Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA015l14.3                        325 END     2           1        0                MGC69403 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 93%

 1012071523 Xt7.1-CAAK7282.3 - 155 ESTs
                                                                       ....-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAK7282.3                         AGGTAACTCCATTGCAGTAATTAGTGAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAGGGCCTTGATTAAATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGTGCACAGTGAAGTAGTTGCTATCCATTTCCAACCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCATGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTCCACAGGAGGCCTATACATGGCCATTTACTAGCAAGGATTATCCTTCATTTAAATGACAAGGAAATGCTCAAGTACTGAGAAGTGCTCCACCCCAGTTCGTATAATCACTAACCGCTGACCCCAAGCAGACACTTTGCTAAAAAGCACAGTGCCGCTAAGGACGGTCCATCTACAGAGTAGTAATTAGTTGCCAACATCTGTCGGCACAATACAGTGCATCTCTTTAAATATATAACCAAAAGGCAACACTATAAACAGAAACAGCCATATATAAAATTTTATTCACATGCAATTTAAATAAATTATAACACTTTTGAATCATTACCAATAATACCATTACAGCTGTGGTTAAAGTCCCACGTAATTGTTGCTTCCTTGTAGCTGCATTGTCTTGACTAATTTATGTGTGCCCTTGGAGGAACTTCAGCCTGTGATCTGGAAAATCCATACAATTGCAGCAAGCTCTATTTTTTACTTAACCACTTGTTTTTTTAATGGGATTAAAGCACACAGGCTGGTGTTCACCTGGGATTTACTTTCACTTTTTTAAAATGTGCAGAGAAAGAGACTAATTATTTGTGCTTTAAATTTAGCTTTTTCTCATTAGAAAAGCAAAGTCTTAACTTTTATACAGATATATGAGATCGATATTCATTCTCAAAGCATTGTGGAATTTATGTTTGCAAATTTCTAGCACACCATTATTTGTCTTGTACTGTATGTTTTCACACTGCTGTATTTACATGTATAGCTCTGCAGTGGCGGTGTGGAACCCTTACACACAGCAAATTATTAGGGATAGGCAACCCCTGGAGCAAGACTCCAACCCATGTTGCAAGACTACAGTGCATACCATCCCTCCTGCACTTGGCAAAGGGATGCTGGGAGTTTTAGTTCTTCACCATTGAGAGCCCCAGCTGTTCCAGAAAACTAAAGGGGTTATGTTATAAAAGGCAATATGTTTGCCCAGGAGAAGTAACCCAGCTTAAGAAAAAACATCTTAATAGTTGCTATAAGTTACTGCTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTTAGCAAAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACTAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222247                               CTCCATTGCAGTAATTAGTGAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTxxxGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAGGGCCTTGATTAAATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGTGCACAGTGAAGTAGTTGCTATCCATTTCCAACCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCATGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTCCACAGGAGGCCTATACATGGCCATTTACTAGCAAGGATTATCCTTCATTTAAATGACAAGGAAATGCTCAAGTACTGAGAAGTGCTCCACCCCAGTTCGTATAATCACTAACCGCTGACCCCAAGCAGACACTTTGCTAAAAAGCACAGTGCCGCTAAGGACGGTCCATCTACAGAGTAGTAATTAGTTGCCAACATCTGTCGGCACAATACAGTGCATCTCTTTAAATATATAACCAAAAGGCAACACTATAAACAGAAACAGCCATATATAAAATTTTATTCACATGCAATTTAAATAAATTATAACACTTTTGAATCATTACCAATAATACCATTACAGCTGTGGTTAAAGTCCCACGTAATTGTTGCTTCCTTGTAGCTGCATTGTCTTGACTAATTTATGTGTGCCCTTGGAGGAACTTCAGCCTGTGATCTGGAAAATCCATACAATTGCAGCAAGCTCTATTTTTTACTTAACCACTTGTTTTTTTAATGGGATTAAAGCACACAGGCTGGTGTTCACCTGGGATTTACTTTCACTTTTTTAAAATGTGCAGAGAAAGAGACTAATTATTTGTGCTTTAAATTTAGCTTTTTCTCATTAGAAAAGCAAAGTCTTAACTTTTATACAGATATATGAGATCGATATTCATTCTCAAAGCATTGTGGAATTTATGTTTGCAAATTTCTAGCACACCATTATTTGTCTTGTACTGTATGTTTTCACACTGCTGTATTTACATGTATAGCTCTGCAGTGGCGGTGTGGAACCCTTACACACAGCAAATTATTAGGGATAGGCAACCCCTGGAGCAAGACTCCAACCCATGTTGCAAGACTACAGTGCATACCATCCCTCCTGCACTTGGCAAAGGGATGCTGGGAGTTTTAGTTCTTCACCATTGAGAGCCCCAGCTGTTCCAGAAAACTAAAGGGGTTATGTTATAAAAGGCAATATGTTTGCCCAGGAGAAGTAACCCAGCTTAAGAAAAAACATCTTAATAGTTGCTATAAGTTACTGCTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTTAGCAAAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                              3     4     6     7    11    13    23    25    26    29    28    31    28    31    30    34    31    34    31    34    31    34    31    34    32    35    32    35    33    35    33    35    33    35    25    36    35    36    35    36    35    36    35    36    36    37    36    37    35    37    37    39    37    39    37    39    37    39    38    40    38    39    39    40    39    40    40    41    41    42    42    43    43    44    45    46    47    48    49    50    49    50    49    50    49    50    49    50    50    51    50    51    51    52    52    53    53    54    53    54    52    54    52    53    52    53    50    51    52    52    50    50    50    50    48    48    48    48    48    48    47    48    47    49    46    50    47    50    48    50    45    50    46    50    46    50    45    49    44    49    45    49    41    46    41    44    43    46    41    44    36    41    36    40    32    37    32    37    32    36    31    37    30    36    29    36    29    36    29    36    29    36    29    36    28    36    29    37    29    37    28    37    28    37    28    35    28    35    28    36    17    34    17    32    17    32    15    29    13    25    13    21    13    20    13    20    13    17    13    16    13    16    14    17    15    18    15    17    15    16    15    16    15    16    15    15    14    15    14    15    14    15    14    15    14    14    14    14    14    14    14    14    14    14    14    14    12    12    11    12    11    12    10    11    10    12    10    12     9    12     8    10     8    11     8    11     8    11     5    10     5    10     5    10     5    10     5    10     5    10     5    10     4    10     4    10     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     6    11     6    11     6    11     6    11     6    10     6    10     6    10     6    10     6    10     7    10     7    11     8    11     8    11     8    11     8    11     8    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    13    13    12    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    13    13    13    14    13    14    14    14    13    13    12    13    12    13    11    13    11    13    12    14    12    14    11    13    11    13    12    14    12    12    12    12    12    12    11    12    11    12    11    13    11    13    11    13    11    14    11    14    11    14    12    16    12    16    12    16    13    18    13    18    14    20    14    20    16    22    19    26    20    26    22    28    28    35    33    43    34    44    33    45    35    47    33    48    37    49    38    53    41    54    41    54    41    53    42    53    43    54    50    55    51    56    51    57    54    57    55    58    55    59    56    60    59    61    60    62    60    62    58    62    61    64    60    63    62    65    59    65    60    66    61    66    61    65    60    65    62    64    62    64    62    64    61    64    61    63    59    62    60    62    60    62    60    62    59    62    61    62    60    62    60    61    59    60    58    60    58    60    57    60    56    59    57    59    56    59    57    59    55    59    55    59    52    59    52    59    52    58    51    57    50    57    46    55    41    55    41    55    40    53    36    52    38    52    33    48    11    16     4     4
                                                                   SNP                                                                                                                                                                                                                                     ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                     ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AC----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------C
                                               BLH ATG      61     652                         
                                               BLH MIN      61      86                         
                                               BLH MPR      61      86                         
                                               BLH OVR      61      61                         
                                               CDS MIN      61      31                         
                                               EST CLI      25      31                         
                                               ORF LNG      61       4                         
                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 2e-026     XP_780155.1 PREDICTED: similar to CG11009-PA [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                            PROTEIN === Ce ==== 5e-031     NP_508620.1 WW domain binding like (32.6 kD) (XE224) [Caenorhabditis elegans] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                            PROTEIN === Dm ==== 6e-034     NP_648607.2 CG11009-PA [Drosophila melanogaster] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                           PROTEIN === Xt ==== 1e-066     AAH88817.1 LOC496980 protein [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                            PROTEIN === Dr ==== 5e-076     NP_956004.1 WW domain binding protein 2 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                            PROTEIN === Mm ==== 1e-079     NP_058548.1 WW domain binding protein 2 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                            PROTEIN === Hs ==== 1e-079     NP_036610.2 WW domain binding protein 2 [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                            PREDICTED = Gg ==== 5e-112     XP_001233672.1 PREDICTED: hypothetical protein [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                            PROTEIN === Xl ==== 3e-158     AAH82812.1 LOC494729 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                            PREDICTED = ?? ==== 3e-158     NP_001088037.1 hypothetical protein LOC494729 [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAK7282.3                                                                             TAG------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATGATG---------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------ATG------------------ATG------ATG---ATG---------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------ATG---ATG---------------------------------------------TAA---------------------------TAG---------------------------------------------------------------------------------------------ATGTGA---------------------------------------------------------------ATGTAA---------------------------------------------------------------------------------TAA------TGA------------------------------------TGA---------------------------------------ATG---------------------TGA---------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------TGA------------------------------TAA------------------------------------------------------------------TAGTAA---------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------TAG---------------TAA---ATG---------------------------------------------------------------------------------------TAA------TAA---------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------TAG------------TAA---------------------------------------------TAA---------------------------------------------TAA------------------------------ATG------------------------TAA------------------ATGTAA------------------TGAATG---------------------------------------------------TGA---------TAG------------------TGA---------------------TAA---------------------TAG------------------------------------------------TAG------------TGA------------------------------TAA---------------------------------------------------------------------------------------------TAA---------------------------------------TAG---------------------TGA------TGA---------ATG---------TAA---------------------------------------------------------------------------TGA---------------------------ATG------------------------------------------------------------------------------------TGA---------------------------TAA---TGA---------------------------------TAA
                                                                   ORF                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  0   1   1           Egg  FL                     TEgg073e17.FL-Sanger                                                 TGAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTATTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCTATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCTCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTTAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTTCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTCAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld In66 5g                         IMAGE:8964651.5p CCACCTTTAATTACAACCTACACCACCATTAAAAAAAACCCGTATTAGTGAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTATTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCTATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGATATGCCTGAGCAGCAAAGCTGCAGAGCTGCATCCAGTGCGTATTATATCCAGCGACCCTCACATGTTCTACATGCCCTTATGGGACCGTCCACCCTCCCATATGCCTCCCGAACTTTATTGA
  5   1   2   10  bld Te1  5g3  in                         CBWN5508.b1 ............AGGAGCTCCATTAGGTAACTCCATTGCAGTAATTAGTGAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGANATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGAATGCCTGG
  5   1   2       bld 1030 5g                         IMAGE:7029054.5p                   GCCATTAGGTAACTCCATTGCAGTAATTAGTGAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAA
  5   1   2       bld BrSp 5g3  in                      EC2BBA7BH06.g1                      GGGAGGTAACTCCATTGCAGTAATTAGTGAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTAT
  5   1   2       bld Abd0 5g3  in                       IMAGE:7003130                                  CATTGCAGTAATTAGTGAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGGACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCCGACCCTCACAATGTCTACATGCCCTA
  5   1   2       bld TpA  5g3  in                   TTpA068e02.p1kSP6                                  CATTGCAGTAATTAGTGAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTATTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCTATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGNGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCANAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTA
  5   1   2   14  bld Brn3 5g3  in                        CAAK10815.5p ..................................ATTGCAGTAATTAGTGAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGAC
  5   1   2       chi Liv1      in                         CAAR5137.5p                                             CGGTTCTGGGCAGCTGTTGAGAAAAGTTCTCAAGGGTCTGTTTAGAAAATACTTCTGTGTTCTGAAGCTGATGCTGCAAGGCTGATTATTTACttgcactgatttctgagctgccatgtgctagttatctgaaataattactaaatagccttatatcatgacatattctatatatacagtatattgtgagtgggttcctaagctcaggtaagtgacagcatctgggaatcagcagaaaagaagatggggagctactgggggtatatttgggggcacagaacttcattgctttggactttcgttgccttgggctggtacagaagatcagaacataatatataacattgctgcccttcttcttgagttaaACTTTAGTTCTCCTTTCAATACATGTACTTTAACGTCTTTCCAATGCTGTATGAGATTTAGCCTGGGAACATCCATTGTGCTATTAACTATCCCCAGCCATTCTCTGCCCACTCATATTAGTTTTATTTTTCATGGATGTGGAAATGTAGCTTTCACACTCCTGGCTTAATATGGGTGATGTAACTTACAAGATGGGGGATTTATTTTTGTTTTAGAAGCACAAAATGTTGTGTATTTATGACAGTTATTTTTCTATAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGNGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTA
  5   1   2       bld HeRe 5g3  in                     EC2CAA21CE05.g1                                              GAGTGAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTATTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCCGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGGGATACCCCTATGCTCCACCACCAGGACCTGGT
  5   1   2       bld Egg  5g                        TEgg100j05.p1kSP6                                                TGAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTCATTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCA
  5   1   2       bld AbdN 5g                            IMAGE:7004754                                                GTGAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGGACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCCTGGAGGCAGCAAAGCTGCAGAAAGCTGCATCCAGTGGCGTATTATAAATCCAGCCGAACCCCTCACAAATGGTCTAACATGGCCCTATGGGAACCT
  5   1   2   12  bld Gas7 5g3  in                         XZG36788.5p ...............................................GTGAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGNGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGAATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACCACT
  5   1   2       bld Egg  5g                        TEgg137n03.p1kSP6                                                 TGAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCAGTGCTGAGCCTG
  5   1   2       bld Egg  FL   in                   TEgg073e17.p1kSP6                                                  GAGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTATTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCTATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCTCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGG
  5   1   2       bld Gas  5g                        TGas130c09.p1kSP6                                                   AGTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGA
  5   1   2   10  bld Te1  5g3  in                         CBWN2880.b1 ...................................................GTACGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGNG
  5   1   2   10  bld Tbd1 5g3  in                         CBXT5732.b1 ......................................................CGCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCACGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCC
  5   1   2   12  bld Gas7 5g3  in                         XZG48526.5p .......................................................GCAGGGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTATTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCTATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAAACAC
  5   1   2       bld Egg  5g3  out                  TEgg002n08.p1kSP6                                                            GGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCCACTCCAAATCCAATGGGATACCCCTATGC
  5   1   2       bld Egg  5g3  ?                    TEgg003a23.p1kSP6                                                            GGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCT
  5   1   2       bld Egg  5g3  in                   TEgg036a07.p1kSP6                                                            GGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAAT
  5   1   2       bld Egg  5g3  in                   TEgg037o23.p1kSP6                                                            GGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCA
  5   1   2       bld Egg  5g3  in                   TEgg037p24.p1kSP6                                                            GGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCACGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCA
  5   1   2   14  bld Brn3 5g3  in                         CAAK3679.5p ...........................................................GGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGT
  5   1   2       bld Te5       in                         CAAO7484.5p                                                            GGAGAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGA
  5   1   2   10  bld Tbd1 5g3  in                        CBXT21265.b1 ..............................................................GAAGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGAATGCCTGGAGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACAT
  5   1   2   15  bld Brn3 5g3  in                         CAAK7277.5p ...............................................................AGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAAACACTAAACACAAATTCCTG
  5   1   2   12  bld Gas7 PIPE in                          XZG4188.5p ................................................................AGTTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTC
  5   1   2   14  bld Brn3 5g3  in                         CAAK7282.5p ..................................................................TTGGAAGGTTTAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCTTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAAC
  5   1   2   10  bld Fat1 5g3  in                         CABC5435.5p ............................................................................TAGTGGGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACNNACTAACACAAATTCCTGAGCCCACTGCAACAT
  5   1   2   34  bld Brn3 5x3  out                        CAAK8330.5p .................................................................................GGAGATGTCGCTAAATAAGAACCACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCACTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAAC
  3  -1   2       bld Tbd1      in                         CBXT3824.g1                                                                                                   TCGCGATCTAGAACTAGTCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTCTTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCTTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGAATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTA
  5   1   2       bld Ski1      in                         CABJ8817.5p                                                                                                        CACTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTATTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCTATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTA
  5   1   2       bld Ski1      in                         CABJ3360.5p                                                                                                          CTCTGAGGGGGCTGGGATCATCGTCAGCAACGGGGAGAGTGTTCTCAGGCAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTATTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCTATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGNCACATAGCCTTTGTATCTCTTG
  5   1   2       bld Liv1      in                        CAAR12723.5p                                                                                                                                                                        TGGAACTCTCCTTCAGCGATATGTCTCAAAAATCAGAGGCATTCAAAGGCACCAAAAAAGGATCTCTATTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCTATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCCCCT
  5   1   2       bld Gas7      in                          XZG6371.5p                                                                                                                                                                                                                           CCAAAAAAGGATCTCTATTTCTCACCCCCTACAGGGTGATCTTCCTAAGCAAGGGGAAGGACCCCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCTATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTTCTGGTAACAGGNTGTTAGTAGTAATACATTTTAAAAGTGTGTACAGCTATTTATGTAAAACAGC
  5   1   2       bld AbdN                               IMAGE:7025170                                                                                                                                                                                                                                                                                          CCATGATGTCTTTTAATATGCCATTCTATCTGATGAAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATGTCTTGGCAGCTGGATGTCTTGATTTACATCCACCCTGGTGTAGCCCCTAAGAAACCCTGACCAGCTTGGATAACCATAGCCACCCAGGATGTGGACTTTCCTGGTTCCTGGGTAACAGGTTTGGTTAGTAGGTAATACNTTTTTTAAAAAAGTGTTGGTACAGGCTTATTTTTATGGTAAAAACAGGCAAGATTTAATT
  5   1   2       bld Brn3      in                         CAAK7051.5p                                                                                                                                                                                                                                                                                                                             AAAGGATGCTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTTAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATGTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTACTGGCAGTTTCTCTG
  5   1   2       bld Egg                            TEgg121b14.p1kSP6                                                                                                                                                                                                                                                                                                                                     CTCCATAGAACAGCCAGTGTTCTCTGCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGAATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGC
  3   1   2       bld Ski1      in                         CABJ3360.3p                                                                                                                                                                                                                                                                                                                                                              GCCAACTACATCAAGGGATCCATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTTCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTCAAAAA
  3   1   2       bld Ski1      in                         CABJ8817.3p                                                                                                                                                                                                                                                                                                                                                                                  CATCGGTGCTGAGCCTGAAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTTCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTC
  3   1   2       bld Egg  FL   in                    TEgg073e17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                   AAGGTGGCTGGGTGGGTCAGGCCTCTTTCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCTCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTTAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTTCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTCAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                         XZG48526.3p                                                                                                                                                                                                                                                                                                                                                                                                                              TCAAACTTACATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTTCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGAAAAAT
  5  -1   2       bld Tbd1      in                         CBXT3824.b1                                                                                                                                                                                                                                                                                                                                                                                                                                       CATTTAATAGTGGAGGTGCTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCTTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGAATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCAC
  3   1   2       bld Te5       in                         CAAO7484.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTATTGAATTTGGACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATGTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATT
  3   1   2       bld Gas7 PIPE in                          XZG4188.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAAGTCATGTTCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATGTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAAAAAACC
  3   1   2       bld Tbd1 5g3  in                        CBXT21265.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAAAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGAATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                      EC2BBA7BH06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAATGGCAACTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCTTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCCCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGAATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTT
  5   1   2       bld Tad5      in                         XZT31578.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTTCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTCAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAGGGCCTTNGATAAATTATGTCATGTNATATG
  3   1   2       bld Gas7 5g3  in                         XZG36788.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTGCTTCCAGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGAATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAGTCAAAAAC
  5   1   2       bld Gas7      in                           XZG453.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATGTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAA
  5   1   2       bld Brn3                                 CAAK1631.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAGCCCCTCCTGTCCCTCATGCCGTATATGGATACATTCCTGCACCAGGCGGGTACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATGTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAGTCAATGAGCAGTGTCCAATANATCCTATTCTTTAAAGGGCCTTGATTAAATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGTGCACAGTGAAGTAGTTGCTATCCA
  3   1   2       bld Te1  5g3  in                         CBWN5508.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCCTCCAGCTCCAGGAATATATTCAGCGCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGAATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAAAAAAAAAAAA
  5   1   2       bld Brn3      in                         CAAK8444.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCACCCCAACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATGTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAGGGCCTTGATTAAATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGTGCACAGTGAAGTAGTTGCTATCCATTTCCAACCCCTAAAATCTGTCGGCAAACAAAGTTCTTATAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCA
  3   1   2       bld Gas7      in                          XZG6371.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCATCAGGACCTTATCCATACGGACCCCCTGCTATGAATGGATATGGACCACCTCCAAATCCAGTGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTTCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTCAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTAAAAGGGAAAAAAAAAATTGAAAAAAAAAAAAAAAGG
  5   1   2       chi Abd0      in                       IMAGE:6999398                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTTATCCATACGGACCCCCTGCTATGAATGGATATGGGCCACCTCCAAATCCAATGGGATACCCCTATGCTCCACCACCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAAAACAACTAAACACAAATTCCTGAACCCCATGGCAACATAACCTTTTGTATGTTCTGGCCACCGGGAAGCCTTTAATTTACCCCCCCCCGGGGGAACCCCCTAAAAAACCCCTGAACACCTTTTGAAAACCCATACCCCCCAAAAGGGGGCCCCTCTGGGGCCCCGGGGAAAAAGGGGTTTTTAAAAAAAAAAAAACTTTTTAAAAAAAGGGGGGGGCGCCCCTTTTTTTTTTTTAAAAACAACCCAAAATATTTTTTTTTTTTTTTCCCTAAAAAAAGATTTTTTTTTTGGGGGGGGTTTTTCTCCAAAAAAAAAAAAAAAAAAAACCCCCCTCTAAAAAAAAAAAAAAGGAGGGGGGGGGGAAAAAAAAAATTTTTTTTTTTAGGGGGGGGTGGTTTTATT
  5   1   2       bld Te4       in                         CAAN8941.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAGGACCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATGTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAGGGCCTTGATTAAATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGTGCACAGTGAAGTAGTTGCTATCCATTTCCAACCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCATGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTC
  3   1   2       bld Gas7      in                           XZG453.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGCCCTGGTATGTATCCACCCCCTCCTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTTTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCTTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATGTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTACTGGCAGTTTCTCGGAGAATAAACNACAGAATCCTC
  5   1   2       bld Te1       in                        CBWN17051.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGAATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAAAAAAAAAAAAA
  3   1   2       bld Te1       in                        CBWN17051.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGAAATGAATCCCATGTACATGGCTCCTCCACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGAATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAAAAAAAAAAAAA
  3  -1   2       bld Ski1      in                         CABJ2182.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACCACCTTATCCTGGGCCCCCTTACAATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATGTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAGGGCCTTGATTAAATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGTGCACAGTGAAGTAGTTGCTATCCATTTCCAACCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCATGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTCCACAGGAGGCCTATACATGGCCATTTACTAGCAAGGATTATCCTTCATTTAAATGACAAGGAAATGCTNCAGTACTG
  5   1   2       bld Egg                            TEgg090c15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTATCGTGGGCCCTCTTTCCATGGAACCCCGGCACCTTCAACTCCGTCTGAGAGCTGGATGCTGGTATGCCTGAAAGCAGCCAAGGTGCGGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTGACAAGGACTACATGCCTATAGACCGGCCACCTCCATATGCTCCGACTGATGATAACAACAACAACTACACTCCACTTCCGGAGCCCACTGCAACATAACCTTTGTATGTCATGGCAGCATGGATGTCATGATTTACATGCACCTGGAGTAGCCCTAAAAGACCCTGAACAACTTGATAACCATATCACACAGATGTGACTTCGCTGGACGCGAGGGAACACTGGTGCTACATACTAATACATTTTACAAAGTGTGAACAGCGTATTTATGTACAAACAGCAGATTAATTTATTTCATCTATAAACTGGATTTACTGGGAGTTTCACTGAAAATAAACTAGCAGAATCCTTCACAATTAAAGTCAATGAGCAGAGTCCAATAAATCCTATTCTTTAACAGGGCCTTGATTAAATTATGTTCATGTATTATTGATAAGCCAAAGCTGGATGTTAAGTTGGCTTTGTGCACAGTGAAGTAGTTGCTATCCATTTCCAACCCCTAAAATCTGTCGGCAA
  3   1   2       bld TpA  5g3  in                   TTpA068e02.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGGAACCCCAGCACCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTTCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTCAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Ski1      in                         CABJ3920.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTTCAGCTCCCTCTGGGTGCATGGATGCTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTTCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTCAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAGGGCCTTGATTAAATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGCGCACAGTGAAGTAGTTGCTATCCATTTCCAAGCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCGTGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTCCACAGGAGGCCTATACATGGCCATTTACTAGCAAGGATTATCCTTCATTTAAATGACAAGGAAATGCTTAAGTACTGAGAAATGCTCCACCCCAGTTCGTATAATCACTAACCGCT
  5   1   2       bld Liv1      in                        CAAR12078.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGGTATGCCTGGAGGCAGCAAAGCTGCAGAAGCTGCATCCAGTGCGTATTATAATCCAGCCGACCCTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATGTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAGGGCCTTGATTAAATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGTGCACAGTGAAGTAGTTGCTATCCATTTCCAACCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCATGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTCCACAGGAGGCCTATACATGGCCATTTACTAGCAAGGATTATCCTTCATTTAAATGACAAGGAAATGCTCAAGTACTGAGAAGTG
  5   1   2       bld TbA       in                   TTbA070g20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCACAATGTCTACATGCCTATGGACCGTCCACCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATGTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAGGGCCTTGATTAAATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGTGCACAGTGAAGTAGTTGCTATCCATTTCCAACCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCATGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTCCACAGGAGGCCTATACATGGCCATTTACTAGCAAGGATTATCCTTCATTTAAATGACAAGGAAATGCTCAAGTACTGAGAAGTGCTCCACCCCAGTTCGTATAATCACTAACCGCTGACCCCAAGCAGACACTTTGCTAAAAAGCACAGTGCCGCTAANGACGGTCCATCTA
  3   1   2       bld HeRe 5g3  in                     EC2CAA21CE05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TACATGCATATGGACCGTCCACCTCCATATGCTCGGAGTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCATTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGCGTAGCCATAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATTTGACGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGAT
  5   1   2       bld Egg                            TEgg086m22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATGTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAGGGCCTTGATTAAATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGTGCACAGTGAAGTAGTTGCTATCCATTTCCAACCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCATGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTCCACAGGAGGCCTATACATGGCCATTTA
  5   1   2       bld Egg                            TEgg086n01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTCCATATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATGTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTACTGGCAGTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAGGGCCTTGATTAAATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGTGCACAGTGAAGTAGTTGCTATCCATTTCCAACCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCATGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTCC
  3   1   2       bld Tbd1 5g3  in                         CBXT5732.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGCTCCGACTGATGATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTCCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTTTTTGAGAATAAACTACAGAATCCTTCACAATTAAAAAAAAAAAAAGAAAAAAAAAAAAAAA
  5   1   2       bld Ski1      in                         CABJ5773.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAAGAAGAACAACTAAACACAAATTCCTGAGCCCACTGCAACATAGCCTTTGTATCTCTTGGCAGCTGGATGTCTTGATTTACATCCACCTGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTTCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTCAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAGGGCCTTGATTAAATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGCGCACAGTGAAGTAGTTGCTATCCATTTCCAAGCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCGTGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTCCACAGGAGGCCTATACATGGCCATTTACTAGCAAGGATTATCCTTCATTTAAATGACAAGGAAATGCTTAAGTACTGAGAAATGCTCCACCCCAGTTCGTATAATCACTAACCGCTGACCCCAACAGACACTTTGCTAAAAAGCACAGTGCCGCTAAGGATGGTCCATCTACAGAGTAGTAATTAGTTGCCAACATCTGTCGGCACAATACAGTGCATCTCTTTAAATATATAAC
  5   1   2       bld In63                            IMAGE:8959040.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGGATGTCTTGATTTACATCCACCTAGGTGTAGCCCTAAGAAACCCTGACCAGCTTGATAACCATAGCACCCAGATGTGACTTCCTGGTTCTGGTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTCAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAGGGCCTTGATTAAATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGCGCACAGTGAAGTAGTTGCTATCCATTTCCAAGCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCGTGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTCCACAGGAGGCCTATACATGGCCATTTACTAGCAAGGATTATCCTTCATTTAAATGACAAGGAAATGCTTAAGTACTGAGAAATGCTCCACCCCAGTTCGTATAATCACTAACCGCTGACCCCAACAGACACTTTGCTAAAAAGCACAGTGCCGCTAAAGGATGGTCCATCTACAGAGTAGTAATTAGTTGCCAACATCTGTCGGCACATACAGTGCATCTCTTTAAATATATAACCAAAAGGCAACACTATAAACAGAAACGCATATATAAAATTTTATTCCACATGCATTTAAATAATTATAACACTTTTGATCATTACATAATACCAATACAGCTGGATTAAGTCCACGTATGGGTGTACGTGTATTATGAACCCTCAGGGCAGCCAGCCATTTGGGGTGCTT
  5   1   2       bld Eye       in                         CCAX8970.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTAACAGGTTGTTAGTAGTAATACATTTTAAAAAGTGTGTACAGCTATTTATGTAAAACAGCAGATTAATTTATTTCATCTATAAACTGTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTAAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAGGGCCTTGATTAAATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGTGCACAGTGAAGTAGTTGCTATCCATTTCCAACCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCATGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTTCCACAGGAGGCCTATACATGGCCATTTACTAGCAAGGGATTATCCTTCATTTAAATGACAAGGAAATGCTCAAGTACTGAGAAGTGCTCCACCCCAGTTCGTATAATCACTAACCGCTGACCCCAAGC
  5   1   2       bld Hrt1      in                         CAAQ4658.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATAAACTGGTTTTTTACTGGCAGTTTCTCTGAGAATAAACTACAGAATCCTTCACAATTCAAGTCAATGAGCAGTGTCCAATAAATCCTATTCTTTAAAAGGGCCTTGATTAAATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGCGCACAGTGAAGTAGTTGCTATCCATTTCCAAGCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCGTGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTCCACAGGAGGCCTATACATGGCCATTTACTAGCAAGGATTATCCTTCATTTAAATGACAAGGAAATGCTTAAGTACTGAGAAATGCTCCACCCCAGTTCGTATAATCACTAACCGCTGACCCCAACAGACACTTTGCTAAAAAGCACAGTGCCGCTAAGGATGGTCCATCTACAGAGTAGTAATTAGTTGCCAACATCTGTCGGCACAATACAGTGCATCTCTTTAAATATATAACCAAAAGGCAACACTATAAACAGAAACGGCCATATATAANATTTTATTCACATGCAATTTAAATAAATTATAACACTTTTGAATCATTACCAATAATACCATTACAGCTGTGATTAAAGTCCCACGTAATTGTGTGGTACGGTGTATTATGACACCTCAAGGGGCAGCAGCCATTTTGTTGCTTCCTTGTAGCTGCATTGTCTTGACTAACTTATGTGTGCCCTTTGGAGAACT
  5   1   2       bld Ovi1      in                          CABI895.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTATGTTCATGTATTATTGTTAGGCCAAAGCTGGATGTTAAGTTGGCTTTGTGCACAGTGAAGTAGTTGCTATCCATTTCCAACCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCATGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTCCACAGGAGGCCTATACATGGCCATTTACTAGCAAGGATTATCCTTCATTTAAATGACAAGGAAATGCTCAAGTACTGAGAAGTGCTCCACCCCAGTTCGTATAATCACTAACCGCTGACCCCAAGCAGACACTTTGCTAAAAAGCACAGTGCCGCTAAGGACGGTCCATCTACAGAGTAGTAATTAGTTGCCAACATCTGTCGGCACAATACAGTGCATCTCTTTAAATATATAACCAAAAGGCAACACTATAAACAGAAACAGCCATATATAAAATTTTATTCACATGCAATTTAAATAAATTATAACACTTTTGAATCATTACCAATAATACCATTACAGCTGTGGTTAAAGTCCCACGTAATTGTTGCTTCCTTGTAGCTGCATTGTCTTGACTAATTTATGTGTGCCCTTGGAGGAACTTCAGCCTGTGATCTGGAAAATCCATACAATTGCAGCAAGCTCTATTTTTTACTTAACCACTTGTTTTTTTAATGGGATTAAAGCACACAGGCTGGTGTTCACCTGGGATTTACTTTCACTTTTTTAAAATGTGCAGAGAAAGAGACTAATTTATTGTGCTTTAAATTTAGCTTTTTCTCATTAGAAAAGCAAAGTCTTAACTTTTATA
  5   1   2       bld Ovi1      in                         CABI4528.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGGCCAAAGCTGGATGTTAAGTTGGCTTTGTGCACAGTGAAGTAGTTGCTATCCATTTCCAACCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCATGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTCCACAGGAGGCCTATACATGGCCATTTACTAGCAAGGATTATCCTTCATTTAAATGACAAGGAAATGCTCAAGTACTGAGAAGTGCTCCACCCCAGTTCGTATAATCACTAACCGCTGACCCCAAGCAGACACTTTGCTAAAAAGCACAGTGCCGCTAAGGACGGTCCATCTACAGAGTAGTAATTAGTTGCCAACATCTGTCGGCACAATACAGTGCATCTCTTTAAATATATAACCAAAAGGCAACACTATAAACAGAAACAGCCATATATAAAATTTTATTCACATGCAATTTAAATAAATTATAACACTTTTGAATCATTACCAATAATACCATTACAGCTGTGGTTAAAGTCCCACGTAATTGTTGCTTCCTTGTAGCTGCATTGTCTTGACTAATTTATGTGTGCCCTTGGAGGAACTTCAGCCTGTGATCTGGAAAATCCATACAATTGCAGCAAGCTCTATTTTTTACTTAACCACTTGTTTTTTTAATGGGATTAAAGCACACAGGCTGGTGTTCACCTGGGATTTACTTTCACTTTTTTAAAATGTGCAGAGAAAGAGACTAATTATTTGTGCTTTAAATTTAGCTTTTTCTCATTAGAAAAGCAAAGTCTTAACTTTTATACAGATATATGAGATCGATATTCATTCTCAA
  5   1   2       bld Ovi1      in                         CABI9482.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAGTTGGCTTTGTGCACAGTGAAGTAGTTGCTATCCATTTCCAACCCCTAAAATCTGTCGGCAAACAAAGGTTCTTATAAAAGATGGCAAATAGCTTTCTGCCTCATCACCTGACTGGTATTACCTGTCAAGCCTGGTCAGGTTTTACTTGGTCCCTTGCTATCATGTTATACATAGCCATCTTTGTGTCCATACCAGACTTTTCCACAGGAGGCCTATACATGGCCATTTACTAGCAAGGATTATCCTTCATTTAAATGACAAGGAAATGCTCAAGTACTGAGAAGTGCTCCACCCCAGTTCGTATAATCACTAACCGCTGACCCCAAGCAGACACTTTGCTAAAAAGCACAGTGCCGCTAAGGACGGTCCATCTACAGAGTAGTAATTAGTTGCCAACATCTGTCGGCACAATACAGTGCATCTCTTTAAATATATAACCAAAAGGCAACACTATAAACAGAAACAGCCATATATAAAATTTTATTCACATGCAATTTAAATAAATTATAACACTTTTGAATCATTACCAATAATACCATTACAGCTGTGGTTAAAGTCCCACGTAATTGTTGCTTCCTTGTAGCTGCATTGTCTTGACTAATTTATGTGTGCCCTTGGAGGAACTTCAGCCTGTGATCTGGAAAATCCATACAATTGCAGCAAGCTCTATTTTTTACTTAACCACTTGTTTTTTTAATGGGATTAAAGCACACAGGCTGGTGTTCACCTGGGATTTACTTTCACTTTTTTAAAATGTGCAGAGAAAGAGACTAATTATTTGTGCTTTAAATTTAGCTTTTTCTCATTAGAAAAGCAAAGTCTTAACTTTTATACAGATATATGAGATCGATATTCATTCTCAAAGCATTGTGGAATTTAT
  5   1   2       bld Lun1                                 CABD5887.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAAATGCTCCACCCCAGTTCGTATAATCACTAACCGCTGACCCCAACAGACACTTTGCTAAAAAGCACAGTGCCGCTAAGGATGGTCCATCTACAGAGTAGTAATTAGTTGCCAACATCTGTCGGCACAATACAGTGCATCTCTTTAAATATATAACCAAAAGGCAACACTATAAACAGAAACGGCCATATATAAAATTTTATTCACATGCAATTTAAATAAATTATAACACTTTTGAATCATTACCAATAATACCATTACAGCTGTGATTAAAGTCCCACGTAATTGTGTGGTACGGTGTATTATGACACCTCAAGGGGCAGCAGCCATTTTGTTGCTTCCTTGTAGCTGCATTGTCTTGACTAACTTATGTGTGCCCTTGGAGGAACTTCAGCCTGTGATCTGGAAAATCCATACAATTGCAGCAAGCTCTATTTTTTACTTAACCACTTGTTTTTTTAATGGGATTAAAGCACACAGGCTGGTGTTCACCTGGGATTTACTTTCACTTTTAAAATGTGCAGAGAAAGAGACTAATTATTTGTGCTTTAAATTTAGCTTTTTCTCATTAGAAAAGCAAAGTCTTAACTTTTATACAGATATATGACATCGATATTCATTCTCAAAGCATTGTGGAATTTATGTTTGCAAATTTCTAGCACACCATTATTTGTCTTGTACTGTATGTTTTCACACTGCTGTATTTACATGTATAGCTCTGCAGTGGCGGTGTGGAACCCTTACACACAGCAAATTATTAGGGATTGGCAACCCCTGGAGCAAGACTCCAACCCATGTTGCAAGACTACAGTGCATACCATCCCTCCTGCACTTGGCAAAGGGATGCTGGGAGTTTTAGTTCTTCACCATTG
  5   1   2       bld Neu0      in                       IMAGE:6992951                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCACAGACACTTTGCTAAAAAGCACAGTGCCGCTAAGGATGGTCCATCTACAGAGTAGTAATTAGTTGCCAACATCTGTCGGCACAATACAGTGCATCTCTTTAAATATATAACCAAAAGGCAACACTATAAACAGAAACGGCCATATATAAAATTTTATTCACATGCAATTTAAATAAATTATAACACTTTGAATCATTACCAATAATACCATTACAGCTGTGATTAAAGTCCCACGTAATTGTGTGGTACGGTGTATTATGACACCTCAAGGGGCAGCAGCCATTTTGTTGCTTCCTTGTAGCTGCATTGTCTTGACTAACTTATGTGTGCCCTTGGAGGAACTTCAGCCTGTGATCTGGAAAATCCATACAATTGCAGCAAGCTCTATTTTTTACTTAACCACTTGTTTTTTTAATGGGATTAAAGCACACAGGCTGGTGTTCACCTGGGATTTACTTTCACTTTTAAAATGTGCAGAGAAAGAGACTAATTATTTGTGCTTTAAATTTAGCTTTTTCTCATTAGAAAAGCAAAGTCTTAACTTTTATACAGATATATGACATCGATATTCATTCTCAAAGCATTGTGGAATTTATGTTTGCAAATTTCTAGCACACCATTATTTGTCTTGTACTGTATGTTTTCACACTGCTGTATTTACATGTATAGCTCTGCAGTGGCGGTGTGGAACCCTTACACACAGCAAATTATTAGGGATTGGCAACCCCTGGAGCAAGACTCCAACCCATGTTGCAAGACTACAGTGCATACCATCCCCTCCTGCACTTGGCAAAGGGATGCTGGGGAGTTTTAGTTCCTCACCATTGAGAGCCCCAGCTGTTTCAGAAAACTAAAG
  5   1   2       bld Eye       in                          CCAX998.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACTAACCGCTGACCCCAAGCAGACACTTTGCTAAAAAGCACAGTGCCGCTAAGGACGGTCCATCTACAGAGTAGTAATTAGTTGCCAACATCTGTCGGCACAATACAGTGCATCTCTTTAAATATATAACCAAAAGGCAACACTATAAACAGAAACAGCCATATATAAAATTTTATTCACATGCAATTTAAATAAATTATAACACTTTTGAATCATTACCAATAATACCATTACAGCTGTGGTTAAAGTCCCACGTAATTGTTGCTTCCTTGTAGCTGCATTGTCTTGACTAATTTATGTGTGCCCTTGGAGGAACTTCAGCCTGTGATCTGGAAAATCCATACAATTGCAGCAAGCTCTATTTTTTACTTAACCACTTGTTTTTTTAATGGGATTAAAGCACACAGGCTGGTGTTCACCTGGGATTTACTTTCACTTTTTTAAAATGTGCAGAGAAAGAGACTAATTATTTGTGCTTTAAATTTAGCTTTTTCTCATTAGAAAAGCAAAGTCTTAACTTTTATACAGATATATGAGATCGATATTCATTCTCAAAGCATTGTGGAATTTATGTTTGCAAATTTCTAGCACACCATTATTTGTCTTGTACTGTATGTTTTCACACTGCTGTATTTACATGTATAGCTCTGCAGTGGCGGTGTGGAACCCTTACACACAGCAAATTATTAGGGATAGGCAACCCCTGGAGCAAGACTCCC
  5   1   2       bld Eye       in                         CCAX1540.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGCATCTCTTTAAATATATAACCAAAAGGCAACACTATAAACAGAAACGGCCATATATAAAATTTTATTCACATGCAATTTAAATAAATTATAACACTTTTGAATCATTACCAATAATACCATTACAGCTGTGATTAAAGTCCCACGTAATTGTGTGGTACGGTGTATTATGACACCTCAAGGGGCAGCAGCCATTTTGTTGCTTCCTTGTAGCTGCATTGTCTTGACTAACTTATGTGTGCCCTTGGAGGAACTTCAGCCTGTGATCTGGAAAATCCATACAATTGCAGCAAGCTCTATTTTTTACTTAACCACTTGTTTTTTTAATGGGATTAAAGCACACAGGCTGGTGTTCACCTGGGGATTTACTTTCACTTTTAAAATGTGCAGAGAAAGAGACTAATTATTTGTGCTTTAAATTTAGCTTTTTCTCATTAGAAAAGCAAAGTCTTAACTTTTATACAGATATATGACATCGATATTCATTCTCAAAGCATTGTGGAATTTATGTTTGCAAATTTCTAGCACACCATTATTTGTCTTGTACTGTATGTTTTCACACTGCTGTATTTACATGTATAGCTCTGCAGTGGCGGTGTGGAACCCTTACACACAGCAAATTATTAGGGATTGGCAACCCCTGGAGCAAGACTCCCACCCATGTTGCAGACTACAGTGCATACCATCCCTCCTGCACTTGGCAAAGGGATGCTGGGAGTTTTAGTTCTTCACCATTGAGAGCCCCAGCTGTTCCAGAAAACTAAAGGGGTTATGT
  5   1   2       bld AbdN                               IMAGE:7006185                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGTGGTTAAAGTCCCACGTAATTGTTGCTTCCTTGTAGCTGCATTGTCTTGACTAATTTATGTGTGCCCTTGGAGGAACTTCAGCCTGTGATCTGGAAAATCCATACAATTGCAGCAAGCTCTATTTTTTACTTAACCACTTGTTTTTTTAATGGGATTAAAGCACACAGGCTGGTGTTCACCTGGGATTTACTTTCACTTTTTTAAAATGTGCAGAGAAAGAGACTAATTATTTGTGCTTTAAATTTAGCTTTTTCTCATTAGAAAAGCAAAGTCTTAACTTTTATACAGATATATGAGATCGATATTCATTCTCAAAGCATTGTGGAATTTATGTTTGCAAATTTCTAGCACACCATTATTTGTCTTGTACTGTATGTTTTCACACTGCTGTATTTACATGTATAGCTCTGCAGTGGCGGTGTGGAACCCTTACACACAGCAAATTATTAGGGATAGGCAACCCCTGGAGCAAGACTCCAACCCATGTTGCAAGACTACAGTGCATACCATCCCTCCTGCACTTGGCAAAGGGATGCTGGGAGTTTTAGTTCTTCACCATTGAGAGCCCCAGCTGTTCCAGAAAACTAAAGGGGTTATGTTATAAAAGGCAATATGTTTGCCCAGGAGAAGTACCCAGCTTAAGAAAAACATCTTAATAGTTGCTATAAGTTACTGCTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTTTAGCAAACTGGTATTAATGGCATGGTTCTGAGGGGGTAGTGGGAACTACATTTCAGCAAGTCTAAAGGAAAGATAACCAAAACCACCTTTTACAAACACACCTTTTCCTCCCTAATGAAGGAATAGCTGGTT
  3  -1   2       bld Int1      in                         CAAP5785.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTTAAAGTCCCACGTAATTGTTGCTTCCTTGTAGCTGCATTGTCTTGACTAATTTATGTGTGCCCTTGGAGGAACTTCAGCCTGTGATCTGGAAAATCCATACAATTGCAGCAAGCTCTATTTTTTACTTAACCACTTGTTTTTTTAATGGGATTAAAGCACACAGGCTGGTGTTCACCTGGGATTTACTTTCACTTTTTTAAAATGTGCAGAGAAAGAGACTAATTATTTGTGCTTTAAATTTAGCTTTTTCTCATTAGAAAAGCAAAGTCTTAACTTTTATACAGATATATGAGATCGATATTCATTCTCAAAGCATTGTGGAATTTATGTTTGCAAATTTCTAGCACACCATTATTTGTCTTGTACTGTATGTTTTCACACTGCTGTATTTACATGTATAGCTCTGCAGTGGCGGTGTGGAACCCTTACACACAGCAAATTATTAGGGATAGGCAACCCCTGGAGCAAGACTCCAACCCATGTTGCAAGACTACAGTGCATACCATCCCTCCTGCACTTGGCAAAGGGATGCTGGGAGTTTTAGTTCTTCACCATTGAGAGCTCCAGCTGTTCCAGAAAACTAAAGGGGTTATGTTATAAAAGGCAATATGTTTGCCCAGGAGAAGTAACCCAGCTTAAGAAAAAACATCTTAATAGTTGCTATAAGTTACTGCTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTTAGCANAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAA
  5   1   2       bld Ovi1      in                         CABI6432.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATTGCAGCAAGTTTTATTTTTTACTTAACCACTTGTTTTTTTAATGGGATTAAAGCACACAGGCTGGTGTTCACCTGGGATTTACTTTCACTTTTTTAAAATGTGCAGAGAAAGAGACTAATTATTTGTGCTTTAAATTTAGCTTTTTCTCATTAGAAAAGCAAAGTCTTAACTTTTATACAGATATATGAGATCGATATTCATTCTCAAAGCATTGTGGAATTTATGTTTGCAAATTTCTAGCACACCATTATTTGTCTTGTACTGTATGTTTTCACACTGCTGTATTTACATGTATAGCTCTGCAGTGGCGGTGTGGAACCCTTACACACAGCAAATTATTAGGGATAGGCAACCCCTGGAGCAAGACTCCAACCCATGTTGCAAGACTACAGTGCATACCATCCCTCCTGCACTTGGCAAAGGGATGCTGGGAGTTTTAGTTCTTCACCATTGAGAGCCCCAGCTGTTCCAGAAAACTAAAGGGGTTATGTTATAAAAGGCAATATGTTTGCCCAGGAGAAGTAACCCAGCTTAAGAAAAAAACATCTTAATAGTTGCTATAAGTTACTGCTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTTAGCAAAACTGGTATTAATGGCATGTTTCTGGAGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTC
  5   1   2       bld AbdN                               IMAGE:7006121                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTATTTTTTACTTAACCACTTGTTTTTTTTAATGGGATTAAAGCACACAGGCTGGTGTTCACCTGGGATTTACTTTCACTTTTTTAAAATGTGCAGAGAAAGAGACTAATTATTTGTGCTTTAAATTTAGCTTTTTCTCATTAGAAAAGCAAAGTCTTAACTTTTATACAGATATATGAGATCGATATTCATTCTCAAAGCATTGTGGAATTTATGTTTGCAAATTTCTAGCACACCATTATTTGTCTTGTACTGTATGTTTTCACACTGCTGTATTTACATGTATAGCTCTGCAGTGGCGGTGTGGAACCCTTACACACAGCAAATTATTAGGGATAGGCAACCCCTGGAGCAAGACTCCAACCCATGTTGCAAGACTACAGTGCATACCATCCCTCCTGCACTTGGCAAAGGGATGCTGGGAGTTTTAGTTCTTCACCATTGAGAGCCCCAGCTGTTCCAGAAAACTAAAGGGGTTATGTTATAAAAGGCAATATGTTTGCCCAGGAGAAGTAACCCAGCTTAAGAAAAAACATCTTAATAGTTGCTATAAGTTACTGCTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTTAGCAAAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTTAAGTTTACCCGCACCTTGCCANTATGTTAATTTAATACCACCGAAGCCTGGGCTGAAATGGGTC
  5   1   2       bld Lun1                                 CABD6057.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTCTCATTAGAAAAGCAAAGTCTTAACTTTTATACAGATATATGAGATCGATATTCATTCTCAAAGCATTGTGGAATTTATGTTTGCAAATTTCTAGCACACCATTATTTGTCTTGTACTGTATGTTTTCACACTGCTGTATTTACATGTATAGCTCTGCAGTGGCGGTGTGGAACCCTTACACACAGCAAATTATTAGGGATAGGCAACCCCTGGAGCAAGACTCCAACCCATGTTGCAAGACTACAGTGCATACCATCCCTCCTGCACTTGGCAAAGGGATGCTGGGAGTTTTAGTTCTTCACCATTGAGAGCCCCAGCTGTTCCAGAAAACTAAAGGGGTTATGTTATAAAAGGCAATATGTTTGCCCAGGAGAAGTAACCCAGCTTAAGAAAAAACATCTTAATAGTTGCTATAAGTTACTGCTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTTAGCAAAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTTATATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAAGTTTATTTCTCTAGGTCTGTAAATGC
  5   1   2       bld Tad0                               IMAGE:6981950                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTTAACTTTTATACAGATATATGACATCGATATTCATTCTCAAAGCATTGTGGAATTTATGTTTGCAAATTTCTAGCACACCATTATTTGTCTTGTACTGTATGTTTTCACACTGCTGTATTTACATGTATAGCTCTGCAGTGGCGGTGTGGAACCCTTACACACAGCAAATTATTAGGGATTGGCAACCCCTGGAGCAAGACTCCAACCCATGTTGCAAGACTACAGTGCATACCATCCCTCCTGCACTTGGCAAAGGGATGCTGGGAGTTTTAGTTCTTCACCATTGAGAGCCCCAGCTGTTCCAGAAAACTAAAGGGGTTATGTTATAAAAGGCAATACGTTTGCCCAGGAGAAGTAACCCAGTTTAAGAAAAAACATCTTAATAGTTGCTATTAGTTACTGCTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTCAGCAAAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGTAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCCCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATCAGCTTGAGACTCTGGCTGATCTTCATCCCTAGAGTCCTTTAGCTNGTGCTGAAN
  5   1   2       bld TpA       in                   TTpA016d16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATATATGAGATCGATATTCATTCTCAAAGCATTGTGGAATTTATGTTTGCAAATTTCTAGCACACCATTATTTGTCTTGTACTGTATGTTTTCACACTGCTGTATTTACATGTATAGCTCTGCAGTGGCGGTGTGGAACCCTTACACACAGCAAATTATTAGGGATAGGCAACCCCTGGAGCAAGACTCCAACCCATGTTGCAAGACTACAGTGCATACCATCCCTCCTGCACTTGGCAAAGGGATGCTGGGAGTTTTAGTTCTTCACCATTGAGAGCCCCAGCTGTTCCAGAAAACTAAAGGGGTTATGTTATAAAAGGCAATATGTTTGCCCAGGAGAAGTAACCCAGCTTAAGAAAAAACATCTTAATAGTTGCTATAAGTTACTGCTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTTAGCAAAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTC
  5   1   2       bld TbA       in                   TTbA027e08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGTGGAACCCTTACACACAGCAAATTATTAGGGATAGGCAACCCCTGGAGCAAGACTCCAACCCATGTTGCAAGACTACAGTGCATACCATCCCTCCTGCACTTGGCAAAGGGATGCTGGGAGTTTTAGTTCTTCACCATTGAGAGCCCCAGCTGTTCCAGAAAACTAAAGGGGTTATGTTATAAAAGGCAATATGTTTGCCCAGGAGAAGTAACCCAGCTTAAGAAAAAACATCTTAATAGTTGCTATAAGTTACTGCTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTTAGCAAAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTAT
  5   1   2       bld Tad5      in                         XZT16190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGGAACCCTTACACACAGCAAATTATTAGGGATAGGCAACCCCTGGAGCAAGACTCCAACCCATGTTGCAAGACTACAGTGCATACCATCCCTCCTGCACTTGGCAAAGGGATGCTGGGAGTTTTAGTTCTTCACCATTGAGAGCTCCAGCTGTTCCAGAAAACTAAAGGGGTTATGTTATAAAAGGCAATATGTTTGCCCAGGAGAAGTAACCCAGCTTAAGAAAAAACATCTTAATAGTTGCTATAAGTTACTGCTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTTAGCAAAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGNTATTAAATATGTAATCCCCTCCTACCATG
  5   1   2       bld AbdN                               IMAGE:7023986                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCTTACACACAGCAAATTATTAGGGATAGGCAACCCCTAGGAGCAAGACTCCAACCCATGTTGCAAGACTACAGTGCATACCATCCCTCCTGCACTTGGCAAAGGGATGCTGGGAGTTTTAGTTCTTCACCATTGAGAGCCCCAGCTGTTCCAGAAAACTAAAGGGGTTATGTTATAAAAGGCAATATGTTTGCCCAGGAGAAGTAACCCAGCTTAAGAAAAAACATCTTAATAGTTGCTATAAGTTACTGCTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTTAGCAAAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTGTGTTATTATAGCATCTAGAATATTCCAACAACAACCTGGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAAGCACGGGGTTATTAAATATGTAATCNCCTCCTACCATGGTCCTTGGGCGTGTATTCTGGGAAAGCAAGGTATGAATTTGTGTAGATATGTGGAGAAAATGGTGCGACATTG
  5   1   2       bld Brn4      in                        CAAL20741.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAAAGGGATGCTGGGAGTTTTAGTTCTTCACCATTGAGAGCTCCAGCTGTTCCAGAAAACTAAAGGGGTTATGTTATAAAAGGCAATATGTTTGCCCAGGAGAAGTAACCCAGCTTAAGAAAAAACATCTTAATAGTTGCTATAAGTTACTGCTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTTAGCAAAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATAT
  5   1   2       bld Tad0                               IMAGE:6984539                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATCAGAAAACTAAAGGGGTTATGTTATAAAAGGCAATACGTTTGCCCAGGAGAAGTAACCCAGTTTAAGAAAAAACATCTTAATAGTTGCTATTAGTTACTGCTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTCAGCAAAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGTAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCCCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAGTACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACTAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACATGGTTAATAAATATGTAATCTCTCCCTACATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTTATGAATTGTGTAGATATGTGAAAGAATGTGCAGACATTGATTACATTATTCTGTTTACTGGGCACTGTCTGTACAGATTTAGGAAGAAATACTATATTCGGGGAACCTTTGATATATGAATGTGGCCTTTACCTCTCAG
  5  -1   2       bld Int1      in                         CAAP5785.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAACATCTTAATAGTTGCTATAAGTTACTGCTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTTAGCAAAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTC
  5   1   2       bld Ovi1      in                         CABI1612.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTACCGAGCAAACTTAGTTATTTTTATTACATATTGGTGTAGGACTTTTTACTTTGCAGTTCATCCAGTCAGCAAAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGTAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCCCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAGTACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACTAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACATGGTTAATAAATATGTAATCTCTCCTACCATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTCTGTTTACTGGGCACTGTCTGTTACAGATATATGGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGNGGAGAGCTCTGGTTTTACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTA
  3   1   2       bld Neu0      in                       IMAGE:6992951                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              NGACTTTTACTTTGCAGTTCATCCAGTCAGCAAAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGGCAAGTCTAAAGGAAGGATAACCAAAACACCCTTTTTACAAACCACACCTTTCCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGTAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCCCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAGTACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACTAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACATGGTTAATAAATATGTAATCTCTCCTACCATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTCTGTTTACTGGGCACTGTCTGTTACAGATATATGGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCCGGTA
  3  -1   2       bld Ovi1      in                         CABI3920.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGACTTTTTACTTTGCAGTTCATCCAGTTAGCAAAACTGGTATTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGG
  3   1   2       bld Abd0 5g3  in                       IMAGE:7003130                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGCCATGTTTTTGAGGGGGTAGTGGGGACTTACATTTCAGCAAGTTTAAAGGAAAGGATACCCAAAACCCCTTTTACAAACCACACCTTTCCTCTTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCGG
  3   1   2       bld Ovi1      in                         CABI9482.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAATGGCATGTTTCTGAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTT
  3   1   2       bld Ski1      in                         CABJ5773.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGGGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGTAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCCCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAGTACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACTAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACATGGTTAATAAATATGTAATCTCTCCTACCATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTCTGTTTACTGGGCACTGTCTGTTACAGATATATGGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACT
  3   1   2       bld Ovi1      in                         CABI6432.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGTAGTGGGACTTACATTTCAGCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACT
  3   1   2       bld Ovi1      in                          CABI895.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCAGCCAGTCTAAAGGAAGGATANCCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTNTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACC
  3   1   2      seed Brn3 5g3  in                         CAAK7282.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAAGTCTAAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACT
  3   1   2       bld Mus1 5x3  out                        CABH7139.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACC
  3   1   2       bld TbA       in                    TTbA027e08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGAAGGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTACTAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Brn3      in                         CAAK7051.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAGGATACCCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACT
  5  -1   2       bld Ski1      in                         CABJ2182.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGATAACCAAAACACCTTTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGNTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTA
  3   1   2       bld Brn3      in                         CAAK8444.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTACAAACCACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACT
  3   1   2       bld Ovi1      in                         CABI4528.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTACAACACACCCTTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGNTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACC
  5  -1   2       bld In63                            IMAGE:8961972.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCAGCCAGTTAAAGAGGATACCAACCCTTGCAAGCACACCTTCTCTATGAGATAGCTGTAGAATCTTGGAGAGTTAGTGAGCAGAAGCTTAGAGTAGTACCCCCCCTGCATATGTAATATACACAGAGCTGCTGAATGGTCTGTGAATGCATACTTTTTCCAAATATCAGCTGAGGACTCTGGCTGATCTCATCCTAGAGGTCCTTTAGCTGTGCTGAAGCAGACATCCTTATACCCTCTAGTACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACTAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACATGGTTAATAAATATGTAATCTCTCCTACCATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTCTGTTTACTGGGCACTGTCTGTTACAGATATATGGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACTAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Liv1      in                        CAAR12723.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACACCTTTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGTAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCCCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAGTACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACTAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACATGGTTAATAAATATGTAATCTCTCCTACCATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTCTGTTTACTGGGCACTGTCTGTTACAGATATATGGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACC
  3   1   2       bld Liv1      in                        CAAR12078.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTGNAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACC
  3   1   2       bld Brn3 5g3  in                         CAAK3679.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAGTTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTACTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTCGTAATTAAAATAAATATAGTCTTTAACT
  3   1   2       bld Fat1 5g3  in                         CABC5435.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGNTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACCAAA
  3   1   2       bld Brn3 5g3  in                        CAAK10815.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACT
  3   1   2       bld Liv1      out                       CAAR11243.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACT
  5  -1   2       bld Ovi1      in                         CABI3920.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGNTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTA
  3   1   2       bld Ovi1      in                         CABI1612.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCTAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGTAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCCCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAGTACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACTAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACATGGTTAATAAATATGTAATCTCTCCTACCATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTCTGTTTACTGGGCACTGTCTGTTACAGATATATGGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACG
  3   1   2       bld TpA       in                    TTpA016d16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn3 5g3  in                         CAAK7277.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACT
  3   1   2       bld Te4       in                         CAAN8941.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACT
  3   1   2       bld Liv1      in                         CAAR5137.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGGAGGATAGCTGGTTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACC
  3   1   2       bld TpA                             TTpA065e03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTATTCCTGTTAAATTAAAGGATTTGTAATTAAAATAAATATAGTCTTTACTAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT16190.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTGNAGCAGAAGCTTTAGAGTTNAAGTTACCGCACCTTGCAATATGTAATTATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACT
  3   1   2       bld Egg  5g3  in                    TEgg036a07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGANTTTGTAATTANAAATAAATATAGTCTTTACTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG65862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGGATAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCACTACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGATATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTAATAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAANAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAAC
  3   1   2       bld Brn4      in                        CAAL20741.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGCTGGTTATGAATCTTGTGAGATGCAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTT
  3   1   2       bld Ski1      in                         CABJ3920.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTATGAATCTTGTGAGATGTAGTTGAGCAGAAGCTTTAGAGTTTAAGTTACCCCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAGTACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACTAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACATGGTTAATAAATATGTAATCTCTCCTACCATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTCTGTTTACTGGGCACTGTCTGTTACAGATATATGGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTTTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTACCT
  3   1   2       bld Egg  5g3  in                    TEgg037p24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGATGCAGTGAGCAGAGCTTTAGAGTTAAGTTACCGCACCTTGCAATATGTAATTATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACTAAAAAAAAAAAAAAAAAA
  3   1   2       chi Abd0      in                       IMAGE:6999398                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCCTAATATAATTAAACACACCCCCGGGGGAGAATTTTTTTAAAAAAAAATTTTTTTTTAAAAAAATTTCGCGGGGGGACATTTTGGGGGTTTTTTTTTTTCCGGGGGGGGCCTCTTTTAGGGGGGGGGAGAAGGGAAAAACCCCTTTTAACCCCCTTTAAAAAAACCACCCAAGGGTGTTTTTTTTTAAAGGCCCCTGGGAAAATTCCCCCCCACCCCCCTGGGGGGGCAAAAGGGTTTTTTTTTTTGGGGTTGGAAAAAGGGGGGGAAGCCTTCCCTTTCCGAGCCCCGGGGGTTATTAAAATATGTAATTCCCTCCTACCCAGGTCCTTGGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGAT
  5   1   2       bld Thy1      in                        CBST6313.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAAGCTTTAAAGATTAAGTTACCGCACCTTGCAATATGTAATTAATACACACAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCCAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTATAGGTCCTTTACCTGTTGCTGAACCACACATCCTTATACCCTCTAATACACATTCAGATTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAAGTCTGAAAATGCAGAATACCATTGCATTCCAAGCCACGTGGTAATTAAATATGTAATCCCTCCTACCATGTGCCTTGGGCGTGTATTCT
  3   1   2       bld Tad5                                 XZT57624.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTAAGTTACCGCACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACT
  3   1   2       bld Te1  5g3  in                         CBWN2880.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCTTGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGCGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGCCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACTAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCATGTGGTTAATAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAAGGTGCAGACATTGATTAACATTATTCTGTTTACTGGGCACTGTCTGTTACAGATATATGGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCCATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACTAAAAAAAAAAAAAAA
  5   1   2       bld Sto1      in                        CABG10256.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATANCTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Sto1      in                        CABG10256.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACCGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACT
  3   1   2       bld Hrt1      in                         CAAQ4658.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAGTACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACTAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACATGGTTAATAAATATGTAATCTCTCCTACCATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTCTGTTTACTGGGCACTGTCTGTTACAGATATATGGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACT
  3   1   2       bld Tad5      in                         XZT31578.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAATATGTAATTAATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAGTACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACTAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACATGGTTAATAAATATGTAATCTCTCCTACCATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTCTGTTTACTGGGCACTGTCTGTTACAGATATATGGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTT
  3   1   2       bld Egg  5g3  in                    TEgg037o23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATTATACACAGAGCTGGCTGAATGGTCTGTGAATGCATACTTTTTTCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Eye       in                          CCAX998.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCAAATTATTCAGCTTGAGACTCTCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACTA
  3   1   2       bld Gas7      in                         XZG65862.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTCTGGCTGATCTTCATCATAGAGGTCCTTTTAGCTGTTGCTGAAGCAGATATCCTTATACCCTCTAAAACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTAATAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTTTGTGCCAGGGTCTCCCAGGAAGAACTGCCCTTCTGATCTTTACCTGGAATATCATTTTATGGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTCCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTACCTTAAAAAAAAAAAAAAAAAAAAAAAAAAATCAT
  3   1   2       bld Eye       in                         CCAX8970.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTGGCTGATCTTCATCCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACTA
  3   1   2       bld Thy1      in                        CBST6313.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTAGAGGTCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATTCACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGACTTGTGTAGATATGTGAAGAAATGTGCAGACATTGCTTAACATTTTTTTGTTTATCGGGCACTGTCCGTTACAGATATATAGAAGAAATATCTATATTTCGGGTGATCTTTTTGATTATCTGAAATGTGTGCACTTTAACCTCT
  3   1   2       bld TbA       in                    TTbA070g20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCTTTAGCTGTTGCTGAAGCAGACATCCTTATACCCTCTAATACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACTAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas7      in                         XZG53533.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACGCGTCCGCTTATACCCTCTAGTACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACTAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACATGGTTAATAAATATGTAATCTCTCCTACCATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTCTGTTTACTGGGCACTGTCTGTTACAGATATATGGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTT
  5   1   2       bld Gas7      in                         XZG53533.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTATACCCTCTAGTACACATTCAGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACTAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACATGGTTAATAAATATGTAATCTCTCCTACCATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTCTGTTTACTGGGCACTGTCTGTTACAGATATATGGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAAAAAAAAAAAAAAAAAAGG
  5   1   2       bld Brn3      in                         CAAK6269.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          NNCGTCCGGTTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACTAAAAAAAAAAAAAAA
  3   1   2       bld Brn3      in                         CAAK6269.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGTTATTATAGCATCTAGAATATTCCAGCAACAGCCTGGGGCACAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATCTTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATCTGTAATTAAAATAAATATAGTCTTTAACT
  5   1   2       bld Egg                            TEgg124c09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCATCTAGAATATTCCAGCAACAGCCTGGGGCACTAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACATGGTTAATAAATATGTAATCTCTCCTACCATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTCTGTTTACTGGGCACTGTCTGTTACAGATATATGGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACT
  3   1   2       bld Te4       in                         CAAN1233.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACT
  5   1   2       bld Te4       in                         CAAN1233.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAAGGTTTATTTCTCTAGGTCTGTAAATGCTGAGTAGCATTGCATTCCGAGCCACGTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACTAAAAAAAAAAAAAAA
  3   1   2       bld Sto1      in                         CABG4418.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTAAATGCTGAGTAGCATTGCATTCCGAGCCACATGGTTAATAAATATGTAATCTCTCCTACCATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTCTGTTTACTGGGCACTGTCTGTTACAGATATATGGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACC
  5   1   2       bld Sto1      in                         CABG4418.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTAAATGCTGAGTAGCATTGCATTCCGAGCCACATGGTTAATAAATATGTAATCTCTCCTACCATGTCCTTGGGCGTGTATGCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTCTGTTTACTGGGCACTGTCTGTTACAGATATATGGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Hrt1      in                         CAAQ7737.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGGGGAGCCCCGGGGTTTTTAAATATGTAATCCCCCCTCCCCTGTCCTTGGGGGGGTTTTCTGGAAAGCAAGTAATGAATTGTGTAGATATGGGAAGAAATGTGCCGCCCTTGTTTACCCTTTTTTTGTTTTCTGGGCCCTTTTTTTTTCGGATATTTAGAAGAAATATCTTTTTTTTGGGGGATCTTTTTGATTATATGAAAGGGGGGCCCTTTAACCTCTCCGAAGGCTTGGGGAGAGCTTTGGTTTTAACCAATTTTGTGCCCGGGTTTCCCCGGAAGAACTGCCCTTTTGATTTTTCCCGGGAATATCCTTTTTTTGGGGGCCTTCCAAAAAAACCGTTCTAGAAAAACTTTGTTTAATTTGGGTTTGTGGGTTGGTTTTCCCGTGCTTTGTAAAAACCCTGGGGGGAAATTTAGATCTTTTAGTTTTTTCCCGTTAAATTGGGGGGTTTGTAATTAAAATAAATTTGGTTTTTAACT
  5   1   2       bld Hrt1      in                         CAAQ7737.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCCACGCTGGTTATTAAATATGTAATCCCTCCTACCATGTCCTTGGGCGTGTATTCAGGAAAGCAAGTAATGAATTGTGTAGATATGTGAAGAAATGTGCAGACATTGATTAACATTATTTTGTTTACTGGGCACTGTCTGTTACAGATATATAGAAGAAATATCTATATTTTGGGTGATCTTTTTGATTATATGAAATGTGTGCACTTTAACCTCTCCGAAGGCTTGGAGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGAGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTATTGGATGCATTCCAAAAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACTaanaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaNC
  3   1   2       bld Eye       in                         CCAX1540.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTATATGAAATGTGTGCACTTTAACCTTTCCGAAGGCTTGGGGAGAGCTCTGGTTTTAACCAATTCTGTGCCAGGGTCTCCCAGGAAGAACTGACCTTCTGATCTTTACCTGGAATATCATTTTCTTGGATGCATTCCAACAAAACCGTTCTAGAAATACTTTGTTTAATCTGTGTTTGTAGGTTGGTTTTGCCGTGCTTTGTAAAAACGCTAGAGTGAAATTTAGATCTTTTAGTTTATTCCTGTTAAATTTGAGGATTTGTAATTAAAATAAATATAGTCTTTAACTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)