Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas056o13.3                          4 END     2           1       50                PREDICTED: similar to proline-rich glycoprotein (sgp158) [Mus musculus]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 364.0    0Xt7.1-TGas115d22.3.5                      218 PI      74       2740     3590                ibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome) [Xenopus tropicalis]
     3 389.0    0Xt7.1-TGas140l04.3                         87 PI      74       2728     3582                fibroblast growth factor receptor 4 [Xenopus tropicalis]
     4 353.0    0Xt7.1-CAAK2914.3.5                         14 PI      78       3086     3621                Unknown (protein for MGC:80912) [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012071506 Xt7.1-XZT49974.3.5 - 131 ESTs
                                                                       .....-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZT49974.3.5                                                                                                                                                                                                                                                                                                                                                          CCCTCACACACGGGATCTACACTGGGTTGCACCTCTCACACATCCACTTTTGGGAACTTTCCCTACCTATTACCTTATTGTTTGTGGCTGCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGCCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGAATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATACGGTAAAGTTACGCTGCCCGGCAGGAGGGAATCCCACCCCTCGAATGAGGTGGTTAAAGAATGGAAAGGAGTTCAAACAGGAGCATCGGATTGGGGGATACAAGGTCCGTAACCAGCACTGGAGCCTGATCATGGAAAGTGTTGTCCCATCAGACAAGGGCATCTACACGTGTATTGTGGAAAATGAACACGGCTCCATTAACCATACTTACCACTTGGATGTCATTGAACGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGTTGACGGTTCATCCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTTTTGGCGTCGACAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGATCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGGTGGAGCGTGAACCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAACAACACAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCAAATTCTGTTATTTTATATTATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATATAGAAAAGGAACAATTTTTTTTTTTTTTCATGAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTA
                                                  Xt7.1-CHK-1008222579                                                                                                                                                                                                                                                                                                                                                                CACACGGGATCTACACTGGGTTGCACCTCTCACACATCCACTTTTGGGAACTTTCCCTACCTATTACCTTATTGTTTGTGGCTGCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGCCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGAATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATACGGTAAAGTTACGCTGCCCGGCAGGAGGGAATCCCACCCCTCGAATGAGGTGGTTAAAGAATGGAAAGGAGTTCAAACAGGAGCATCGGATTGGGGGATACAAGGTCCGTAACCAGCACTGGAGCCTGATCATGGAAAGTGTTGTCCCATCAGACAAGGGCATCTACACGTGTATTGTGGAAAATGAACACGGCTCCATTAACCATACTTACCACTTGGATGTCATTGAACGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGTTGACGGTTCATCCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAAxxxxxTTTGGCxxxxAxAACATCATTAACTTACTAGGAGCCTGCACGxxxGGAGxxAxxCTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGAxxxTxxGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTxxCxxGGTGGAGxxTxAxCCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAACAACACAAAAAATTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGxxAxxxxxAAxTxxxxTxxTTTxxxxTATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTxxxATATAGAAAAGGAACAATTTTTTTTTTTTTTCAxxAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAAGAAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                               5     6     7     8     7     8     8     9     8     9     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    13    13    14    13    14    13    14    13    14    13    14    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    11    13    11    13    11    13    12    14    12    14    12    14    11    13    11    13    11    13    11    13    11    13    10    12    10    12    10    12    10    12    10    11     9    10    10    11     9    10     9    10     8     9     7     9     8     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     6     6     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     6     6     5     6     6     6     6     6     6     6     6     6     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     6     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     4     3     5     3     5     3     5     3     5     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     5     2     5     2     5     2     5     2     5     2     6     2     6     2     6     2     6     2     6     2     5     3     6     6     7     6     7     6     7     6     7     6     7     6     8     6     8     7     8     7     8     7     8     7     8     7     9     7     9     8    10     9    10     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    13    13    14    13    14    13    15    13    15    12    14    11    13    11    15    11    15    12    16    12    16    12    16    15    19    16    20    16    20    16    22    17    22    17    23    17    23    17    23    19    25    19    25    20    25    21    26    20    26    20    26    22    28    22    28    22    28    22    28    21    28    22    28    22    28    22    28    23    29    21    27    21    27    21    27    22    28    22    28    22    28    22    28    23    30    23    31    23    31    23    31    25    31    24    30    25    32    25    32    25    32    24    30    26    32    27    33    27    34    27    34    28    36    30    39    32    41    32    43    33    45    41    51    43    54    47    56    46    57    45    57    46    54    48    60    53    60    52    60    50    60    51    62    51    61    50    60    50    60    50    59    46    58    48    59    43    57    47    58    47    59    47    60    46    59    46    58    46    58    45    58    46    59    44    59    45    60    45    59    45    59    46    58    46    58    45    58    44    56    41    55    41    55    41    54    41    55    42    55    41    55    38    54    39    53    41    53    39    52    39    53    41    54    41    54    44    57    46    56    47    56    47    57    46    56    45    56    47    56    47    55    43    54    45    52    44    51    43    49    44    49    39    47    37    45    35    43    32    37    32    36    11    12     4    11     6    11     6    11     6    11     5    11     5    12     5    12     7    12     5    12     5    12     5    12     4    12     4    12     4    12     4    12     4    12     4    12     4    12     4    12     4    12     4    12     4    12     4    12     4    12     4    11     3    11     3    11     3    11     3    12     3    12     4    12     8    13     4    13     3    12     3    12     3    12     3    12     3    12
  5   1   2  SIG                                      Xt7.1-XZT49974.3                                                                                                                                                                                                                                                                                                                                              ACTTTCCATTGCCCCTCACACACGGGATCTACACTGGGTTGCACCTCTCACACATCCACTTTTGGGAACTTTCCCTACCTATTACCTTATTGTTTGTGGCTGCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGCCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGAATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATACGGTAAAGTTACGCTGCCCGGCAGGAGGGAATCCCACCCCTCGAATGAGGTGGTTAAAGAATGGAAAGGAGTTCAAACAGGAGCATCGGATTGGGGGATACAAGGTCCGTAACCAGCACTGGAGCCTGATCATGGAAAGTGTTGTCCCATCAGACAAGGGCATCTACACGTGTATTGTGGAAAATGAACACGGCTCCATTAACCATACTTACCACTTGGATGTCATTGAACGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTGAGGCCAACAAGTCTGCCTGGCTCACGGTGGAGCGTGAAAAAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAG------------CGGGATACTTACCACTTGGATGTCATTGACCGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGGTGGAGCGTGAACCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAACAACACAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCAAATTCTGTTATTTTATATTATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATATAGAAAAGGAACAATTTTTTTTTTTTTTCATGAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAATACTAAGAAATGGGAAGCAACGT
  5   1   2  SIG                                      Xt7.1-XZT67690.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGTACAGATTTTTCCATCCTGCTGGATACACACCAGAGAGGCCCAGGAAAGCACCCCACATCCACTGCTCCAGCTTCTTATACCAGGGGTGCCGGCACAGGTTCTTGTAGGACAGAAGCACCCAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATACGGTAAAGTTACGCTGCCCGGCAGGAGGGAATCCCACCCCTCGAATGAGGTGGTTAAAGAATGGAAAGGAGTTCAAACAGGAGCATCGGATTGGGGGATACAAGGTCCGTAACCAGCACTGGAGCCTGATCATGGAAAGTGTTGTCCCATCAGACAAGGGCATCTACACGTGTATTGTGGAAAATGAACACGGCTCCATTAACCATACTTACCACTTGGATGTCATTGAACGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGTTGACGGTTCATCCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGTAAGTGTTTGCTGTTTGGCATTTGGTTGGGCTGGTTATGTTTGGTTCCACCATAATATAGAGTAATGGCAATCAGGTACA------------------------------------------------------------------------------------------------------------------------------------ATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTT
  5   1   2                                         Xt7.1-TNeu074e05.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTCCAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAACAACACAAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCAAATTCTGTTATTTTATATATATATATATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATAGAAAAGGAACAATTTTTTTTTTTTTTCATGAAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAAGAAATGGGAAGCAACGTCTGTAAATAAAACCTTGCTGCTGTGGAATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTATTTCTTATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGGGGGACCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATTGTATAGA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AA----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          T-----------
                                               BLH ATG     558    1222                                                                                                                                                                                                                                                                                                                                                          
                                               BLH MIN     558     293                                                                                                                                                                                                                                                                                                                                                          
                                               BLH OVR     558     266                                                                                                                                                                                                                                                                                                                                                          
                                               EST CLI      -4      13                                                                                                                                                                                                                                                                                                                                                          
                                               ORF LNG     558     122                                                                                                                                                                                                                                                                                                                                                          
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Sc ---- 7e-019     NP_011856.1 Involved in pheromone response and pseudohyphal growth pathways; Ste20p[Saccharomyces cerevisiae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Bf ---- 2e-052     AAX94285.1 neurotrophic tyrosine kinase receptor precursor [Branchiostoma floridae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Br ---- 2e-063     AAB50848.1 insulin-like peptide receptor; ILP-R [Branchiostoma lanceolatum] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 4e-086     NP_001024723.1 EGg Laying defective family member (egl-15) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 2e-103     NP_729956.1 breathless CG32134-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ci ---- 2e-111     BAE06421.1 fibroblast growth factor receptor [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Sp ---- 1e-121     NP_999702.1 fibroblast growth factor receptor [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Bb ---- 1e-155     ABD24302.1 fibroblast growth factor receptor [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dr ---- 0          NP_840088.1 fibroblast growth factor receptor 2 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Hs ==== 0          NP_000132.1 fibroblast growth factor receptor 2 isoform 1 precursor [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Gg ==== 0          NP_990650.1 fibroblast growth factor receptor 2 homolog [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 0          NP_034337.2 fibroblast growth factor receptor 2 isoform IIIc [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 0          AAH73456.1 Fgfr2 protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === ?? ==== 0          NP_001084132.1 fibroblast growth factor receptor-2 [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 0          AAI35727.1 Unknown (protein for MGC:121723) [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZT49974.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------ATG---ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------ATG---ATGATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------ATGATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------TGA------------------------------------------------------------------TGA---ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------TAAATGTAA------------------TAA---------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------ATG------------------------------TAG------TAA---------------------------------------------------------------------------------------------------TAG---------------------------TGA---------------------------TGA------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2  SIG                                      Xt7.1-XZT49974.3                                                                                                                                                                                                                                                                                                                                              ACTTTCCATTGCCCCTCACACACGGGATCTACACTGGGTTGCACCTCTCACACATCCACTTTTGGGAACTTTCCCTACCTATTACCTTATTGTTTGTGGCTGCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGCCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGAATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATACGGTAAAGTTACGCTGCCCGGCAGGAGGGAATCCCACCCCTCGAATGAGGTGGTTAAAGAATGGAAAGGAGTTCAAACAGGAGCATCGGATTGGGGGATACAAGGTCCGTAACCAGCACTGGAGCCTGATCATGGAAAGTGTTGTCCCATCAGACAAGGGCATCTACACGTGTATTGTGGAAAATGAACACGGCTCCATTAACCATACTTACCACTTGGATGTCATTGAACGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTGAGGCCAACAAGTCTGCCTGGCTCACGGTGGAGCGTGAAAAAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAG------------CGGGATACTTACCACTTGGATGTCATTGACCGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGGTGGAGCGTGAACCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAACAACACAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCAAATTCTGTTATTTTATATTATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATATAGAAAAGGAACAATTTTTTTTTTTTTTCATGAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAATACTAAGAAATGGGAAGCAACGT
                                                  Xt7.1-CHK-1008275804                                                                                                                                                                                                                                                                                                                                                    CATTGCCCCTCACACACGGGATCTACACTGGGTTGCACCTCTCACACATCCACTTTTGGGAACTTTCCCTACCTATTACCTTATTGTTTGTGGCTGCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGCCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGAATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATACGGTAAAGTTACGCTGCCCGGCAGGAGGGAATCCCACCCCTCGAATGAGGTGGTTAAAGAATGGAAAGGAGTTCAAACAGGAGCATCGGATTGGGGGATACAAGGTCCGTAACCAGCACTGGAGCCTGATCATGGAAAGTGTTGTCCCATCAGACAAGGGCATCTACACGTGTATTGTGGAAAATGAACACGGCTCCATTAACCATACTTACCACTTGGATGTCATTGAACGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAxxxxxGAGGCCAACAAGTCTGCCTGGCTCACGGTGGAGCGTGAAAAAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTC------------------------ACTTACCACTTGGATGTCATTGACCGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTxxCxxGGTGGAGxxTxAxCCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAACAACACAAAAAATTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGxxAxxxxxAAxTxxxxTxxTTTxxxxTATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTxxxATATAGAAAAGGAACAATTTTTTTTTTTTTTCAxxAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAAxAxxxAGAAATGGGAAGxxxxxxAATAAA
  0   1   1           Tad5 FL                          XZT56324.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGCCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGAATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATACGGTAAAGTTACGCTGCCCGGCAGGAGGGAATCCCACCCCTCGAATGAGGTGGTTAAAGAATGGAAAGGAGTTCAAACAGGAGCATCGGATTGGGGGATACAAGGTCCGTAACCAGCACTGGAGCCTGATCATGGAAAGTGTTGTCCCATCAGACAAGGGCATCTACACGTGTATTGTGGAAAATGAACACGGCTCCATTAACCATACTTACCACTTGGATGTCATTGAACGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGTTGACGGTTCATCCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAA
  5  -1   2       add Tbd0                               IMAGE:6979220 GTGAACTGAAGTGTATGGCACCNTAAGGCAGCTGAGTCCNTTCAGACCAANTTGGCAGCTACTTTGCCCATGTATGGGGACNCCTAACgggcctacctgaccaatatctggcctaaaattgggcagatgtcgactggacagatttgatttTCCCTTCGGATATGGGACCACTTAAACTCATTGATGCAGTCCTATTCTCCTTCCATCGGATTACACCAATATCACCCACTTTAGGTGGGCATATCCATGGACAGGTCATTTGGCGACCTAACCAAACAAATGGCTCTTATAGTGTATGGCCACCTTAATATGGCACATAGGACAACATTGTGTATAACCCACAGACGACAACAGCATTTATTGTTTAACAAGCGGCAGGGCCCCTTCAGCTTCAGCTGCCGTCTAGAACCTGGGCTAAGGTACGAGTCTGAGTCTCATGGTGTTTGGGTGGTGAACTGTGGGCAGCAATTTGTTAAAGGAAAACACCTTTTTGGGGTAAGAGAGCTCCTTGTTGTAGCACCGTGCCTTACCCAGAGCCAGAAGTCTAGTCTGCACCGAATCCTGCGACCCACGGGAGTCATTCACCCTGCAAAGGGGATTCTGTCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACAC
  5   1   2       ext Tad5 5g3  in                         XZT48793.5p                                                                                                                                                                                                                                                                                                          TGAGGAGTGAGGGGGAGGGAGGGAAAAGTCACACAGACTTTCCATTGCCCCTCACACACGGGATCTACACTGGGTTGCACCTCTCACACATCCACTTTTGGGAACTTTCCCTACCTATTACCTTATTGTTTGTGGCTGCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGCCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGGATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCG
  5   1   3        nb Gas8                                  st35e12.5p                                                                                                                                                                                                                                                                                                                              GGAAAAGTCACACAGAACTTTCCATTGCCCCTCACACACGGGATCTACACTGGGTTGCACCTCTCACACATCCACTTTTGGGAACTTTCCCTACCTATTACCTTATTGTTTGTGGCTGCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGCCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGG
  5   1   2       add Tad5 5g3  in                         XZT25107.5p                                                                                                                                                                                                                                                                                                                                          CGGACGCGTGGGTTGCCCCTCACACACGGGATCTACACTGGGTTGCACCTCTCACACATCCACTTTTGGGAACTTTCCCTACCTATTACCTTATTGTTTGTGGCTGCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGCCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGAATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGAC
  5   1   2       ext Panc      in                         CBTA463.fwd                                                                                                                                                                                                                                                                                                                                                      TTGCCCCTCACACACGGGATCTACACTGGGTTGCACCTCTCACACATCCACTTTTGGGAACTTTCCCTACCTATTACCTTATTGTTTGTGGCTGCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGTCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGGATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGG
  5   1   3        nb BrSp 5g3  in                     EC2BBA27DG07.g1                                                                                                                                                                                                                                                                                                                                                        GGGCCTCACACACGGGATCTACACTGGGTTGCACCTCTCACACATCCACTTTTGGGAACTTTCCCTACCTATTACCTTATTGTTTGTGGCTGCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGCCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTTACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGGATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTC
  5   1   2       ext Brn2 5g3  in                        CAAJ23218.5p                                                                                                                                                                                                                                                                                                                                                            CTCACACACGGGATCTACACTGGGTTGCACCTCTCACACATCCACTTTTGGGAACTTTCCCTACCTATTACCTTATTGTTTGTGGCTGCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGCCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGAATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACT
  5   1   3        nb Gas       in                   TGas082l16.p1kSP6                                                                                                                                                                                                                                                                                                                                                             TCACACACGGGATCTACACTGGGTTGCACCTCTCACACATCCACTTTTGGGAACTTTCCCTACCTATTACCTTATTGTTTGTGGCTGCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGCCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTG
  5   1   3        nb Gas8                                  st82c08.5p                                                                                                                                                                                                                                                                                                                                                                                        ACCTCTCACACATCCACTTTTGGGAACTTTCCCTACCTATTACCTTATTGTTTGTGGCTGCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGCCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGAATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGANGATACCACTTCTGAACCCGAAG
  5   1   2       add Int1      in                        CAAP13511.5p                                                                                                                                                                                                                                                                                                                                                                                                               GAACTTTCCCTACCTATTACCTTATTGTTTGTGGCTGCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGCCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGGATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCACACCGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATACGGTAA
  5   1   4      seed Tad5 FL   in                         XZT56324.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGAACCTTGCGGGATTCATCACTGTGGGACTATCAGGGGATTGGTGATTCACTCAGAGAGAAAAGAAATCACAGAGAACTTACTCATTCACCCTGCAAAGGGGATTCTGCCTGTTCCCCTCTTTGGAACCTCACTGGCTTTGGCTGCTGCTGGTTACCGGGCTCTGAGTCGGGATCGGGACTCGCTCACCCTGCGCTCGGAGGGATACGTATTTCTCATTGGCTGAAACGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGAATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGNGCANAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTANGGAGAC
  5   1   2       add Brn2 5x3  out                       CAAJ19166.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCGGGGTGTGTGGTGTGTAAAGAACTTTGGTCGTGTAAACTGACAAAGGGAAAGCGGAGGCACCGGAGGGAGAGACTGCATGGGTACAGCTATGAGACAGCTCTGTGCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGAATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGA
  5   1   2       ext Gas8      out                         st77a24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGGACTTGGGAATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGAATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAG
  5   1   3        nb Gas8                                  st76a24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATCTGTCCCCTGGGACACACGGAGTCTTGCCAGGCACACGCCTGATGCAGGGCTGAGGGGATTTTCTTACACCGCCATCTCTCCAGGTCTCCCGGGCAGGGAGCGGGACCCGCAGTTCCTGGGACCTCCCATTGATACGTGCGGCTCATGCTTGCGCACAGCTGGACAGATGGGGATGTCCTTAGTGTGGCGTTCGGGGAAAGCAGGAGGAGGCGGCCACGCTGACAGAATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAG
  5   1   2       ext Spl1      in                         CABK3001.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGAGGCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATACGGTAAAGTTACGCTGCCCGGCAGGAGGGAATCCCACCCCTCGAATGAGGTGGTTAAAGAATGGAAAGGAGTTCAAACAGGAGCATCGGATTGGGGGATACAAGGTCCGTAACCAGCACTGGAGCCTGATCATGGAAAGTGTTGTCCCATCAGACAAGGGCATCTACACGTGTATTGTGGAAAATGAACACGGCTCCATTAACCATACTTACCACTTGGATGTCATTGAACGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATT
  5   1   2       ext Gas7      in                         XZG52498.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATACGGTAAAGTTACGCTGCCCGGCAGGAGGGAATCCCACCCCTCGAATGAGGTGGTTAAAGAATGGAAAGGAGTTCAAACAGGAGCATCGGATTGGGGGATACAAGGTCCGTAACCAGCACTGGAGCCTGATCATGGAAAGTGTTGTCCCATCAGACAAGGGCATCTACACGTGTATTGTGGAAAATGAACACGGCTCCATTAACCATACTTACCACTTGGATGTCATTGAACGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGTTGACGGTTCATCCAGCTACTGTCAGTCCA
  3   1   1       add Int1      in                        CAAP13511.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGGGATACAAGGTCCGTAACCAGCACTGGAGCCTGATCATGGAAAGTGTTGTCCCATCAGACAAGGGCATCTACACGTGTATTGTGGAAAATGAACACGGCTCCATTAACCATACTTACCACTTGGATGTCATTGAACGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGCGCTCAGGAATTAACAGTTCCAGTGCTGAAGTGCTGAAACTGTACAATGTGACAGAAGAGGACGCAGGGGAATATATATGTGCGGTCTCCAATTATATAGGAGAGGCCAACAAGTCTGCCTGGCTCACGGTGGAGCGTGAAAAAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGT
  5   1   2       add Tad5      in                         XZT47352.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGGATACTTACCACTTGGATGTCATTGACCGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGTTGACGGTTCATCCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTC
  5   1   2       add Gas7      in                         XZG17730.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGTTGACGGTTCATCCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAG
  5   1   2       ext Ski1      in                         CABJ6091.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTAAAGCGCTCAGGAATTAACAGTTCCAGTGCTGAAGTGCTGAAACTGTACAATGTGACAGAAGAGGACGCAGGGGAATATATATGTGCGGTCTCCAATTATATAGGAGAGGCCAACAAGTCTGCCTGGCTCACGGTGGAGCGTGAAAAAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGNGAACCTGCGACAGTACCTC
  5   1   0       chi Gas7      in                         XZG28851.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCCGAGGCCTCTTGGGATTGATAAAGACCGT
  5   1   2       add In62                            IMAGE:8955612.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGATTTTTAATATTTCTATATAAATAAAAACATCTGTTGTCTCCATTATATAGGAGAGGCCAACAAGTCTGCCTGGCTCACGGTGGAGCGTGAAAAAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAAGGGGAACCTGCGACAGTACCTCAGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAGACTTGTATCTGCACTTATCAATAGCAAGAGGCATGATTACTGCATCCAAGTGTAACCCGGATTGGCAGCCAGACGTGCTGTCACTGAAACATGTTATGAGATGCAATTTGTTGCCGGATTCATACTGATTATTAAAGACCATGCATCTGTCAATGATGACGAACTATCACGTTACTCTCAGAGAGTGGCTCTTGGATAAT
  5   1   3        nb Int1      in                         CAAP8091.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCACGGTGGAGCGTGAAAAAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCCTTCAAGACTTGGTATCCTGCACTTATCAAATAGNCAGAGGCATGGGATACCTGGCATCCCAAAAGTGTATA
  5   1   2       ext Gas7      in                         XZG58751.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTTCATCCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCANAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAGTGTATA
  5   1   3        nb Lun1      in                         CABD8349.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCATCGATTCAATTCGGCCGAGGTCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGC
  5   1   2       ext HdA       in                   THdA020a05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAAGAAGAAAAAGAACTTCACTGGGGCCGCCGTGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTA
  5   1   3        nb Gas7                                 XZG13868.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTAACAGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTG
  5   1   2       ext Sto1      in                          CABG889.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATTCGAATTGGCCGAGGGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGA
  3  -1   3        nb Int1      in                         CAAP3111.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCCATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCCTTCAGCAACT
  5   1   2       add In62                            IMAGE:8953817.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGGATGGACAAGCCAGGAAACTGCACCAATGACTGTACATGATGATGCGGGATTGTTGGCACGCCAATTCCCTCTCACAGACCCACCTTCAAGCACTGGTGGAAGATCTGACGGATCTCCAACTACACATGAGAATACTCGACTGACCGCCCCCCTGAGCAGTATTCCTCCCAGCTTCCTCTCGAT
  5   1   2       ext Gas7      in                         XZG27996.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTTCCTCTCACAGACCCACCTTCAAGCAACTGGGTGGA
  5   1   3        nb Gas7                                 XZG10163.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCGCCTCCTCCTCCTC
  5   1   2       ext Tad5      in                         XZT49974.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCT
  5   1   3        nb Gas7      in                         XZG11032.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCT
  5   1   3        nb Tad5      in                          XZT3803.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGNGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCT
  5   1   3        nb TbA       in                   TTbA080f05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTNCAGCAACTGGTGGAAGATCTGGACCGAATTCTCACAC
  5   1   0       chi Tad5      in                         XZT50960.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCCTGTCTCACCCTAATGGGAAATGCACAGAGCTAATGTCTGTCTCCCAGTGCCCGATGTTACCATTGTTACTGTACATCCCATGGCTGTACCCCCTCCGTATTGATCTGCTATGTTTTGTTCTCCCAGGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTGTAAGTGTGCAGTAATGTTTATGTGATGGGAACAATAGAAGGAAAAAGATTGGGAGCAGAAGAGACCTGTGATAGATTTTATTTTTCTGGTTTCCAGGATATCAGCTTGAGATCAAGAGATGCCATATAATGTATAAGGGGGTGGGTTGTAGAAGCTGTGTTTTGGGGTCTTTCTGGGACTAATTAATGGGATTGGAAATGGGGTTGATGATATTCTGTCCTCTTATGTGGTTATTTCATCTCTTGGTGCAGATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACAATGAGGAATACCTCGACTTGAGCGCCCCCTGG
  5   1   3        nb Gas       in                   TGas140o21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGGGGAAATTATTGGAAGCTAAAAACTCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTG
  5   1   2       add In63                            IMAGE:8961739.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCTTCCCGTTACCTACATATGTGCAGCGCCCACAAATTCGTCCCCGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACACCCATGAGAATACCTCGACTTGAGCGCCCTCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCTGCTCCGTCATCCACATCCTTCAGCGACGACTCAATGTTTTCTCCGACCCCATGCTCACGACCCTGACTACCCAAGTTCCACACGTTATGGGTAGTAAGAACTGAGCCGATTGCATCAGCACCTCCACTAATAGACTGCTGTCTCAGCCCGACG
  5   1   3        nb Gas7      in                         XZG57336.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCCAGTTCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTG
  3   1   3        nb Gas       in                    TGas082l16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGGGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAAAAAAAAAA
  5   1   2       add Gas       in                   TGas066a10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGAC
  5   1   3        nb Gas8      in                         st101i20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCC
  3  -1   3        nb Int1      in                         CAAP2192.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAA
  3  -1   3        nb Lun1      in                         CABD1310.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATCCCGTTGTACT
  5   1   2       ext HdA       in                  THdA025k03.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGAATACCTGGTCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGAAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACGCATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCACAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAAGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACGAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACATACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAAGGAAGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCACTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGTGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAACTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACGGAGGACGACAGAAAGAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGC
  5   1   3        nb Te1       in                        CBWN15044.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGCTGGTCACTGAAAACAATGTTATGAAGATCGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCCGTTGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCGGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGCTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGGTTCATCAAATGGCGGTACAACAGCGA
  3   1   2       add Gas7      in                         XZG28851.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAAC
  5   1   2       add In54                            IMAGE:8944719.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATATTTTATTTAAAGGACCAATTTAATACTAATTCGTCCCGGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACACAGCGAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCAGCCGGGATTTGTACCACAGTACATTCTCGTCTCATCGGATCATTCACTGACTCAGCAACAACTTTTGCTCTTGTATTTGAATATTTCGAAATAATCGACCTCTATCTCCGAGCCATACACATGGCGTCGATAATGATATCAATGTAGATGATATATCAGGATATTTGTTGGT
  5   1   3        nb Tad0      in                     NISC_no10b06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCCGACTTCCTGTCAAATGGATGGCACCGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTC
  5   1   3        nb HeRe      in                     EC2CAA17DC06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCCGTTGAGGAACTATTTAAGCTGCTGATAGAGGGACGCCGGATGGACAAGCCGGGAAACTGCATCCAATGAACTGTACATGATGATGCGGGATTGCTGGCACGCCATTCCCTCTCACAGACCCACCTTCTAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACA
  5   1   3        nb Liv1      in                          CAAR392.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGAAGCTTTATTCGACAGGGTTTACACTCATCAGAGTGATGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAA
  3   1   3        nb Gas       in                    TGas140o21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTATGGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAAAAA
  5   1   2       ext Gas7      in                         XZG63242.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTCATTTGGTGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCNCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATG
  5  -1   3        nb Int1      in                         CAAP2192.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTATTAATGTGGGAGATCTTTACCCTGGGGGGATCTCCGTACCCCGGAATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCAT
  5   1   3        nb Tbd1      in                        CBXT21654.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCGTACCCCGGAATTCCCGTTGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCGGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGCTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCT
  3   1   2       ext Tad5      in                         XZT49974.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTACCCCGGATTTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAAGG
  3   1   2       ext Gas7      in                         XZG63242.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAAGG
  3   1   3        nb Liv1      in                          CAAR392.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAAAAAAAAG
  3   1   2       ext Spl1      in                         CABK3001.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCTGTAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCT
  3   1   3        nb Int1      in                         CAAP8091.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAGAGGAACTATTTAAGCTGCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCG
  5   1   3        nb Limb      in                        CBSU3242.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGGAACTATTTAAGCTGCTGAAAGAGGGACACCNGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAAAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAAT
  3   1   4      seed Tad5 FL   in                         XZT56324.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGCTGAAAGAGGGACACCGGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTGGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAAGG
  3   1   2       ext HdA       in                    THdA020a05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTGAAAGAGGGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGAGGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAAAAAGCGCC
  5   1   2       add Tad5      in                         XZT72054.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCCCCTTGTAATTTTGTAATATTTTGAGAAAATAATT
  3   1   2       add Tad5      in                         XZT47352.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATGGTATATTTACAAGG
  3   1   2       ext Sto1      in                          CABG889.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCT
  3   1   3        nb Gas7      in                         XZG57336.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAAGG
  3   1   2       ext Brn2 5g3  in                        CAAJ23218.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCT
  3   1   3        nb Tad5      in                          XZT3803.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCT
  3   1   2       ext Ski1      in                         CABJ6091.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCT
  3   1   2       add Tad5 5g3  in                         XZT25107.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATG
  5   1   2       add Gas       in                   TGas098n24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTT
  5   1   3        nb Gas                            TGas048e03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTGCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTANCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTGCAAGCAAAACAAAACTTTTTTGCCTTCCTT
  3   1   3        nb Gas8                                 st110i07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCNTNTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTNTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATA
  5  -1   3        nb Lun1      in                         CABD1310.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCT
  3   1   2       ext Panc      in                         CBTA463.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCT
  3   1   3        nb Limb      in                        CBSU3242.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAATCGCGA
  5   1   2       add Eye       in                         CCAX5794.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAAATATATTTCCAGCACCTCTAATCCCTT
  3   1   3        nb Tbd1      in                        CBXT21654.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAA
  3   1   2       add Gas7      in                         XZG19899.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAAAGG
  3   1   3        nb Lun1      out                       CABD11943.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCT
  3   1   2       ext Gas7      in                         XZG52498.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCT
  3   1   2       ext Gas7      in                         XZG58751.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAAAGG
  3   1   3        nb BrSp 5g3  in                     EC2BBA27DG07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGTGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAAATATATATTATATATTTA
  3   1   3        nb Gas8                                 st111i07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACNTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAANCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTGTTCCTGCTCCGCCTCCTCCTCCTCCGGNGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTNTGCAGCTCCCCTATTAAGACTGCATGTCTNGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATAT
  3   1   3        nb Gas8                                  st94k21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTNTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCCAAAATATGTATAAATATATAT
  3   1   3        nb Gas8                                  st80f05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCNCACNTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCNGATTTTTCCTGNTCCGCCTCCTCCTCCTCCGGCGANGANTCAGTGTTTTCTCCCGNCCCCAT
  3   1   3        nb Te1       in                        CBWN15044.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGTGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTTGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAA
  3   1   2       ext Tad5 5g3  in                         XZT48793.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCT
  3   1   3        nb TbA       in                    TTbA080f05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGTTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas8                                 st112i07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACTTACAANCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTGTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTNTCCCGACCCCATGCCTCACGACCCCTGCCTNCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCNGATTGCGTTNTGCAGCTNCCCTATTAAGACTGCATGTCTNGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGNTGACAGNGGNCAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCTTTCACCAGAGCA
  3   1   3        nb HeRe      in                     EC2CAA17DC06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCTGCTCCGCCTCCTCCTCCTCCGGTGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGTGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCATAATATGTATAAATATATATTATATATTA
  3   1   2       add Tad5      in                         XZT50960.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCT
  3   1   3        nb Tad0      in                     NISC_no10b06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAAAG
  3   1   2       add Gas7      in                         XZG17730.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGACCCCATGCCTCACGAGCCCTGCCTCTCCAAGTTTCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGAATGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCTAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAATTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAACG
  3   1   3        nb Gas8      in                         st101i20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATGCCTCNCGACCCCNGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTTTGCAGCTCCCCTNTTAAGNANGCATGTCTNGNCGNCAGATTNTGCNGNACGATGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGNGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTNTCATCGGNATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGNTGCTGGATATAAATGTAAATATATTCCAAA
  5   1   3        nb Gas                            TGas134h08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCT
  5   1   3        nb BrSp      in                     EC2BBA21AF09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACATCGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGGGCGCCGATGGCGTAGCACAGAGCCTGTTTGCAGGATG
  5   1   2       add Bone      in                        CBTC1634.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTGTTTTTCTCCCTGAATCCAAGTCGCTGATCATCTCTCTCTGTCTTCTGTGTAACCCAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTTGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAATTACACAAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCAAATTCTGTTATTTTATATATATATATATGTATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGAACCCGTTGTCGTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATAGAAAAGGAACAATTTTTTTTTTTTTTTTTCATAAAAAAAACTATTCTACTGGCCT
  3   1   3        nb Gas7      in                         XZG11032.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTCCCCAATGGGGGTTCAACAAAAAACGAAACAACGGCGAAATGCCCCGATGGCTTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCTCTGGGACTCAAGGCAAAACAAAACTTTATAACCTTCCTTGTTAATTTAGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATAGTCGCTGCTGGATATAAATGTAAATACCTTCCAAATATGTATAA
  3   1   2       add Bone      in                        CBTC1634.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTCCCAGCTTCCCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTTGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAATTACACAAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCAAATTCTGTTATTTTATATATATATATATGTATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGAACCCGTTGTCGTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATAGAAAAGGAACAATTTTTTTTTTTTTTTTTCATAAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAAGAAATGGGAAGCAACGTCTGTAAATAAAACCTTGCACTAGTTCTAGATCG
  5   1   3        nb HdA       in                   THdA031o12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTAACCACAGTTACATTCTGCATCTCATCTGGATCATACGGTTGGACTCAAGGCAAAACGAAAATTTTTTGCCTATCCATGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAACAACACAAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCGAATTCTGTTAATTTATATATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACATAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAATAGGACTGGCGGATGAATCCTAAAAATGTTTTA
  5  -1   3        nb Int1      in                         CAAP3111.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAACAACACAAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCAAATTCTGTTATTTTATATATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATAGAAAAGGAACAATTTTTTTTTTTTTTTCATGAAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAAGAAATGGG
  3   1   3        nb Lun1      in                         CABD8349.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAACAACACAAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCAAATTCTGTTATTTTATATATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATAGAAAAGGAACAATTTTTTTTTTTTTTTCATGAAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAAGAAATGGGAAGCAACGTCTGTAAATAAAACCTTGCTGCTGTG
  3   1   2       ext Gas7      in                         XZG27996.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAACAACACAAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGGTAACTGCAAATTCTGTTATTTTATATATATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATAGAAAAGGAACAATTTTTTTTTTTTTTCATGAAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAAGAAATGGGAAGCAACGTCTGTAAATAAAACCTTGCTGCTGTGGAATGTCAAAAAAAAAAAAAAAGG
  3   1   2       add Tad5      in                         XZT72054.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAACAACACAAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCAAATTCTGTTATTTTATATATATATATATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATAGAAAAGGAACAATTTTTTTTTTTTTTCATGAAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAAGAAATGGGAAGCAACGTCTGTAAATAAAACCTTGCTGCTGTG
  3   1   2       add Gas       in                    TGas098n24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTCCAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAACAACCCAAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCAAATTCTGTTATTTTATATATATATATATATATATGCCCCCTACACTGACAGAAATACTTATTTTTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATAGAAAAGGAACAATTTTTTTTTTTTTTCATGAAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAAGAAATGGGAAGCAACGTCTGAAATAAAACCTTGCTGCTGTGGAAGTTAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext HdA       in                   THdA025k03.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAGTCAAGGCAAAACAAAACTTTTTTCCCTTCCTTGTAAATTTTGGAAAACTTTGAGAAAATATATTCCTGCACCTGTAATCCCTTCACCCGAGCACATACACCGCATGGTCGCTGCTGGATATAAATGTAAATATCTTCCAAAGATGGGGAAAAATATATTATATATTTGCAATGAATTTTTTTTTGTGTGGTTTCTACAAAAAAAAAAATCACCTCCAAAAACTTGTTTTTAGGGTTTAGGGCTAGTCACCTAAAAGGGGGGGGTAACAGCAAATTCTGTTATTTTATGTATATATATATGCACCCTCCACTGACAGAAATAATTATTTTTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTTGTGTACAAACCGGACTGGCGGATGAATCCGAAAAAAGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAATTCACCTATATTTTGCCTTGAAATCACAAAAGACAAGTTATCAGAGAGCAGATTGTATAGAGCTTTTACGGTATTTATGGTGTAATATGGAAAAGGAACAATTTTTTTTTTTTTTCATGAAAAAAAACCTATTGNTTTTGGCCTTCTCCCCTGAATGTTGGAGGAGGAAGTTCTGTACAATTGTATATTAAAGAATGTGGGAAGCAAGCCATCTGTAAATAAAACCCTTGAGGACTGTGGAATGTCAAAAAAAAAAAAAAAAAAAAG
  3   1   3        nb BrSp      in                     EC2BBA21AF09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATACTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAACAACACAAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGGTAACTGCAAATTCTGTTATTTTATATATATATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATAGAAAAGGAACAATTTTTTTTTTTTTTTCATGAAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTGAAATGTGGAAGTCTGTACAATGTATACTAAGAAATGGGA
  3   1   3        nb HdA       in                    THdA031o12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCACTTTTACTCCCTTCACCAGAGCACATACACAGCATTGTCGTTGCTGGATATAAAAGTAAATATATTCCCAATATGTAGAAACATATATTATATATTTACAAGGAATTATTTTTTGAATTGATTTTAAAAAAAAAAAAAAACAACCCAAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCAAATTCTGTTATTTTATATATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATGGTAAAGCAACAATTTTTTTTTTTTTTCATGAAAAAAAACTATTCTACTGGCCTTCTACCCTGAAGATTGGATTGTGGAAGTTCTGTACAATTGTATATTAAGAAATGGGAAGCAACGTCTGTAAATAAAACCCTTGGTGGCTGTGGAATGTCAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       add Gas       in                    TGas066a10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGGGGTAACTGCAAATTCTGTTATTTTATATATATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACNCCAGATTTAATTTATTAGCACNGTGGGAAACACAGAAGCCNNCCCNGGGGGACCCGCGTTGTCGTGTACAAACCAGGACGTGGCGGATGAATCGCGAAAAAATGTTTTAGGCCAGNTGGTTGTAGTTAACTTAAATTAAAAAAAAAAAAAAAAA
  3   1   3        nb HdA  5x3  out                   THdA031o13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTTAATTAAAAAAAATTCACTTCTATTTTGCCTTGAAATCACAAATAGACAAGCTACAGAGAGTCAGATTGTATAGAGCTTTTATGGTATTTTTGCTGTAATATAGAAAAGGAACAATTTTTTTTTTTTTTCAAGAAAAAAAACTTATTCTAAAGGCCTTCTACCCTGAATGTTGGATGTGGAAAGTAAAGTAAAAAAGTATAATAAAGAAAGAGGGAAGACAAAGTAATGTAAATAAAAACCTAAGAAGATGTGGAAAGTCAAAAAAAAAAAAAAAAAAA
  3   1   1       add Eye       in                         CCAX5794.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTTAGAGGTTTTTTGGTTTTTTTGGTTTTATTTAGAAAAGGAACAATTTTTTTTTTTTTTCAAGAAAAAAAAATATTTTTCTGGCCTTCTCCCCGAAATTGGATGGGGAAGTCTGTACAATGTTTTTTAAGAAAAGGGAAGCAACGTCTGTAAATAAAACCCTGCTGCTGGGGG
  3   1   3        nb BrSp                             EC2BBA21DE08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTTTTTTTTTTTCATGAAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAAGAAATGGGAAGCAACGTCTGTA
  5   1   2  SIG                                      Xt7.1-XZT67690.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGTACAGATTTTTCCATCCTGCTGGATACACACCAGAGAGGCCCAGGAAAGCACCCCACATCCACTGCTCCAGCTTCTTATACCAGGGGTGCCGGCACAGGTTCTTGTAGGACAGAAGCACCCAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATACGGTAAAGTTACGCTGCCCGGCAGGAGGGAATCCCACCCCTCGAATGAGGTGGTTAAAGAATGGAAAGGAGTTCAAACAGGAGCATCGGATTGGGGGATACAAGGTCCGTAACCAGCACTGGAGCCTGATCATGGAAAGTGTTGTCCCATCAGACAAGGGCATCTACACGTGTATTGTGGAAAATGAACACGGCTCCATTAACCATACTTACCACTTGGATGTCATTGAACGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGTTGACGGTTCATCCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGTAAGTGTTTGCTGTTTGGCATTTGGTTGGGCTGGTTATGTTTGGTTCCACCATAATATAGAGTAATGGCAATCAGGTACA------------------------------------------------------------------------------------------------------------------------------------ATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTT
                                                  Xt7.1-CHK-1008275808                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGATTTTTCCATCCTGCTGGATACACACCAGAGAGGCCCAGGAAAGCACCCCACATCCACTGCTCCAGCTTCTTATACCAGGGGTGCCGGCACAGGTTCTTGTAGGACAGAAGCACCCAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATACGGTAAAGTTACGCTGCCCGGCAGGAGGGAATCCCACCCCTCGAATGAGGTGGTTAAAGAATGGAAAGGAGTTCAAACAGGAGCATCGGATTGGGGGATACAAGGTCCGTAACCAGCACTGGAGCCTGATCATGGAAAGTGTTGTCCCATCAGACAAGGGCATCTACACGTGTATTGTGGAAAATGAACACGGCTCCATTAACCATACTTACCACTTGGATGTCATTGAACGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGTTGACGGTTCATCCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGTAAGTGTTTGCTGTTTGGCATTTGGTTGGGCTGGTTATGTTTGGTTCCACCATAATATAGAGTAATGGCAATCA------------------------------------------------------------------------------------------------------------------------------------CTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATT
  5   1   0       chi Gas7      in                         XZG19899.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGACGCGTGGGCACACACGGGATCTACACTGGGTTGCACCTCTCACACATCCACTTTTGGGAACTTTCCCTACCTATTACCTTATTGTTTGTGGCTGCACTGCTGCCTGGAAGGGCTTGGCTTGCCTGGATAGCACTTACCGGGATTCCTATGCACTGACAGGATGCTGGTACTCGTGCTACTTGGGTTGCTTCTGGTCAGCCGAACAATAGCCCGGCCATCTTACCACATGGCGGAGGATACCACTTCTGAACCCGAAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATACGGTAAAGTTACGCTGCCCGGCAGGAGGGAATCCCACCCCTCGAATGAGGTGGTTAAAGAATGGAAAGGAGTTCCAACAGGAG
  5   1   2       ext Gas       out                  TGas101l21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCCTTGCCTTACACTGAGAGGAGGCCAGGCCTAACCAAGTACAGATTTTTCCATCCTGCTGGATACACACCAGAGAGGCCCAGGAAAGCACCCCACATCCACTGCTCCAGCTTCTTATACCAGGGGTGCCGGCACAGGTTCTTGTAGGACAGAAGCACCCAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGAGGGCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAAGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAAGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTGAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATA
  5   1   2       ext Thy1      in                       CBST11690.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCAGCCATAACCAAGTACAGATTTTTCCATCCTGCCGGATACACACCAGAGGGGCCCAGGAAAGCACCCCACATCCACTGCTCCAGCTCCTGATACTGGGGGTGCCGGCACAGGTTCTAGTAGGACAGAAGCACCCAGAACCTCCGGCCAAATACCAAATCTCCAAAGCTGATGTCTTTCCTGTTCTGCCTGGTGAGCCACTTGATCTTCGCTGCCCATTGGCCGATGGCCCCCCTGTGACTTGGAATAAAGATGGGGCAAAGTTAGAGGTCAACAATAGGACGTTGATTGTCAGGAACTACTTGCAGATTAAGGAGACCACCCCCAGGGACTCAGGGCTCTATTCCTGTTCAGTGTTAAAAAACTCACATTTCTTCCATGTCAATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAATGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATACGGTAAAGTTACGCTGCCCGGCAGGAGGGAATCCCACCCCTCGAATGAGGTGGTTAAAGAATGGAAAGGAGTTCAAACAGGAGCATCGGATTGGGGGATACAAGGTCCGTAACCAGCACTGGAGCCTGATCATGGAAAGTGTTGTCCCATCAGACAAGGGCATCTACACGTGTATTGTGGAAAATGAACACGGCTCCATTA
  5   1   2       ext Gas7      in                          XZG5763.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGTCACAGAAGCCAGTTCTTCCGGGGATGATGAAGATGATAACGACGGTTCTGAAGACTTCACCAACGACAATAACAATATAAGAGCTCCCTACTGGACCAACACAGAGAAGATGGAGAAGAAGCTTCACGCCGTTCCTGCAGCGAATACGGTAAAGTTACGCTGCCCGGCAGGAGGGAATCCCACCCCTCGAATGAGGTGGTTAAAGAATGGAAAGGAGTTCAAACAGGAGCATCGGATTGGGGGATACAAGGTCCGTAACCAGCACTGGAGCCTGATCATGGAAAGTGTTGTCCCATCAGACAAGGGCATCTACACGTGTATTGTGGAAAATGAACACGGCTCCATTAACCATACTTACCACTTGGATGTCATTGAACGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGTTGACGGTTCATCCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAA
  5   1   2       add Gas1                               IMAGE:6988254                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCAAGATAGCACTGGAGCCTGATCTTGCCCAGAGTTGTCCCATCAGACAAGGGCATCTACACGTGTATTGTGGAAAATGAACACGGCTCCATTAACCATACTTACCACTTGGATGTCATTGAACGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTGCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGTTTTCTACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGTTGACGGTTCATCCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCCCATGACCCTCTCTGGGAGTTTCTCGAGAGACAAGCTTGACGCCTTGGGCAAAGCCACTTGGGCGAAGGGGGTGCCTTTTGGGGCAAAATTGGGTGAATGGGCCCCAGGA
  5   1   3        nb Tad5      in                         XZT49515.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAATGAACACGCGCTCCATTAACCATACTTACCACTTGGATGTCATTGAACGTTCCTCGCACAGACCCATACTGCAGGCCGGGCTTCCGGCGAACACCACAGCCATGGTGGGAGGGGACGCAGAGTTTGTCTTCAAGGTGTACAGTGATGCCCAGCCCCACATCCGCTGGGTGAGATACATTGAGAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGTTGACGGTTCATCCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAAGCTC
  5   1   4      seed Tad5      in                         XZT67690.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGAATGGAAGCCGATTTGGCGTCGACGGCTTACCTTATATCAAGGTTTTAAAGGCGGCTGGAGTTAACGTTACGGACGAAGAGATAGAAGTCTTGTATGTCAGGAATGTTTCTTTTGAGGATGCTGGGGAATATACTTGTATAGCTGGAAATTCTATTGGGATTTCTCAACATTCTGCCTGGTTGACGGTTCATCCAGCTACTGTCAGTCCAGGGGAAGACAACCCCGTCCCCTATTACATGGAGATTGGTATCTACTCTGCCGGTATCTTTATAATCTTCTGTATGGTGGTGATCTGCGTGGTGTGCCGTATGCGCCAAGGAGCCAAGAAGAAAAAGAACTTCACTGGGCCGCCGGTGCACAAACTCACCAAACGGATACCGCTCCATCGCCAGGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGANAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATG
  5   1   2       ext Tad5                                 XZT61398.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGGTTTCGGCTGATTCCAGCTCATCCATGAACTCAACCACTCCTCTGGTGAGGATCACAACGCGACTCCTGTCCAGTACCGACGCCATGCCCTTACCGAATGTGTCTGAATATGAACTGCCACATGACCCTCTCTGGGAGTTCTCGAGAGACAAGCTGACGCTGGGCAAGCCACTTGGCGAGGGGTGCTTTGGGCAAGTGGTGATGGCCGAGGCTCTTGGGATTGATAAAGACCGTCCCAAGGAGTCTGTGACAGTAGCGGTGAAGATGCTGAAAGATGATGCTACGGAGAAAGACCTGGCAGATTTGGTATCAGAAATGGAGATGATGAAAATTATTGGAAAGCATAAAAACATCATTAACTTACTAGGAGCCTGCACGCAGGGAGGAACACTGTATGTCATTGTTGAATATGCTGCTAAGGGGAACCTGCGACAGTACCTCAGGGCCAGGCGCCCTCTCGAGATGGAGTACTCGTTCGATGTTACTAGGGTTCCCGATGAGCAGATGACCTTCAAAGACTTGGTATCCTGCACTTATCAAATAGCAAGAGGCATGGAATACCTGGCATCCCAAAAGTGTATACACCGGGATTTGGCAGCCAGGAACGTGCTGGTCACTGAAAACAATGTTATGAAGATTGCAGATTTTGGTCTGGCGCGAGATGTCAATAACATTGATTATTATAAAAAGACAACAAATGTAAGTGTTTGCTGTTTGGCATTTGGTTGGGCTGGTTATGTTTGGTTCCACCATAATATAGAGTAATGGCAATCAGGTACA
  3   1   4      seed Tad5      in                         XZT67690.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCT
  3   1   2       ext Gas7      in                          XZG5763.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCNCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCCCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCTTTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAAAGGG
  3   1   2       ext Thy1      in                       CBST11690.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACCTTCAAGCAATTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCT
  3   1   3        nb Tad5      in                         XZT49515.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGCCTCCTCCTCCTCGGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCT
  5   1   2                                         Xt7.1-TNeu074e05.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTCCAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAACAACACAAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCAAATTCTGTTATTTTATATATATATATATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATAGAAAAGGAACAATTTTTTTTTTTTTTCATGAAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAAGAAATGGGAAGCAACGTCTGTAAATAAAACCTTGCTGCTGTGGAATG
                                                  Xt7.1-CHK-1008275800                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTCCAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAACAACACAAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCAAATTCTGTTATTTTATATATATATATATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATAGAAAAGGAACAATTTTTTTTTTTTTTCATGAAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAAGAAATGGGAAGCAACGTCTGTAAATAAAACCTTGCTGCTGT
  5   1   4      seed Neu       in                   TNeu074e05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACACCGGATGGACAAGCCAGGAAACTGCACCAATGAACTGTACATGATGATGCGGGATTGTTGGCACGCCATTCCCTCTCACAGACCCACCTTCAAGCAACTGGTGGAAGATCTGGACCGAATTCTCACACTTACAACCAATGAGGAATACCTCGACTTGAGCGCCCCCCTGGAGCAGTATTCTCCCAGCTTCCCCGATTCTTCCTGCTCCGCCTCCTCCTCCTCCGGCGACGACTCAGTGTTTTCTCCCGACCCCATGCCTCACGACCCCTGCCTCCCCAAGTTCCCACACGTTAATGGGGTGGTAAAGACATGAAGCCGATTGCGTTCTGCAGCTCCCCTATTAAGACTGCATGTCTCGCCGACAGATTCTGCAGAACGCTGAGGAATGTGGACATTCCAGTTGACAGAGGACAACAAAAAAAAAGGACAACGTTCTGCAAATTCCGTTGTACTCAGGTTTCCCCAATGGGGGTTCATCAAATGGCGGTACAACAGCGAAGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAAC
  3   1   4      seed Neu       in                    TNeu074e05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTGCGCCGATGGCGTAGCACAGAGACAGTATGGAGGATGCGCCAAGCCGGGATTTGTAACCACAGTTACATTCTCCGTCTCATCGGGATCATTCACTTGGACTCAAGGCAAAACAAAACTTTTTTGCCTTCCTTGTTAATTTTGTAATATTTTGAGAAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTCCAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAACAACACAAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCAAATTCTGTTATTTTATATATATATATATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATAGAAAAGGAACAATTTTTTTTTTTTTTCATGAAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAAGAAATGGGAAGCAACGTCTGTAAATAAAACCTTGCTGCTGTGGAATGTCAAAAAAAAAAAAAAAAAA
  5   1   2       ext Tad5      in                           XZT331.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTGAGAAATATATTCCAGCACCTCTAATCCCTTCACCAGAGCACATACACAGCATTGTCGCTGCTGGATATAAATGTAAATATATTCCAAATATGTATAAATATATATTATATATTTACAATGAATTATTTTTTGTATTGATTCTAAAAAAAAAAAAAACAACACAAAAAACTTGCTGTTAGGGCTTAGGGCAAGTCACCTAAGTGGGGGGGTAACTGCAAATTCTGTTATTTTATATATATATATATATATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCACAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATAGAAAAGGAACAATTTTTTTTTTTTTTCATGAAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAAGAAATGGGAAGCAACGTCTGTAAATAAAACCTTGCTGCTGTGGAATGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGCGGCCCGC
  3   1   2       ext Tad5      in                           XZT331.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAATATGTATAAATATATATTATATATTTCCAAGGAATTATTTTTGGTATTGATTCTAAAAAAAAAAAAAACAACACAAAAACCTTGCTGTTAGGGCTTGGGGCAAGTCACCTAAGTGGGGGGGTAACGGCAAATTCCGTTATTTTATATATATATATAAAAATATGCACCCTACACTGACAGAAATACTTATTTCTTATTAAAACTAACCCAGATTTAATTTATTAGCACGTGGGAAACACAGAAGCCCCCGGGGGACCCCGTTGTCGTGTACAAACAGGACTGGCGGATGAATCCGAAAAATGTTTTAGGCCAGTGGTTGTAGTTAACTTAAATTAAAAAAAATTCACTTATATTTTGCCTTGAAATCCCAAAAGACAAGCTACAGAGAGCAGATTGTATAGAGCTTTTATGGTATTTATGCTGTAATATAGAAAAGGAACAATTTTTTTTTTTTTTCATGAAAAAAAACTATTCTACTGGCCTTCTCCCTGAAGTTGGATGTGGAAGTCTGTACAATGTATACTAAGAAATGGGAAGCAACGTCTGTAAATAAAACCCTTGCTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)