22.5.5                                                   TGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTTAACTCTCTCTTAATGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCATAAAGAGCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222777                                                         GTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTxTxTTTTTTTTTTTTTTTTTTTTTAACTCTCTCxxxxTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAxAxxGxxxxxxAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                       21    33    36    48    49    52    51    53    51    54    50    54    53    56    56    58    56    59    57    59    57    59    56    59    58    60    57    62    59    61    61    62    59    62    61    62    61    62    60    61    60    61    59    61    60    61    59    60    59    60    60    61    60    61    60    61    60    61    63    64    63    64    63    64    64    65    64    65    64    65    64    65    64    65    64    66    67    68    66    68    66    67    66    67    66    68    67    68    66    69    66    69    65    68    62    66    62    66    60    64    61    65    53    59    43    49    33    38    24    26    21    22    21    24    22    24    22    25    23    28    18    23    18    23    19    24    18    24    18    24    19    26    20    29    20    28    17    27    18    27    22    32    22    32    23    33    24    35    24    35    24    36    23    35    24    35    23    37    24    36    25    37    24    37    23    36    24    36    21    35    23    36    24    36    29    35    29    36    29    36    27    33    29    34    27    36    27    37    28    37    30    37    25    36    31    37    27    37    29    37    31    39    28    38    29    38    27    38    27    37    30    37    29    37    30    38    20    37    27    37     9    37     9    38    12    40    13    41    13    41    13    40    13    39    11    38    12    38    12    37    12    37    12    34    11    34    11    32     6    22    10    20    10    13     5     7
  5   1   2  SIG                                    Xt7.1-TEgg079h22.5                                       GGCAAGTACTGATGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2                                         Xt7.1-TEgg104j17.5                                                   TGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCCCCACCCCAGAACATCTAACTGCAATTACCCCAACACACACTCGAGAGCACACCCTTATAACCCTCCACCTCATCCCTATCATTCCACTAATAATAAAACCAGAACTAATCTGAGGCCTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTAACTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCACTATTCTAGTGTGGATTAATAAGAATTCTATTGTATTATAGTTTGGTCAGTCACCCTAACGCTGAAACATTCTTTAAAAGAGAATGCAAGTCAAAATTTTAAAGCATACTGCTCAATAGTCCTCCTATTGTTTAGTAAAAACAAATATTTACTTGGTCACTTACTTCACATTTTCTAGAACAGGCAGCCATCTCTAAAAGGGGTATTCTCCCTTCCTTTCCCTCCTTGCTTCATACTGCACATGTTTCATTCATTCCCTCTGCCAGATCCGCTTCTGATTGTCTGGTGGGCATGTGTAGCTCTGAACAGGAGACAGGATCAAGTTACACACATGCTCAGAATAGGAAGGCTGCCGCTGGCAGCCTACAGGAAGGGAAGAGACATTTCAGTGATGTCACTGGAGTCTTTACACTGCTGTAGGCTGCCAGCATCATATCTCAGAAGCAAGCAGGGATCTGGGAATTTAGATATGCAGTAAGTACTTAAAAAGAATGCCTTTAGACTTACTTTTAATTTATATTAACCTTTCATTGTCCTTTAAGTGAACTTGTTAGTTGTACCTGTATTAT
  5   1   2  SIG                                    Xt7.1-TEgg075b06.5                                                      GTGGTGGTGGTGTTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCA------------------------------------------------TAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTTAACTCTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACTCTCTCAATGTTTGACACTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAATTTATTCTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTATTTTAATTTGCCAATATCAA
                                                                   SNP                                                               ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------G--G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -------C----
                                               BLH ATG     170     882                                                   
                                               BLH MIN     170      79                                                   
                                               BLH MPR     170      79                                                   
                                               BLH OVR       2       8                                                   
                                               CDS MIN       2      51                                                   
                                               EST CLI      -6      51                                                   
                                               ORF LNG       2       3                                                   
                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 5e-082     NP_001006045.1 zgc:103418 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 6e-097     NP_996726.1 cited2/melanocyte specific gene-related gene 1 MRG1 [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 2e-101     NP_034958.2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 6e-102     NP_006070.2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain,2 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 2e-117     AAH84310.1 LOC495124 protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                   PREDICTED = ?? ==== 2e-117     NP_001088289.1 hypothetical protein LOC495124 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                   PREDICTED = Xt ==== 3e-138     AAH67308.1 Hypothetical protein MGC75612 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TEgg079h22.5.5                                                     ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATGATG---ATG------------------------------------------------------ATG---ATG------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------ATG---------------ATG------------------------------------------------------------ATG------------------------------------------TAG---------------------------TGA---------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------TAA---------------------------------------------------------------------TGA---------TAA------------TAA------------------------TAA---------------------------------------TAA---------------------------------TGA------TAA---------------------------------------------------------------------TAA---------------------------------------------------TAG
                                                                   ORF                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2  SIG                                    Xt7.1-TEgg079h22.5                                       GGCAAGTACTGATGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008276786                                             AAxTxxTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Neu  FL                     TNeu124g09.FL-Sanger                                                  CTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCAAACAAATAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FLx                    TEgg144j19.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCGGGGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Egg  5g                        TEgg011k05.p1kSP6 ATTAAACAAGCTGGGAAAAAGAAGCACAGTTCATTGTTGGCAAGTACTGATGTGTGGTGGTGGTGTTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGG
  5   1   2       ext Egg  5g3  in                   TEgg017n20.p1kSP6                           CCGGGGCCCGGGGAATCCCCGGGCTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAG
  5   1   3        nb Egg  5g                        TEgg124i18.p1kSP6                              AATTCGCCGGGCAAGTACTGATGTGTGGTGGTGGTGTTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCT
  5   1   3        nb Egg  5g                        TEgg096n02.p1kSP6                               CCCGGGCCCCGGGCAAGTACTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGC
  3  -1   2       ext Egg       in                    TEgg064o11.q1kT7                                GCGTCGACACTAGTTCTCCTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGGACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCANATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCANAGCACAGCACTGGCATGCCTCCCTCAGTCAGCACGTCCTGC
  5   1   3        nb Egg  5g                        TEgg034h19.p1kSP6                                          AAGTACTGATGTGTGGTGGTGGTGTTACAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTATCATACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTTACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGC
  5   1   3        nb Egg  5g3  in                   TEgg037g15.p1kSP6                                          GCAAGTACTGATGTGTGGTGGTGGTATAAATATGAGGAACTCTGTGCTGCAGCAATATCTGATTACAGGGTCATTTAGCAAACTACAAGAGGGAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCATGCATCATTTTTGGAGCATTCACAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATACCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGGCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCACGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCT
  5   1   3        nb Egg  5g                        TEgg114d12.p1kSP6                                          AAGTACTGATGTGTGGTGGTGGTGTTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGC
  5   1   3        nb Egg  5g                        TEgg034j22.p1kSP6                                           AAGTACTGATGTGTGGTGGTGGTGTTAAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTTACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATG
  3  -1   2       ext Egg       in                    TEgg065g08.q1kT7                                            TTCTCCTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGGACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTNGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTT
  5   1   3        nb Egg  5g3  in                   TEgg033a02.p1kSP6                                             AAGTACTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAAT
  5   1   3        nb Egg  5g                        TEgg034d08.p1kSP6                                             AAGTACTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAACCCCGCATTTTAGAGACTGTA
  5   1   3        nb Egg  5g                        TEgg034d10.p1kSP6                                             AAGTACTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCT
  5   1   3        nb Egg  5g                        TEgg041m14.p1kSP6                                             AAGTACTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGTCGTCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGAGATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCA
  5   1   3        nb Egg  5g                        TEgg107p10.p1kSP6                                             AAGTACTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACT
  5   1   3        nb Egg  5g                        TEgg135f24.p1kSP6                                             AAGTACTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAG
  5   1   3        nb Gas  5g   ?                    TGas058n11.p1cSP6                                             AAGTACTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATAAGGGGCTCAACTGA
  5   1   3        nb Tbd0 FL   ?                     IMAGE:5379297.y1                                               CTGATGTGTGGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATG
  5   1   2       add Egg  5g3  in                   TEgg071g05.p1kSP6                                                TGATGTGTGGTGGTGGTGTTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACT
  5   1   3        nb Egg  5g                        TEgg108l01.p1kSP6                                                TACTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTA
  5   1   3        nb Egg  5g                        TEgg131m06.p1kSP6                                                 ACTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACA
  5   1   3        nb Egg  5g                        TEgg137g06.p1kSP6                                                 TGATGTGTGGTGGTGGTGTTAAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACCATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACT
  5   1   2       add Egg  5g3  in                   TEgg037k14.p1kSP6                                                  ACTGATGTGTGGTGGTGGTAAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCA
  5   1   3        nb Gas  5g3  in                   TGas055g17.p1cSP6                                                  CTGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCA
  5   1   4      seed Egg  5g3  in                   TEgg015j17.p1kSP6                                                   TGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTC
  5   1   3        nb Egg  5g3  in                   TEgg071h06.p1kSP6                                                   TGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCA
  5   1   3        nb Egg  5g                        TEgg092d15.p1kSP6                                                   TGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACA
  5   1   3        nb Egg  5g                        TEgg098o03.p1kSP6                                                   TGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATC
  5   1   3        nb Gas  5g                       TGas090p02.p1kaSP6                                                   TGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCA
  5   1   3        nb Gas  5g                        TGas137i11.p1kSP6                                                   ATGTGTGGTGGTGGTGTTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACTGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAAT
  5   1   3        nb Neu  FL   in                   TNeu124g09.p1cSP6                                                   TGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACT
  5   1   3        nb Egg  5g                        TEgg079h22.p1kSP6                                                    GATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCT
  5   1   0       chi Egg       out                  TEgg068e08.p1kSP6                                                      GGCGGCTCCAGCTGCTCAGAGACTATCATCCCGAAGGAATTGACACTCAAGAGACCGACTCCCGGGGCAAGTGACAGTCCAGATACTCCCGGGAATGGCTCATGGGGATCCCGGTGGGCATACTCCACAGGCTCCGTCTATGGGACTGATAATAAACCCGATGACCCTAAAGCAACGGATAATCCCCATGGGGCGGGGCCACATCCCAGGGACCCCCCATGGGGGGAGAAGGGGCTCTCGTACCCTCCAGAGGGGGAGATTGTGCTCTCGTCACTCCTCACCCGCGGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCAT
  5   1   3        nb Egg                            TEgg117c20.p1kSP6                                                       GTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAAATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTC
  5   1   3        nb Egg                            TEgg138k21.p1kSP6                                                       TGGTGGTGGTGTTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTC
  5   1   3        nb Egg                            TEgg138l05.p1kSP6                                                       TGGTGGTGGTGTTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTC
  5   1   3        nb Egg                            TEgg004i02.p1kSP6                                                          TGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAG
  5   1   3        nb Egg       in                   TEgg010f16.p1kSP6                                                            CCGGGGCCCGGGGTAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATTTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCA
  5   1   3        nb Egg                            TEgg033i20.p1kSP6                                                             CCGGGGTAGAAATATAGGAACTCTGTGCTGCAGCAATATCGCATTACAGGGTCATTTAGCACACTACGAAAGGCAAAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCA
  5   1   3        nb Egg                            TEgg073b14.p1kSP6                                                             TGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGG
  5   1   3        nb Egg                            TEgg097p12.p1kSP6                                                             TGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCC
  5   1   3        nb Egg0                                 dad70f10.y1                                                              TGGTGGTAGAAATAGAGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAAGGATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCTGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTTAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATTAGATAAATGGGACAAACCAGCATTTTAAAGAC
  5   1   3        nb Egg                            TEgg059d23.p1kSP6                                                               GTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCT
  5   1   3        nb Egg                            TEgg095b06.p1kSP6                                                                  GTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGAACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGT
  5   1   3        nb Gas                            TGas080n15.p1kSP6                                                                   TAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGT
  5   1   3        nb Gas                            TGas088l05.p1kSP6                                                                   TAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCC
  5   1   3        nb Egg                            TEgg090m08.p1kSP6                                                                      AAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGC
  5   1   3        nb Egg0      in                         dad62h11.y1                                                                               AACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCATCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCA
  5   1   3        nb Ova1      in                        CABE11363.5p                                                                                              CAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAANAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTTGCTTCAGAGTCTGCTACGATCTGTACAGATTTTTTT
  5   1   3        nb Egg                            TEgg129o09.p1kSP6                                                                                                                        CAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGT
  5   1   3        nb Egg                            TEgg129o11.p1kSP6                                                                                                                        CAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAAT
  5   1   0       chi Gas       out                  TGas140h17.p1kSP6                                                                                                                             TACAAAAGGCAAAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAAACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCACTATTCTAGTGTGGATTAATAAGAATTCTATTGTATTATAGTTTGGTCAGTCACCCTAACGCTGAAACATTCTTTAAAAGAGAATGCAAGTCAAAATTTTAAAGCATACTGCTCAATAGTCCTCCTATTGTTTAGTAAAAACAAATATTTACTTGGTCACTTACTTCACATTTTCTAGAACAGGCAGCCATCTCTAAAAGGGGTATTCTCCCTTCCTTTCCCTCCTT
  5   1   3        nb Lun1      in                         CABD4667.5p                                                                                                                               CAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAG
  5   1   2       add Egg                            TEgg087a05.p1kSP6                                                                                                                                          TGCAGAGCCCTTTCTTCGTCGTCTCTACTCCCTTCTGTCTTTTTTTTTTTTTTTTGTTAGTGTTCGGCTTTGAGATGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAAT
  5   1   2       ext Egg       in                   TEgg029k04.p1kSP6                                                                                                                                                                            TCCTGATCCTCTGCAGTCTCATTTATGGAGCATTCTCACTGGGTTTGCTATGGCAGACCACATGATGGCCATGAATCGTATCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGACAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGG
  5   1   3        nb Egg                            TEgg054j17.p1kSP6                                                                                                                                                                                            CAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATG
  5   1   3        nb Egg                            TEgg112k19.p1kSP6                                                                                                                                                                                                             CCGGGGGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTAT
  5   1   3        nb Egg                            TEgg125p20.p1kSP6                                                                                                                                                                                                             CCGGGGGGGGTTTGCAATGGCAGAACACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTT
  5   1   3        nb Egg                            TEgg075c23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                       GAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTT
  5   1   3        nb Gas0                                 dad32g01.y1                                                                                                                                                                                                                                                                                                                                                                                                         CCCCGGGGGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCT
  5   1   2       ext TpA                            TTpA019d02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                              AACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAATCCA
  5   1   3        nb Egg                            TEgg093n02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGT
  5   1   2       add Egg       in                   TEgg032a22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATCCCCGGGGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGG
  5   1   3        nb Egg       out                  TEgg029k07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATG
  5   1   2       add Egg       in                   TEgg031j22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGC
  5   1   3        nb Egg                            TEgg129a22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGGAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGGGGAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGGAAACAACAGCCTAACAGAGTAAGCTGGTAGGGGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTA
  5   1   3        nb Egg                            TEgg120m03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAGTTGCACCCTGCGAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTG
  5  -1   2       add Egg       out                  TEgg066c04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCATTTTAGAGATTGTAATGCAAAGCACAGCTCTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCTTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGATTACAGTTTTTAAAATGTGGTTTGTCC
  5   1   3        nb Egg                            TEgg093a20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAG
  5   1   3        nb Gas                            TGas135f15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACGTCCCTGCAGCTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTG
  5   1   3        nb Egg  FLx                       TEgg144j19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTATGCTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATCCCTTTATGGGCCAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTT
  3   1   3        nb Neu  FL   in                    TNeu124g09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGCCTCCTAGTGTAATAGACACTGACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTTTGCTACGATCTGTACAGATTTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTAACAGTATCAATAAAGAGCTTCAAAGTGCAAACAAATAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas  5g3  in                    TGas055g17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTTTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAATTTCCCCCCCCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCAGGATGCTTCATTTAATCTATCATATTCTAAAGGGGCGGTTTCACAAATGTGAGCTAACCCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTTTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCCCCCAATTTTTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAA
  3   1   3        nb Lun1      in                         CABD4667.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGC
  3   1   3        nb Ova1      in                        CABE11363.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGC
  3   1   2       add Egg  5g3  in                    TEgg071g05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATGGGTTTGGATCGTATAAAAGAACTCCCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACACCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTTTGTTACGATCTGTACAGATTTTTTTTTCACGTTTTTTTTGTCCCCAATACCACAATTTCCATAATTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACACCCATGTTAAAATTTCCCCACCCCCCATGCACATCATTGTAACAACTTGATTTAATCCAGTTGTTGATTGCAGGGCCCTTTAAAGGCAGACTTGCTGCACTAATACTCCCAGGAGGCTTCATTTAATTTTTCATATTCTAAAGGGGGGGTTTCCCAAATGGGAGTTAACCCTTGCGGGAAAAGTCCTTCTGTTTGTTTAGTTTCCCAAAATTCCCCCCCCTTCCCTTTTTTAGTATAAATCCCTGAGAGGGGTAAGATGGTTTTTGGAACATTTCCCCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTTTTTAAACTTTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCAGGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGCCAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTGGCCAATATCAATAAAGAGGCTTAAAGGTCGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg  5g3  in                    TEgg071h06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTTTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTTTTGTCCCCAATACCCCAATTTCCATAAATGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTTCCCCACCCCCCATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATTTATCATATTTTAAAGGGGGGGTTTCCCAAATGTGAGCTAAACCCTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCCCCTTCCCTTTTTTAGTATAAATCCCTGAGATGGGTAAGATGGTTTTTGGAACATTTCCCCCAATTTTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAAGAAAGAGCTTCCAGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       add Egg       in                    TEgg031j22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTTTAACAGGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCNAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAAACCATGTTTAAAACTTCCCCCCACCCCCCATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTAACTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas                            TGas018p21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTA
  3   1   0       chi Egg                             TEgg020c24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTTTGATTTTATGACAGACTTTGTTTGTAACCAACAGCCTACCAGAGTAAGTTGTTAGGTGTGTATTAGGAGTATACAAAGGCTTGGAACATTCCTTTATGGGCACAAACCCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAACCAACCATGTTAAAATTTCCCCACCCACATGCACATCATGGTAACAACTTGATATAATACAGTTGTTGATTGCATGGCCCTTTAAAGGCAGACTTGCTGCATTAATACTGCCAGGATGCTTCATTTAATCTATCATATTCTAAAGCGGCGGCTTCACAAATGTGGGAAAACCCTCGGAGGAAAGGTCCTTCCTTTTTCAAAGTTCGCCAAAACCGCCCCTCCTTCCCTTTTGTAGTAAAAATCCACGCGACGGGTATGCTGGTTTCTGGAACATTTCACCCAACTGAACCCGCGTTTAAATGATCAAACTGTGTAACTTTTCGGCGCAGTGTTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTGGCCAGTATTTTTGTCCAAAACATTTTGAGAAAGCTGGATAATTAATTCTATAGAAATTTGCCCATGTCAATAAAGAGCTTCCAAGTGCTAATTTAAAAAAAAAAAAAAAAA
  3   1   2       add Egg       in                    TEgg032a22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCCCCAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCCATTTTAAAAATTTCCCCCCCCCCCCCCCATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCAGGATGCTTCATTTAATCTATCATATTCTAAAGGGGCGGTTTCACAAATGTGAGCTAACCCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCCCCCAATTTTTTTTAAAATTTTTTTTTTTTTTTTTTTTAAACTCTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGAACCAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       add Egg  5g3  in                    TEgg037k14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTTTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTAACTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGGAAAAAAAAAAAAAAAAAAAAAA
  5  -1   2       ext Egg       in                   TEgg064o11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATATTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAAT
  5  -1   2       ext Egg       in                   TEgg065g08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATATTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAAT
  3   1   2       ext Egg  5g3  in                    TEgg017n20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGGTTCCAGAGTTTGGTACGATTTGTACAGATTTTTTTTTCACGTTTTTTTTGTCCCCAATACCCCAATTTCCATAACTGAGCCTTTTCTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAAATTCCCCCCCCCCCCATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGGTGCCCTAATACTGCCAAGAAGGTTCATTTAATTTATCATATTTTAAAGGGGCGGTTTCCCAAATGTGAGGTAAACCTTGCTGGAAAAGTCCTTTTGTTTGTTTAGTTTGCCAAAATTGCCCCCCCTTCCCTTTTTTAGTATAAATCCCTGAGATGGGTAAGATGGTTTTTGGAACATTTCCCCCAATTTTTTTTTTTTTTTTTTTTTTTAACTCTCTCAAAGTTTGACCCTGGGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTTTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg  5g3  in                    TEgg033a02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TACGATCTGTACAGATTTTTTTTTCACGTTTTTTTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAATTTCCCCCACCCCCCATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCAGGAGGCTTCATTTAATCTATCATATTCTAAAGGGGGGGTTTCCCAAATGTGAGCTAACCCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCAAAATTGCCCCCCCTTCCCTTTTTTAGTAATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCCCCCAATTTTTTTTTTTTTTTTTTTTTTTAACTCTCCCAATGTTTGCCACTGTGCTTAATAGTTAATTTAGTTCAGGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGCCAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   4      seed Egg  5g3  in                    TEgg015j17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGATTTTTTTTTCACGTTTTTCTTGTCCCCAATCCCACAATTTCCATAACTGACCCTTTACTTTTTATTTAGAGTTTTGTTAACCACCCATGTTAAAACTTCCCCACCCCCCATGCACATCATTGTAACAACTTGATATAATCCAGTTGTTGATTGCATGGCCCTTTAAAGGCAGACTTGCTGCACTAATACTCCCAGGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCCCAAATGTGAGCTAACCCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTCCCATAATTCCCCCCCCTTCCCTTTTTTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGACCATTTCCCCCAATTTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGCCCCTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGCCAGTATTTTTGTCCAAACCATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg       in                    TEgg029k04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTCCCATAATTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACACACCATGTTAAAATTTCCCCCAACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCAGGAGGCTTCATTTAATCTATCATATTCTAAAGGGGGGGTTTCCCAAATGTGAGCTAACCCTTGCTGGAAAAGCCCTTCTGTTTGTTTAGTTTCCCATAATTGCCCCCCCTTCCCTTTTTTGGTATAAATCCAGGAGAGGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTTTTTTTTTTTTTTTAACTCTCCCAATGTTGGCCACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg       in                    TEgg010f16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTTTTTTTCACGTTTTTTTTGTCCCCAATACCCCAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCCCCATGCACATCATTGTAACAACTTGATATGATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCCCTAATACTGCCAAGAGGCTTCATTTAATCTATCATATTTTAAAGGGGCGGTTTCCCAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTTTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCCCCCAAATTTTTTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACCCTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg  5g3  in                    TEgg037g15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCCCCAATACCACAATTTCTATAACTGAGCCTTCACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACCTGATATAATACAGTTGTTGATCGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCAGGAAGGTTCATTTAATCTATCATATTATAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCGGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTTTCGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGACCATTTCACCCAATCTCTTTTTTTTTTTTTTTTTTGAACTCTCCCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTCCTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTCATTCTATTTTAATTAGCCGAATATCAATAAAGAGCTTCAAAGTCAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Tad5      out                        XZT59050.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCACTATTCTAGTGTGGATTAATAAGAATTCTATTGTATTATAGTTTGGTCAGTCACCCTAACGCTGAAACATTCtttaaaagagaatgcaagtcaaaattttaaagcatactgctcaatagtcctcctattgtttagtaaaaacaaatatttacttggtcacttacttcacattttctagaacaggcagccatctctaaaaggggtattctcccttcctttccctccttgcttcatactgcacatgtttcattcattccctctgccagatccgcttctgattgtctggtgggcatgtgtagctctgaacaggagacaggatcaagttacacacatgct
  5   1   3        nb Egg                            TEgg062j07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGGAAAGGCAGACTTGCTGCACTACTACTGCCCTGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCAGAAATGTGAGGTAAACCTTGCTGGAAAATCCTTCTGCTTGTTTAGTTTGCAATAATTGCCCCTCCTTCGGTTTTCTAGTATAAATCAATG
  3   1   3        nb Egg                             TEgg022l10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTTTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTTTTTTTTTTTTTTAACTCTCTCAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAA
  3   1   3        nb Egg0      in                         dad62h11.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGATTTTTGTACAAAACTTTTTGAGAATACTTGTTATGGTATTCTATTTTAATTT
  5   1   2       ext Egg       in                   TEgg078p05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGCTGGAAGGCTTTTTAGGAAATTTTGACAGTATTTTGTGTACAAGACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGC
  3   1   2       ext Egg       in                    TEgg078p05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGCCAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAGGAGCTTCAAGGTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2                                         Xt7.1-TEgg104j17.5                                                   TGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCCCCACCCCAGAACATCTAACTGCAATTACCCCAACACACACTCGAGAGCACACCCTTATAACCCTCCACCTCATCCCTATCATTCCACTAATAATAAAACCAGAACTAATCTGAGGCCTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTAACTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCACTATTCTAGTGTGGATTAATAAGAATTCTATTGTATTATAGTTTGGTCAGTCACCCTAACGCTGAAACATTCTTTAAAAGAGAATGCAAGTCAAAATTTTAAAGCATACTGCTCAATAGTCCTCCTATTGTTTAGTAAAAACAAATATTTACTTGGTCACTTACTTCACATTTTCTAGAACAGGCAGCCATCTCTAAAAGGGGTATTCTCCCTTCCTTTCCCTCCTTGCTTCATACTGCACATGTTTCATTCATTCCCTCTGCCAGATCCGCTTCTGATTGTCTGGTGGGCATGTGTAGCTCTGAACAGGAGACAGGATCAAGTTACACACATGCTCAGAATAGGAAGGCTGCCGCTGGCAGCCTACAGGAAGGGAAGAGACATTTCAGTGATGTCACTGGAGTCTTTACACTGCTGTAGGCTGCCAGCATCATATCTCAGAAGCAAGCAGGGATCTGGGAATTTAGATATGCAGTAAGTACTTAAAAAGAATGCCTTTAGACTTACTTTTAATTTATATTAACCTTTCATTGTCCTTTAAGTGAACTTGTTAGTTGTACCTGTATTAT
                                                  Xt7.1-CHK-1008276792                                                         GTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCCCCACCCCAGAACATCTAACTGCAATTACCCCAACACACACTCGAGAGCACACCCTTATAACCCTCCACCTCATCCCTATCATTCCACTAATAATAAAACCAGAACTAATCTGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTAACTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCACTATTCTAGTGTGGATTAATAAGAATTCTATTGTATTATAGTTTGGTCAGTCACCCTAACGCTGAAACATTCTTTAAAAGAGAATGCAAGTCAAAATTTTAAAGCATACTGCTCAATAGTCCTCCTATTGTTTAGTAAAAACAAATATTTACTTGGTCACTTACTTCACATTTTCTAGAACAGGCAGCCATCTCTAAAAGGGGTATTCTCCCTTCCTTTCCCTCCTTGCTTCATACTGCACATGTTTCATTCATTCCCTCTGCCAGATCCGCTTCTGATTGTCTGGTGGGCATGTGTAGCTCTGAACAGGAGACAGGATCAAGTTACACACATGCTCAGAATAGGAAGGCTGCCGCTGGCAGCCTACAGGAAGGGAAGAGACATTTCAGTGATGTCACTGGAGTCTTTACACTGCTGTAGGCTGCCAGCATCATATCTCAGAAGCAAGCAGGGATCTGGGAATTTAGATATGCAGTAAGTACTTAAAAAGAATGCCTTTAGACTTACTTTTAATTTATATTAACCTTTCATTGTCCTTTAAGTGAACTTGTTAGTTGTACCTG
  5   1   2       ext Egg  5g                        TEgg104h18.p1kSP6                                                   TGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCCCCaccccagaacatctaactgcaattaccccaacacacactcgagagcacacccttataaccctccacctcatccctatcattccactaataataaaaccagaactaatctgaggCCTATT
  5   1   3        nb Egg  5g                        TEgg104j17.p1kSP6                                                   TGATGTGTGGTGGTGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCCCCaccccagaacatctaactgcaattaccccaacacacactcgagagcacacccttataaccctccacctcatccctatcattccactaataataaaaccagaactaatctgaggCCTATT
  5   1   4      seed TpA       in                   TTpA020k15.p1kSP6                                                           CCCGGGGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTNCAGATGGAAACTATGGTCTTCAT
  3   1   4      seed TpA       in                    TTpA020k15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTAACTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCACTATTCTAGTGTGGATTAATAAGAATTCTATTGTATTATAGTTTGGTCAGTCACCCTAACGCTGAAACATTCTTTAAAAGAGAATGCAAGTCAAAATTTTAAAGCATACTGCTCAATAGTCCTCCTATTGTTTAGTAAAAACAAATATTTACTTGGTCACTTACTTCACATTTTCTAGAACAGGCAGCCATCTCTAAAAGGGGTATTCTCCCTTCCTTTCCCTCCTTGCTTCATACTGCACATGTTTCATTCATTccctctgccagatccgcttctgattgtctggtgggcatgtgtagctctgaacaggagacaggatcaagttacacacatgctcagaataggaaggctgccgctggcagcctacaggaagggaagagacatttcagtgatgtcactggagtctttacactgctgtaggctgccagcatcatatctcagaagcaagcagggatctgggaatttagatatgcagtaagtacttaaaaagaatgcctttagacttacttttaatttatattaacctttcattgtcctttaaGTGAACTTGTTAGTTGTACCTGTATTATGAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TEgg075b06.5                                                      GTGGTGGTGGTGTTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCA------------------------------------------------TAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTTAACTCTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008276788                                                            GTGGTGTTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACG------------------------------------ACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGxxCxGxAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTTAACTCTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   4      seed Egg  5g3  in                   TEgg059p09.p1kSP6                                                      GTGGTGGTGGTGTTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCACG
  5   1   3        nb Egg  5g3  in                   TEgg075b06.p1kSP6                                                      GTGGTGGTGGTGTTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCACAGCACTGGCATGCCTCCCTCAGTCAGCCAC
  5   1   3        nb Egg  5g3  in                   TEgg010l04.p1kSP6                                                            CCGGGGGTAGAAATAGAGGAACTCTGTGCTGCAGCAATATCGTATTACAGGGTCATTTAGCAGACTACAAAAGGCAGAGTTGCTCTTCTCTCCTACATGTTGGGATCTGGCTCCTGATCCTCTGCAGTCAGCATTTTTGGAGCATTCTCAAGGGGTTTGCAATGGCAGACCACATGATGGCCATGAATCATAGCCGGTTTCAAGATGGAACTAATGGTCTTCATCACCCAGCTCATCGAATGGGGATGGGTCAATTTTCCAATCATCATCATCACCCGCAGCAACACACCTTTAACAGCCTAATGGGAGAACACATGCACTATGGACCAGGGAACATAAACGCTAACAATAGCATCAGACATGCCATTGTCACTGGGAATGTAAATGGTGGACATCCAAATGGCAGCATGGCACCAGCATCTAGATTTAACTCGCCATTTATGGGACCTGTCCCAAATCAAGGGGCTCAACTGACTGCTAGCATGCAGTTACAGAAGCTGAACAACCAATATTTTACTCACCACCCCTACCCACACAACCACTATATCCCGGAATTGCACCCTGCAAATCAGATAAATGGGACAAACCAGCATTTTAGAGACTGTAATCCAAAGCATAGCACTGGCATGCCTC
  3   1   4      seed Egg  5g3  in                    TEgg059p09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTTTATAGATGAGGAAGTCCTAATGTCCTTGGTGATAGAAATGGGTTTGGATCGTATAAAAGAACTACCTGAGCTTTGGCTTGGACAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTTTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCCACCCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTTTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTTAACTCTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCAAAAAAAAATAAAAAAATAAAAAAAAAAAAAAAAAA
  5   1   3        nb Egg                            TEgg092o16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGGGAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTTAACTCTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACT
  5   1   3        nb Egg                            TEgg092o18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGGGAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTTAACTCTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTG
  3   1   3        nb Egg  5g3  in                    TEgg075b06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAACGAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCNCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTTAACTCTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCAAAAAAAAATAAAAAAATAAAAAAAAGAAAAAAAAA
  5   1   3        nb Egg       in                   TEgg021k06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGTTTGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTAAGAGTTCTTTTTTTTTTTTTTTTTTTAAAACTCTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTG
  3   1   3        nb Egg       in                    TEgg021k06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGATTTTATGACAGACTTTGTTTGTAAACAACAGCCTAACAGAGTAAGCTGTTAGGGGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTTTGGTACGATTTGTACAGATTTTTTTTTCACGTTTTTTTTGTCCCCAATACCCCAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCCTGTTAAAAATTCCCCACCCCCCATGCCCATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGGTGCCCTAATACTGCCCAGAAGGTTCATTTAATTTATCATATTTTAAAGGGGGGGTTTCCCAAATGTGAGGTAAACCTTGCTGGAAAAGTCCTTTTGTTTGTTTAGTTTGCCATAAATGCCCCCCCTTCCCTTTTTTAGTATAAATCCCTGAGAGGGGTAAGAAGGTTTTTGGAACATTTCCCCCAAATTTTTTTTAAAATTTTTTTTTGGTTTTTTTTTTTTTAACTCTCTCTTAAAGTTTGCCCCTGCGCTTAATAGTTAATTTAGTTCAGGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTGGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAG
  3   1   3        nb Egg  5g3  in                    TEgg010l04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAGTAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTAACTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCAAAAAAAAAAAAAAAAAA
  5   1   2       ext Egg       in                  TEgg057k03.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAGCTGTTAGGTGTGTATTAAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTAACTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGC
  5   1   3        nb Egg                            TEgg094d12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGAGTATACAAAGACTTTGAACATTCCTTTATGGGCACAAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTTAACTCTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTT
  5   1   3        nb Egg                            TEgg066b15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACCTTGCTTCCAGAGTCTGCTACGATCTGTACAGATTTTTTTTTCACGTTTTTCTTGTCCCCAATACCACAATTTCCATAACTGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACAACCATGTTAAAACTTCCCCACCCACATGCACATCATTGTAACAACTTGATATAATACAGTTGTTGATTGCATGGGCCTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTTTAACTCTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTG
  3   1   2       ext Egg       in                    TEgg057k03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTTTTTTCAGGTTTTTTTTGTCCCCAATACCCCAATTTCCAAAAGGGAGCCTTTACTTTTTATTTAGAGTTTTGTTAAACACCCATGTTAAAATTTCCCCCACCCCACATGCACATCATTGTAAAAACTTGATATAAAACAGTTGTTGATTGCAGGGGCCTTTAAAGGCAGACTTGTTGCATTAAAACTCCCAGGAGGCTTCATTTAATTTTTCATATTTTAAAGGGGGGGTTTCACAAATGGGAGTTAACCCTTGCGGGAAAAGCCCTTCTGTTTGTTTAGTTTCCCAAAATTGCCCCCCCTCCCCTTTTTTGGTAAAAACCCATGAGAGGGGTAAGAGGGTTTTTGGAACATTTCCCCCAATTTTTTTTTAAATTTTTTTTTTTTTTTTTTAAACTCTCTAAATGTTTGCCACTGGGCTTAAAAGTTAATTTAGTTCAGGGAAATATTACTGCGTGGAGGGCTTTTTAGGAAATTTTGCCAGTATTTTTGTACAAAACATTTTTGAGAAAACTTGTTAATTTATTTTATTTTAATTTCCCAATACCAATAAAGAGCTTCAAAGGGCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   3        nb Egg       in                   TEgg062n07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGGGTTTAAAGGCAGACTTGCTGCACTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTTAACTCTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGC
  3   1   3        nb Egg       in                    TEgg062n07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTAAAGGCAGACTTGCTGCACTAATACTGCCAGGAGGCTTCATTTAATTTATCATATTTTAAAGGGGGGGTTTCACAAATGTGAGCTAACCCTTGCGGGAAAAGCCCTTCTGTTTGTTTAGTTTGCCAAAATTGCCCCCCCTTCCCTTTTTTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCCCCCAATTTTTTTTTATATTTTTTTTTTTTTTTTTTTTTAACTCTCTCTTAATGTTTGCCACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGCCAGTATTTTTGTCCAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAGGTGCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   3        nb Egg0      in                         dad67d09.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGAATTCCCCGGGCTAATACTGCCATGATGCTTCATTTAATCTATCATATTCTAAAGTGGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTTAGATTTTTTTTTTTTTTTTTTTTAACTCTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAATTTATTCTATTTTAATTTGCCAATATCAATAAAGAGCTTCAAAGTGCAAAAAAA
  5   1   3        nb Egg0      in                         dad67d09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCGGTTTCACAAATGTGAGCTAAACCTTGCTGGAAAAGTCCTTCTGTTTGTTTAGTTTGCCATAATTGCCCCTCCTTCCCTTTTCTAGTATAAATCCATGAGATGGGTAAGATGGTTTTTGGAACATTTCACCCAATTTTTTTTGATATTTTTTTTTTTTTTTTTTTTAACTCTCTCTTAATGTTTGACACTGTGCTTAATAGTTAATTTAGTTCATGGAAATACTACTGCGTTGAAGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATACTTGTTAA
  3   1   3        nb Egg       out                   TEgg049j11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAAAGCCCTTTCGTTGGTTGGGTTTGCCATAATCGCCCCCCTTTCCCTTTTTTAGTATAAACCCAAGAGAGGGGTAAGCCGTTTTTTGGAACCCTTCACCCAATTTTTTTTTATAGTGTTTTTTTTTCTTTTTTTTAAACTCTCTCTTAATGTTGGGCACTGGGCTAAATAGCAAATTTAGTTCAGGGAAATACTAGTGCGTTGAGGGCTTTTTAGGAAATTTTGACAGTATTTTTGTACAAAACATTTTTGAGAATGCTGGTTAATTTATTCCATTTTAATTTGCCAACATCAAGAAAGAGCTTCGAGGGCAAAAAAAACCCCCAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)