Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-CABK2651.3                           18 END     1           1        5                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 191.0    0Xt7.1-CABE10559.5                          10 PI      74        200      605                novel protein similar to cpsf4 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 93%

 1012071541 Xt7.1-TGas086k13.3.5 - 85 ESTs
                                                                       ...-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TGas086k13.3.5                                                                                                                                                                                                                                                                                                                                                                  TCTTTCCCAGAGTGCCCTGCTCTAGGTTGAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATAAAAAAAAAA
                                                  Xt7.1-CHK-1008223710                                                                                                                                                                                                                                                                                                                                                                        CCAGAGTGCCCTGCTCTAGGTTGAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATxAxxAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                       2     3     2     3     5     7     8     9    13    15    16    18    19    22    22    27    24    29    27    32    28    33    29    35    30    35    30    35    31    36    32    37    32    37    32    37    34    37    36    37    36    37    36    37    36    37    37    38    39    39    38    38    39    40    39    40    40    40    37    40    40    41    40    41    40    41    40    42    41    42    42    43    44    47    48    49    48    49    49    50    53    54    53    54    53    54    52    53    53    54    56    58    59    60    59    60    58    59    60    62    60    62    60    62    61    63    61    62    60    63    62    62    61    64    62    62    57    61    60    60    57    58    57    58    55    57    55    57    57    58    57    58    58    58    58    60    55    60    55    60    55    60    56    60    57    61    56    61    55    59    52    56    53    56    51    52    48    51    49    51    48    50    48    48    47    48    45    48    46    47    45    47    45    47    43    44    42    44    42    44    41    43    42    43    41    42    41    42    41    41    37    40    34    39    37    37    36    37    34    36    34    36    34    36    33    34    33    33    28    33     5    11
  5   1   2  SIG                                       Xt7.1-XZG3517.3                                                                                                                                                                                                                                                                                                                                          GAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAGTGAGTACCGGGGCCTGATCCCTCCCATTACCGGGGTGGGCTTTTAAACCGGAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TGas086k13.3                                                                                                                                                                                                                                                                                                                                                                 TTCTTTCCCAGAGTGCCCTGCTCTAGGTTGAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAGTGAGTACCGGGGCCTGATCCCTCCCATTACCGGGGTGGGCTTTTAAACC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GG----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --A---------
                                               BLH ATG     115     725                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN     112     141                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH OVR     115      23                                                                                                                                                                                                                                                                                                                                                                  
                                               CDS MIN     115      11                                                                                                                                                                                                                                                                                                                                                                  
                                               EST CLI      48      11                                                                                                                                                                                                                                                                                                                                                                  
                                               ORF LNG     115       1                                                                                                                                                                                                                                                                                                                                                                  
                                                                       PROTEIN --- Ci ---- 8e-008     FAA00112.1 TPA: zinc finger protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Sc ---- 3e-037     NP_015432.1 Yeast 30kDa Homologue; Yth1p [Saccharomyces cerevisiae] ============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ce ---- 7e-080     NP_001023126.1 F11A10.8 [Caenorhabditis elegans] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Sp ---= 1e-080     XP_001201949.1 PREDICTED: similar to cleavage and polyadenylation specific factor 4 [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Dm ==== 2e-088     NP_477156.1 Clipper CG3642-PA [Drosophila melanogaster] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Mm ==== 5e-123     XP_001004471.1 PREDICTED: similar to Cleavage and polyadenylation specificity factor, 30 kDa subunit (CPSF 30 kDa subunit) (NS1 effector domain-binding protein 1) (Neb-1) (No arches homolog) isoform 5 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Gg ==== 3e-141     XP_414800.1 PREDICTED: similar to CPSF4 protein [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Dr ==== 1e-141     XP_683091.1 PREDICTED: similar to no arches isoform 1 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 6e-154     NP_006684.1 cleavage and polyadenylation specific factor 4, 30kD subunit;cleavage-polyadenylation specificity factor, 30kD; no arches-like (zebrafish)zinc finger protein; cleavage-polyadenylation specificity factor [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 1e-164     AAH75128.1 MGC81862 protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === ?? ==== 1e-164     NP_001086337.1 MGC81862 protein [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 2e-167     AAH80440.1 Cpsf4-prov protein [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TGas086k13.3.5                                                                                                                                                                                                                                                                                                                                                                                        TAG---------------------------------TGA---TGA---TGA------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------TGA---------------ATG---------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------TGA------------------------------------ATGTAAATG------------------------TAA------------------TAG---------------------TGA---TAA------TAATAA---------TAGTGATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2  SIG                                       Xt7.1-XZG3517.3                                                                                                                                                                                                                                                                                                                                          GAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAGTGAGTACCGGGGCCTGATCCCTCCCATTACCGGGGTGGGCTTTTAAACCGGAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATAAAAAAAAAA
                                                  Xt7.1-CHK-1008281422                                                                                                                                                                                                                                                                                                                                                TCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAGTGAGTACCGGGGCCTGATCCCTCCCATTACCGGGGTGGGCTTTTAAACCGGAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATAAAAAAAAAAAAAAAG
  5   1   2   22  ext Tad5 5g                              XZT34773.5p .........................................................................................................................................................................................................................................................................................................................................GAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAGTGAGTACCGGGGCCTGATCCCTCCCATTACCGGGGTGGGCTTTTAAACCGGAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTNCACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAG
  5   1   2   10  ext Tbd1 5g3  in                         CBXT5895.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................AATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAGTGAGTACCGGGGCCTGATCCCTCCCATTACCGGGGTGGGCTTTTAAACCGGAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAG
  5   1   3   20   nb Fat1 5g   ?                           CABC502.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAGTGAGTACCGGGGCCTGATCCCTCCCATTACCGGGGTGGGCTTTTAAACCGGAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTT
  5   1   4   12 seed Gas7 5g3  in                          XZG3517.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAGTGAGTACCGGGGCCTGATCCCTCCCATTACCGGGGTGGGCTTTTAAACCGGAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGA
  3   1   4      seed Gas7 5g3  in                          XZG3517.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATAAAAAAAAAAAAAAAGGG
  3   1   2       ext Tbd1 5g3  in                         CBXT5895.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGCATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTGGAAAAAAAAACAAAAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TGas086k13.3                                                                                                                                                                                                                                                                                                                                                                 TTCTTTCCCAGAGTGCCCTGCTCTAGGTTGAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGAAAAAAAA
                                                  Xt7.1-CHK-1008281420                                                                                                                                                                                                                                                                                                                                                                       CCCAGAGTGCCCTGCTCTAGGTTGAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACAAAAAAAAAAAA
  5   1   1           Abd0 FL                     IMAGE:7016767.FL-MGC                                                                                                                                          CTGGCACTGCTGGGAGATACTGACAGAGACACACAGATTTCCCTATTAAAACACATGGACTAAGCAAAGACTACTGCGCTAAAAAGCATACATTTCACATTACATATTGCATTTACAATCGTACTGTCTGTAATCCGACATCCTAACAAGTTTCAAAATATTCGTCCTCTATCCTTTCTTTCAGCCCCGCCTCCTCCCGACGTGCTTTGCATTGGTTCTTTCCCAGAGTGCCCTGCTCTAGGTTGAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas053l04.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCGGGCGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGTGGCCCTTAATTTATATTATGTCTTTTCAGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTGGAAAAAAAAAAAAAAAAAA
  5   1   2       ext Abd0 FL                            IMAGE:7016767                                                                                                                                          CTGGCACTGCTGGGAGATACTGACAGAGACACACAGATTTCCCTATTAAAACACATGGACTAAGCAAAGACTACTGCGCTAAAAAGCATACATTTCACATTACATATTGCATTTACAATCGTACTGTCTGTAATCCGACATCCTAACAAGTTTCAAAATATTCGTCCTCTATCCTTTCTTTCAGCCCCGCCTCCTCCCGACGTGCTTTGCATTGGTTCTTTCCCAGAGTGCCCTGCTCTAGGTTGAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACA
  5   1   2       ext Egg  5g                        TEgg121d22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                 TTCTTTCCCAGAGTGCCCTGCTCTAGGTTGAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGG
  5   1   2       ext Neu  5g3  in                   TNeu061j08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                CCCTGCTCTAGGTTGAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTG
  5   1   3        nb Neu  5g                        TNeu021p11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                CCCTGCTCTAGGTTGAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAG
  5   1   3        nb TbA  5g                        TTbA071d03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                     CTCTAGGTTGAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTACGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACTGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCCACAGATGTACAAAAGGTCACTTG
  5   1   3        nb Gas  5g                        TGas013m16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                          CCCGGGGNAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGT
  5   1   2   14  ext Gas6 5g3  in                         ANBT1391.5p ............................................................................................................................................................................................................................................................................................................................................................................................CGAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCA
  5   1   3   12   nb Gas7 5g3  in                         XZG36927.5p .............................................................................................................................................................................................................................................................................................................................................................................................GAGAAATCCATCGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGTTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAAC
  5   1   3   12   nb Gas7 5g3  in                         XZG49198.5p ........................................................................................................................................................................................................................................................................................................................................................................................................CGTTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTTCTGAGTGGGCAGTG
  5   1   3        nb Egg  5g3  in                   TEgg026e18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                          TTCGGCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACATGGGCTTCTGTAAACACGGGCCC
  3  -1   3        nb Sto1      in                         CABG8983.3p                                                                                                                                                                                                                                                                                                                                                                                                             AGAGGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTACCTGCTANTAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTG
  5   1   2       ext Gas  5g3  in                   TGas055c20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                               GCGTTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAG
  5   1   2       ext Egg  5g3  in                   TEgg004o20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                  TTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAG
  5   1   3        nb TbA  5g3  in                   TTbA009g20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                  TTCTGCTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTA
  5   1   3   10   nb Te1  5g3  in                         CBWN2628.b1 .....................................................................................................................................................................................................................................................................................................................................................................................................................GATGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTG
  5   1   3        nb Egg  5g                        TEgg038j07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                       CTGGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTA
  5   1   3        nb Egg  5g                        TEgg132o01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                         GGATGAGTCTGATGCTGATATTTGGTGTTGGTGTCGGACTCCGTACCGGTAACGATAACGATGCCGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACCGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCCGCCTGTGGAAAAGGCCGAATGTCTCCCTTTAGACATATCAGTGGGG
  5   1   3        nb Gas  5g                        TGas018d04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGA
  5   1   2       add Neu0 5g3  in                       IMAGE:6991897                                                                                                                                                                                                                                                                                                                                                                                                                                  TGATGCTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGGAACCGGGGAACTAGGCCACTGGACCAAGTTACCTGCTAATAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGGTATGAACATAATTTCTTGGTAAGACGCAAGTGGACAA
  5   1   3        nb Te5       in                         CAAO5005.5p                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGAGATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCATGAGTTAATTGCGTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCACCCTTTCCCGGGCATGGACGAGTCAGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGTCTGTGGAAAAGGCGGAGTGTGTCCGTTTACACATATCAGTGGGGAGAAGACAGTGGACTGTACACATTGGTTACTAGGCCTTTGCAAGAAGGGAGACCATTGTGAATTTTTGCCCGAGTATGATATGACTAACATGCCGGAGTGCTACTTCTACTCCGAGTTAGATGAGTGCAGTAACAAACACTGCCCATTTTTGCATATAGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGAC
  5   1   4   10 seed Mus1 5g3  in                         CABH2901.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................CTGATATTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTA
  5   1   3        nb Egg  5g                        TEgg017l24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAAGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACT
  5   1   3        nb Gas  5g3  in                   TGas086k13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTGGTGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCACTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCACAGTGCTACTTCTACCTCCAA
  5   1   2       ext Egg  5g3  in                   TEgg072e16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTGGTGTCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATC
  5   1   2       ext TbA  5g3  in                   TTbA039i05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGGACTCGGTACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAAGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCACAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTATGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCAAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACATAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCATGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCCACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGA
  5   1   3        nb HdA  5g3  in                   THdA022g12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACTCGGTACCGGTAACGATAACGATGCATGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAAAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTG
  5   1   3        nb HeRe 5g3  in                     EC2CAA27AG12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACCGGTAACGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACA
  5   1   0       chi Gas  FL   in                   TGas053l04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCGGGCGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGTGGCCCTTAATTTATATTATGTCTTTTCAGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCAC
  5   1   3   10   nb Ski1 5g3  in                         CABJ2684.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGATAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGNGCAGTGACAAGTG
  5   1   3   10   nb Ova1 5g3  in                         CABE4346.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAACGATGCAGGAGTTAATTGCTTGTGTGGATCATATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTT
  5   1   3        nb Egg                            TEgg092a14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTAATTGCTTGTGTGGATCTATCCGGTTCGATCTGGAACTGGCCGTGGAACAACAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCC
  5   1   3        nb HeRe      in                     EC2CAA26BG12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGAACTGGTCGTGGAACAACACCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAATTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGATATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACT
  5   1   3        nb Gas7      in                         XZG61314.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCTGGGGGCTCAACCCCTCCCTTTCCCGGGCATGGACAAGTCTGGGGCTGCTGTTTGTGAGTTTTTTCTGAAATCGGCCTGTGGAAAAGGCGGAATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTATTTTGACATCAAGATGCTGGAGACTTTTC
  5   1   3        nb Ova1      in                        CABE12144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATGTGTCCGTTTAGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTAT
  5  -1   3        nb Sto1      in                         CABG8983.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGACATATCAGTGGGGAGAAGACAGTGGTCTGTAAACATGGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAAT
  5   1   3        nb Ova1      in                         CABE4555.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGTCTGTAAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGNGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCANAGTGAAAGTTTTTGCCAGTAACT
  5   1   3        nb Tad5      in                          XZT4674.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGTCTGTAACATTGGTTACGAGGCCTTTGCAAGAAGGGAGACCAGTGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGNGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTG
  3   1   2       add Neu0 5g3  in                       IMAGE:6991897                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTTTTTTTCCCCAAATTTTGGGGGGGGGGCCCGGAAAACAAAGGGGGTGGCCCCCCCTTTTTGGGCTATTATGGCCCCCCGGGTTCCCAGGGGTTAAAAAGGCTTTCCCCCTGGTTTATGACCCGGGGGTTTTTTGTAAAGCCCCGGGCCCCCCTTCGTTAGGGCCCCGGGCATTACTTGGAAGGAAGTAAATTGGGGTCCAAATTACCTGGGTGGGGTTTTCGTATTTGAAGGGCCCCTAACCTGTAAAATCCATGCTTTCCCGGTTTTGAATTTACCTATGGGGAACCACAGAAACAGCCCGCCTCTACCCCAGCAAACACAGACTCAACGGAAGCAAAATAATANCCGGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTTTTTG
  3   1   3        nb Gas  5g3  in                    TGas086k13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTGAATTTTTGCACGAGTATGATATGACTAAAATGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTTTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTGATAAAATCTATTTTAGTGATGACTGGAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb HeRe 5g3  in                     EC2CAA27AG12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCCAGAGTGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATA
  3   1   4      seed Mus1 5g3  in                         CABH2901.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCTACTTCTACTCCAAGTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTGG
  3   1   0       chi Gas  FL   in                    TGas053l04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGTACAAAGAGTGCCCATTTTGCATATGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGTGGCCCTTAATTTATATTATGTCTTTTCAGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATANAAATCTATTTTAGTGATGACGGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Ski1 5g3  in                         CABJ2684.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGTTTGGTGAGTGCAGTACAAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTGGAAAAAAA
  3   1   2       ext Gas  5g3  in                    TGas055c20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTGGTGAGTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTTTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACGGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Ova1      in                         CABE4555.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTGCAGTANCAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATG
  5   1   3        nb Bone      in                        CBTC2989.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGCAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCNCAGAACTGTTTGGCANAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTAT
  3   1   2       ext Egg  5g3  in                    TEgg072e16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTTTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTTTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTTTTAAGTAAATATTGGGATATTTTTTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATTCTATTTTAGTGATGACTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb HeRe      in                     EC2CAA26BG12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATA
  5   1   3        nb Gas7      in                         XZG37367.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACAAAGAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCANATGCCAACAGTTCTCTTGAAC
  3   1   3        nb Ova1 5g3  in                         CABE4346.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGTGCCCATTTTTGCATATTGACCCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATG
  3   1   3        nb Ova1      in                        CABE12144.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGAATCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTGGAAAAAAAAAAAAAAA
  3   1   3        nb Tad5      in                          XZT4674.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATAAAAAAAAAAAAAAAGG
  3   1   3        nb Bone      in                        CBTC2989.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAAAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTGG
  3   1   3        nb Egg  5g3  in                    TEgg026e18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGATAAAAGACTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG61314.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCCCATGGTATGACAGGGGCTTCTGTAAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTGGAAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas7      in                         XZG37367.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGCACGGGCCCCTCTGTAGGCACCGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTGG
  3   1   3        nb TbA  5g3  in                   TTbA009g20.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTTTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTTTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGGGACTTTTCCTTGTTTTTAAGTAAATATTGGGATATTTTTTGCTATTTACTTTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCCGTAACTATTTTTTTAAATAAAAAAATGTAAAAGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATTCTATTTTAGTGATGACTGGAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb HdA  5g3  in                    THdA022g12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTTTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCCGGTGTTACAAAGGTCATCCTCACTCATTCAGGTAACAAGCCAAAACTTTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTTTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTTTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTTTTAAGTAAATATTGGGATATTTTTTGCTATTTACTTTGAGCAGTTTATTGGAATTTTTTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTTTCTTGAACTTAACATTGTTAATAAAATTCTATTTTTGTGGTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCG
  5   1   3        nb Gas7                                 XZG12703.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGGCATACTCGAAGATAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas7 5g3  in                         XZG49198.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCATACTCGAAGAGTAATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGGCTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTTTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCCCTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTTTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCGGGAGACTTTTCCTTGTTTTTAAGTAAATATTGGGATATTTTTTGCTATTTACTTTGAGCAGTTTATTGGAATTTTTTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAAAGGAAAAGTATTTTTATTTCTTTTTATTTCTTTAAAATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTTTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGGGA
  5   1   3        nb Neu       in                   TNeu102m16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATCCCCGGGATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTGATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTATGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTGACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTGAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTGCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTGTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTGTTTTTATTTCTTTTTATTTCTTTAATATAACTT
  3   1   3        nb Neu       in                    TNeu102m16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATCCCCGGGATTTGTGTCAATTACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas6 5g3  in                         ANBT1391.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTTGGTGGGATTCTGTATCGAAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTGG
  5   1   3        nb Gas7      in                         XZG31329.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCGAAGGCCCTAACTGTAAATTCATGCATCCACGCTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGATCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTGGA
  3   1   3        nb TpA                             TTpA025h16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGGCCCTAACTGTAAATTCATGCATCCCCGTTTTGAATTACCTTTGGGAACCACAGAACAGCCGCCTTTATCCCAGCAAACACAGATTCAACAGAAGCAAAATAATAACCAGGTGGTGCAAAGGTCATCCTCAGTCATTCAGGTAACAAGCCAAAACTTTCTTGTCAGCCAACAAAGTTCCCCACAGACAATTGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCCAGTTACCTGTTCTAAGTGGGGTGGGAAAGGACCTTTTCCCTCCAGATGGGCAAAAGGTCCCTTGGCTTTTTTGAGTGGGCAGTGACAAGTGGTTTGGG
  3   1   0       chi TbA       out                   TTbA009g21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGGCCCTAACTGTAAATTCATGCATCCACGTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTTTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTTTTAAGTAAATATTGGGATATTTTTTGTTATTTATTTTGAGCAGTTTATTGGAATTTTTTCNTNCCAAGANNNNNTTNNNNNNCCCCCCCGGATACGCGCAATATACAGAGCATGAAAGTGGATTATCTGTATAAAGAATGGGTTATTTGTTTTAATTTAAATTCTCTTCAAATTGTTTGCCTTTTTTTTTTTTTCCTTGGGTATTTTTTGAAATTTCCAGTGAGGAATAAAAAACTGTTTTTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       ext TbA  5g3  in                    TTbA039i05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTTGAATTACCTATGGGAACCACAGAACAGCCGCCTTTTCCCCAGCAAACACAGGCTCAACAGAAGCAAAATAATAACCCGGGGTTACAAAGGTCATCCTCACTCATTCAGGTAACAAGCCAAAACTTTCCTGTCAGCCAACAACGTTTCCCACAGACAATTGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGGCCTTGGCCACTGGGCCAAGTTACCTGGTATAAGGGGGGGGGGAAAGGGCATTTTGCCCACAGATGTACAAAAGGTCACTTGGGTTTTTTGAGTGGGCCGGGACAAAAGGTTTGGGGTATGGACCTAATTTTTGTAAGGACGCAGTGGGCAGACGTTTCCTTTTTAATTTTGACATCAAGAGGGCGGGGGCTTTTCCTTGTTTTTAAGTAAATATTGGGGGATTTTTTGGTATTTATTTTGGGCAGGTTATTGGAATTTTTTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCCGTAACTATTTTTTTTAATAAAAAAAAGTAAAAGTATTTTTATTTTTTTTTGTTTTTTTAATATAACTTTTGTACAGATTAGATCAAAAGCCAACCGTTTTTTTGAAATTAACCTTGTTAATAAAATTTATTTTAGTGGTGGCGGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg  5g3  in                    TEgg004o20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAACCACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTTTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7 5g3  in                         XZG36927.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAGAACAGCCGCCTCTACCCCAGCAAACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGAAAAAAAAAAAAAAAGG
  3   1   3        nb Te1  5g3  in                         CBWN2628.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTACAAAGGTCATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTAGAAAAAAAAAAAAAAA
  5   1   3        nb Neu       out                  TNeu085h14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGACTCAACAGAAGCAAAATAATAACCAGGTGTTGCAAAGGTGATCCTCACTCATTCAGCTAACAAGCCAAAACTCTCCTGTCAGCCAACAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTGACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTGAATGTGTTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTGCAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTGGAGAGAAAAAAAA
  3   1   2       ext Neu  5g3  in                    TNeu061j08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCTAACAAGCCAAAACTCTNCCTGTCAGCCAACAACGTTCCCCANCAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTGGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7                                 XZG31825.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTCAGCCAACAACGTTCCCCACAGCCAATGGGTGTCATGCAGTCCCAAAGTGGCACCCAGGGGAACCGGGGACCTAGTCCACTGGACCAAGTTTCCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCTTCAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAAGGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACCGATTAGGTCAAATGCCAACAGTTCTCTTGAACTTAACTTTGTTAATAAAATCTATTTTAGCAAAAAAAAAAAAAAAGG
  3   1   3        nb Ova1      in                         CABE4398.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATG
  5   1   3        nb Ova1      in                         CABE4398.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAACGTTCCCCACAGACAATCGGTGTCATGCAGTCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGAAAAAAAAAAAAAAAAAA
  5   1   3        nb Egg                            TEgg119l08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTG
  5   1   2       ext Lun1                                CABD13347.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACAAAGTGGCAACCAGGGGAACCGGGGACCTAGGCCACTGGACCAAGTTACCTGCTATAAGTGTGGTGAGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAATGTAAATGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTACAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGTGATGACTGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   3        nb Gas7      in                         XZG31329.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAAAGGACATTATGCCAACAGATGTACAAAAGGTCACTTGGCTTTCTTGAGTGGGCAGTGACAAGTGGTTTGGGGTATGGACATAATTCTTGTAAGGACGCAGTGGACAGACGTTTCCTTTTTAATTTTGACATCAAGATGCTGGAGACTTTTCCTTGTTCTTAAGTAAATATTGGGATATTTTCTGCTATTTACTCTGAGCAGTTTATTGGAATCTTCTCCTGCCAAGAACTGTTTGGCAAAGTGAAAGTTTTTGCCAGTAACTATTTTTTTAAATAAAAAAAGGTAAAGGTATTTTTATTTCTTTTTATTTCTTTAATATAACTTTTGTCCAGATTAGATCAAATGCCAACAGTTCTCTTGAACTTAACATTGTTAATAAAATCTATTTTAGGGAGGGCGGG
  3   1   3        nb Te5       in                         CAAO5005.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGCGGCTTGGGGCATGGACCTAATTCTTGTAAGGACGCAGGGGGCAGACGCTTCCTTTTGAAGTTGGACATCAAGACGCCGGAGACTTTTCCTCGGTCCTAAGCAAATAGTGGGATATTTTCTGCTATTTACTATGAGCAGTTTATGGGAATCTTCTCCTACCAAGATCTGTTTGGCAAAGGGAAAGTTTTTGCCCGGAACTATTTTTTTTAATAAAAAAATGTAAACGTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)