Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 355.0    0Xt7.1-CABK7113.3.5                        745 PI      74          7      781                MGC89184 protein [Xenopus tropicalis]
     2 806.0    0Xt7.1-CABK3439.3.5                        568 PI      84          7      780                Hypothetical LOC496920 [Xenopus tropicalis]
     3 720.0    0Xt7.1-CABG9955.3                          335 PI      82          7      780                Hypothetical LOC496920 [Xenopus tropicalis]
     4 720.0    0Xt7.1-CBTA4812.5                          240 PI      82          7      780                Hypothetical LOC496920 [Xenopus tropicalis]
     51575.0    0Xt7.1-CABK1302.3                           51 PI      94          6     1006                Hypothetical LOC496633 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 90%

 1012071487 Xt7.1-CAAP1601.3 - 88 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAP1601.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTCCACATGGCTTATTACCTTTATAAAAAAAACAATCAGCAATAAAATTTGAACACGTTAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008223605                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTCCACATGGCTTATTACCTTTATAAAAAAAACAATCAGCAATAAAATTTGAACACGTTAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             16    17    19    20    21    24    25    27    28    29    32    33    34    34    34    34    34    34    34    34    35    35    35    35    36    36    36    36    36    36    38    38    39    40    39    40    44    45    44    45    45    47    51    51    53    53    60    61    57    67    68    68    71    71    78    78    79    79    80    80    81    81    81    81    82    82    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    84    83    84    84    84    84    84    85    86    82    84    80    82    78    81    77    78    77    78    73    74    70    71    67    68    66    67    66    66    66    66    66    66    66    66    64    66    63    65    61    63    60    63    59    62    57    59    55    58    54    54    54    54    54    54    52    54    53    53    50    53    42    45    12    18    12    12    12    12    12    12     6     8     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T------G
                                               BLH ATG      31     425                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      31      99                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      31      54                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI      -7      52                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      31       3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Br ---- 1e-030     AAQ96651.1 elastase I [Branchiostoma belcheri tsingtaunese] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Ci ---- 6e-032     CAD24308.1 putative coagulation serine protease [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bb ---- 5e-037     BAC75888.1 mannose-binding lectin associated serine protease-1 [Branchiostoma belcheri] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 6e-037     NP_501379.1 serine protease 22D (4I977) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dm ==== 6e-037     NP_611066.1 CG8299-PA [Drosophila melanogaster] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 2e-042     XP_001201324.1 PREDICTED: similar to LOC561562 protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Gg ==== 7e-069     XP_001231334.1 PREDICTED: similar to trypsinogen [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 2e-070     NP_002760.1 protease, serine, 1 preproprotein; cationic trypsinogen; trypsinogen A;trypsinogen 1; trypsin 1; trypsin I [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 9e-072     NP_075822.3 trypsinogen 7 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Dr ==== 2e-080     XP_696150.1 PREDICTED: similar to Anionic trypsin II precursor (Pretrypsinogen II) [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 8e-128     AAH72978.1 MGC82534 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === ?? ==== 8e-128     NP_001085585.1 MGC82534 protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Xt ==== 2e-151     AAH87830.1 Hypothetical LOC496697 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAP1601.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------TGA---------------------ATG------------------TAATGA------------------------------------------------------------------ATG------------------TAA---------------------------------TGA---------------------------ATG---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   1           Abd0 FL                     IMAGE:7017747.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAAAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTCCACATGGCTTATTACCTTTATAAAAAAAACAATCAGCAATAAAATTTGAACATGTTAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAGG
  5   1   2   10  bld Panc 5g3  in                         CBTA6431.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGGTGGGCAGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCC
  5   1   2       bld Te5       in                        CAAO12138.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGATCGCTCCAGAAGATCTAGGTCGCCATGAAGGCATCACAAGTTATTGCAGTGTCCCTGCTATTGCTGCTACTGAGCGCAGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCCACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTAT
  5   1   2   10  bld Panc 5g3  in                        CBTA3909.fwd ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTCAGTCCAGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAA
  5   1   2       bld Abd0 5g3  in                     IMAGE:6998877.b                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATTCCAGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGGATGGNGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTATTATCTACGCTGGGTGCAA
  5   1   2   10  bld Panc 5g3  in                        CBTA5163.fwd ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGTCCAGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAG
  5   1   2   10  bld Panc 5g3  in                        CBTA2346.fwd ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCCAGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATA
  5   1   2   10  bld Panc 5g3  in                        CBTA3982.fwd ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCCAGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCC
  5   1   2   10  bld Panc 5g3  in                         CBTA6238.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCCAGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTANAGTCTGTAATTATCTAC
  5   1   2   10  bld Panc 5g3  in                        CBTA1461.fwd ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCAGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAANAG
  5   1   2   10  bld Spl2 5g3  in                        CBSS3354.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCAGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCAT
  5   1   2   10  bld Panc 5g3  in                        CBTA4464.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGT
  5   1   2   10  bld Panc 5g3  in                         CBTA472.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCAGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCTCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTG
  5   1   2   10  bld Panc 5g3  in                         CBTA521.fwd .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCAGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGA
  5   1   2   10  bld Panc 5g3  in                         CBTA6473.b1 .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCA
  5   1   2   10  bld Panc 5g3  in                        CBTA2522.fwd ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAAC
  5   1   2   10  bld Spl2 5g3  in                        CBSS4955.fwd .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGNGGATGGGGCTGTGCCCAACGCAATGCTCCCAGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTG
  5   1   2   10  bld Panc 5g3  in                        CBTA3914.fwd .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGA
  5   1   2   10  bld Panc 5g3  in                        CBTA4092.fwd .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTACAGACTGACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAATGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATT
  5   1   2   10  bld Panc 5g3  in                        CBTA4170.fwd ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGG
  5   1   2       bld Sto1                                CABG10598.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAAACACTAANAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTNGTAATGAATTACATTTCC
  5   1   2       bld Abd0 FL                            IMAGE:7017747                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCATAGAAAACTCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGGATGGGGCTGTGCNCAACGCAATGCTCCAGGAGTGTACC
  5   1   2       bld Sto1      in                         CABG8954.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAATTCGGCACGAGGGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAANAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTNGTAATGAATTACAG
  5   1   2   20  bld Panc 5g   out                       CBTA2489.fwd ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACTCACCATGCATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGA
  5   1   2   10  bld Panc 5g3  in                         CBTA6232.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCGCACCATGATGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCA
  5   1   2   10  bld Spl1 5g3  in                         CABK3929.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCGATTCGTGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTT
  5   1   2       bld Spl1      in                         CABK4882.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATCGATTCGCTGGATCTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAANAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCCTTTGCTGTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCCATATATACTGTA
  5   1   2       bld Sto1      in                         CABG3772.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCCTCTCTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAANAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCAATTATATCATATATTCTGCAGTTTTCATATTATACTGTATATGCAACA
  5   1   2       bld Int1      in                        CAAP13734.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTCTCTGGATACTACTGTTCCTGGCAGTTGCAGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCCGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGNAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCATTAAATC
  5   1   2       bld Sto1      in                         CABG9292.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGGATACTACTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAAATCCCTGCCAATTATATCATATATTCTGCAG
  5   1   2       bld Int1      in                         CAAP1601.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAANAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAG
  3  -1   2       bld Spl1      in                         CABK8109.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGTTCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAANAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAAATACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGC
  5   1   2       bld Sto1      in                        CABG11708.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAAAACATTATAGAGAACAACTAANAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTA
  5   1   2       bld Spl1      in                         CABK2832.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCTGGCAGTTGCTGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAANAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTAT
  3  -1   2       bld Int1      in                        CAAP11070.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGCTGCTGCTCCTCTGGATGATGATAAGATTGTTGGGGGATACGAGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAAACACTCCTTTTGCTGTA
  5   1   2       bld Sto1      in                         CABG5453.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTGCACCCCTCACTCCCAGCCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAAAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCCAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGT
  5   1   2       bld Sto1      in                         CABG3811.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCTGGCAAGTTTATTTCACACAGAATAGCCAAGTCTTTTGCGGCGGATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAAAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGGTCTATGTGAATAAAAGTCACAACCATGAATAAAACAACCGAAAGCAT
  3   1   2       bld Int1      in                        CAAP13734.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACNCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCCGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACGCCCCCGCCCTATAGTG
  3   1   2       bld Sto1      in                        CABG11708.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACTTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAAAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTAAATGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCAAAAAAAAA
  3   1   2      seed Int1      in                         CAAP1601.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCCTAGTCACACCAAGGTGGATTATTTCTGCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCAAA
  3   1   2       bld Abd0 5g3  in                       IMAGE:6998877                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACANCAAGTGGGATATTTCTGCTGCTCATGCTACCCGGCCANCCCAAGACCNTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAACAAC
  3   1   2       bld Spl1      in                         CABK2832.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCTGCTGCTCATTGCTACCGGCCACCCAAGACTTGGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTCCACATGGCTTATTACCTTTATAAAAAAAACAATCAGCAATAAAATTTGAACACGTC
  5  -1   2       bld Spl1      in                         CABK8109.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCAAAG
  3   1   2       bld Sto1      in                         CABG3772.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTCATTGCTACCGGCCACNCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATC
  3   1   2       bld Sto1      in                         CABG9292.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATC
  3   1   2       bld Sto1      in                         CABG5453.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCATTGCTACCGGCCACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAAAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATC
  3   1   2       bld Panc 5g3  in                         CBTA521.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCCAAGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCACC
  3   1   2       bld Spl1 5g3  in                         CABK3929.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGACCTTGGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTCCACATGGCTTATTACCTTTATAAAAAAAACAATCAGCAATAAAATTTGAACACGTTAAAAAAC
  3   1   2       bld Panc 5g3  in                        CBTA1461.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTTGCTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTC
  5   1   2       bld Sto1      in                        CABG12553.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCACCTTGGAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTTTGTAATTATCTACGCTGGGTGCAAAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTCCACATGGCTTATTACCTTTATAAAAAAAACAATCAGCAATAAAATTTGAACATGTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl1      in                         CABK5001.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCAAAAAAAAAA
  5   1   2       bld Spl1      in                         CABK5001.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCACCTTGGAGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCAAAAAAAAAA
  3   1   2       bld Panc 5g3  in                        CBTA2346.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGACCATGATCTTACAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTC
  3   1   2       bld Panc 5g3  in                        CBTA2522.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGACCATGATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATC
  3   1   2       bld Sto1      in                         CABG9634.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCAAAAA
  5   1   2       bld Sto1      in                         CABG9634.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCTTACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCAAAAA
  3   1   2       bld Sto1      in                         CABG3811.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAAAGGAGGAAGGAACCGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAAAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTCCACATGGCTTATTACCTTTATAAAAAAAACAATCAGCAATAAAATTTGAACATGT
  3   1   2       bld Panc 5g3  in                         CBTA472.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAAAGAAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCTCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATC
  3   1   2       bld Sto1      in                         CABG8954.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Spl1      in                         CABK4882.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAGGAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTCCACATGGCTTATTACCTTTATAAAAAAAACAATCAGCAATAAAATTTGAACACGTC
  3   1   2       bld Te5       in                        CAAO12138.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGGAGGAAGGACNCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGC
  3   1   2       bld Sto1      in                        CABG12553.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGGAGGAAGGAACCGAGCAGCACATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTTTGTAATTATCTACGCTGGGTGCAAAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTCCACATGGCTTATTACCTTTATAAAAAAAACAATCAGCAATAAAATTTGAACATGTC
  3   1   2       bld Sto1      in                         CABG8207.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATC
  5   1   2       bld Sto1      in                         CABG8207.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGAAGGAACTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAANACAACCGAAAGCATCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Panc 5g3  in                         CBTA6238.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGGAAGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCACCAAAAAAAAAAAAAAA
  3   1   2       bld Panc                                CBTA4417.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGAACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTAAAAAAAAAAAAAA
  3   1   2       bld Spl2 5g3  in                        CBSS4955.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGACCGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATC
  3   1   2       bld Panc 5g3  in                        CBTA5163.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGAGCAGCATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATC
  3   1   2       bld Panc 5g3  in                        CBTA4092.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATATCCAAGTGGAGGCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAATGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATC
  3   1   2       bld Panc 5g3  in                        CBTA4170.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAAAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATC
  3   1   2       bld Sto1      in                        CABG11734.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTCCACATGGCTTATTACCTTTATAAAAAAAACAATCAGCAATAAAATTTGAACACGTTAAAAAAC
  5   1   2       bld Sto1      in                        CABG11734.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTCCACATGGCTTATTACCTTTATAAAAAAAACAATCAGCAATAAAATTTGAACACGTTAAAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Panc 5g3  in                        CBTA3909.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGC
  3   1   2       bld Panc 5g3  in                         CBTA6431.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCTATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCAAAAAAAAAAAAAAA
  3   1   2       bld Panc 5g3  in                         CBTA6473.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCAAAAAAAAAAAAAAA
  5  -1   2       bld Int1      in                        CAAP11070.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAAC
  3   1   2       bld Panc 5g3  in                        CBTA3914.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATC
  3   1   2       bld Sto1      in                         CABG6364.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAA
  5   1   2       bld Sto1      in                         CABG6364.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGCACTCCAGCTACAAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAA
  3   1   2       bld Panc 5g3  in                        CBTA4464.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTCCACATGGCTTATTACCTTTATAAAAAAAACAATCAGCAATAAAATTTGAACACGT
  3   1   2       bld Spl2 5g3  in                        CBSS3354.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATGAAGCTTATGACCATGATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCCGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACGCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACATTTCCCAGAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCG
  3   1   2       bld Panc 5g3  in                        CBTA3982.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATATCATGTTGGTTAAACTAGCGAAACCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTCCACATGGCTTATTACCTTTATAAAAAAAACAATCAGCAATAAAATTTGAACACGT
  3   1   2       bld Panc 5g3  in                         CBTA6232.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTGCTCAGTATAATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCAAAAAAAAAAAAAAA
  5   1   2       bld Panc      in                        CBTA2455.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGCTATGGGAATCTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTCTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTACTGAGAATATGTTCTGCGCCGGCTTCTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTCTGGTGGCCCATTGGTTTGTAATGGAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGC
  3   1   2       bld Panc      in                        CBTA2455.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCAGTATGTTCAGCCCATCCCAGTGGCAAGAAGCTGCCCAAGAGAAGGGACTGAGTGCCTTGTGTCTGGTTATGGGAATTTGCGTTCAGATCATATAGGAGAATTCCCTGACAGACTGCAATGTGTGGATGTGCCAGTCCTGTTTGACTCCAGCTGTAAAGCTTCATGTCGCGGACTGTTTATTGAGAATATGTTTTGCGCCGGTTTTTTGGAAGGCGGCAAGGATTCATGTCAGGTTGATTTTGGTGGCCCATTGGTTTGTAATGGAGAACTTTATGGAGTGGTTTCATGGGGATGGGGCTGTGCCCAACGCAATGTTCCAGGAGTGTACGCTAAAGTCTGTAATTATTTACCCTGGGTGCGGAACATTATGGGGAACAATTAAAAGTCTTCGGATTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAATTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTTTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGGGATTTAATATGTCGTTTTATGTGATAAAAGTCCACAACCATGAATAAAACAACGGAAAGCTTC
  5   1   2       bld Panc      in                        CBTA1626.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATC
  3   1   2       bld Panc      in                        CBTA1626.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGAACTCTATGGAGTGGTCTCATGGGGATGGGGCTGTGCCCAACGCAATGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCAGGAATAAAACAACCGAAAGCATC
  3   1   2       bld Sto1      in                         CABG9135.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTCCACATGGCTTATTACCTTTATAAAAAAAACAATCAGCAATAAAATTTGAACACGT
  5   1   2       bld Sto1      in                         CABG9135.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTCCAGGAGTGTACGCTAAAGTCTGTAATTATCTACCCTGGGTGCAGAACATTATAGAGAACAACTAAAAGTCATCCGACTCCTATAACACCTTGAAGTGATTGTATTGCACCCTGTATAACATGCAACAACTCCTTTGCTGTTAATGAATTACAGTTCCCAAAATCCCCTGCCAATTATATCATATATTCTGCAGTTTCCATATTATACTGTATATGCAACAGCCAACAGTGATTTAATATGTCGTTCTATGTGATAAAAGTCCACAACCATGAATAAAACAACCGAAAGCATCATTCCACATGGCTTATTACCTTTATAAAAAAAACAATCAGCAATAAAATTTGAACACGTTAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)