Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-EC2BBA11BE07.3                       33 END     1           1        3                secretory granule, neuroendocrine protein 1 (7B2 protein) [Xenopus tropicalis]
     2   2.0    0Xt7.1-CABH4189.3                           28 END     1           1        3                myogenin [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 93%

 1012071579 Xt7.1-TTpA043j03.3 - 75 ESTs
                                                                       -110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA043j03.3                                                                                                               TTACCTAAATCACACATTGTCAATGAAATGAAAAAAAAAAAAAAACTACGACCGAACCAAAGACTACTTAGTGCATCGCTATAGCAACAGGCTCCGCCTCTGTGTTCGCTCCGGATCCACGCCTACTGCGCCACCTAGAGGCTGCCGGCCCGCTCAGTTAATGGAGCGCAGTCCCGGATGGAGGTGTGACGTCAGTATGAGCGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATTGGAACCATGGATGTGGCCGTTGCCTTATTGTACTGCTAAATGTGTTACATGCAAAAGCAGAAATGTGACTGAAATATAATATGGAAACTC
                                                  Xt7.1-CHK-1008224160                                                                                                                     AAATCACACATTGTCAATGAAATGAAAAAAAAAAAAAAACTACGACCGAACCAAAGACTACTTAGTGCATCGCTATAGCAACAGGCTCCGCCTCTGTGTTCGCTCCGGATCCACGCCTACTGCGCCACCTAGAGGCTGCCGGCCCGCTCAGTTAATGGAGCGCAGTCCCGGATGGAGGTGTGACGTCAGTATGAGCGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATTGGAACCATGGATGTGGCCGTTGCCTTATTGTACTGCTAAATGTGTTACATGCAAAAGCAGAAATGTGACTGAAATATAATATGG
                                                      consensus depths                                                                                                                    2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     5     5     7     7    12    12    16    16    22    23    25    26    28    29    30    31    31    32    31    32    31    32    31    32    31    32    30    31    30    30    29    30    29    30    29    30    29    30    29    30    29    30    29    30    29    29    29    29    29    29    29    29    29    29    29    29    29    29    29    29    29    29    30    30    33    33    34    34    34    34    37    37    39    39    41    41    43    43    44    44    44    44    46    46    49    49    51    51    52    52    53    53    55    55    54    54    53    53    52    52    55    55    55    56    56    58    55    58    55    57    54    56    53    55    55    56    55    55    54    54    53    53    52    52    51    52    51    52    51    52    51    52    51    52    51    52    51    52    49    50    49    50    48    49    48    48    48    48    48    48    43    45    43    45    42    44    42    43    42    42    41    41    41    41    41    41    42    42    42    42    42    42    42    42    42    42    42    42    41    41    39    40    38    39    37    38    36    37    36    37    36    37    36    37    36    36    36    36    36    36    32    34    32    33    29    31     8    17     6    10     6     9     6     8     6     8     5     6     4     6     4     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --------T---
                                               BLH ATG     270     653                                                                                                               
                                               BLH MIN     270      67                                                                                                               
                                               BLH MPR     270      67                                                                                                               
                                               BLH OVR     270      50                                                                                                               
                                               CDS MIN     270      28                                                                                                               
                                               EST CLI     201      28                                                                                                               
                                               ORF LNG     270       3                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 9e-015     NP_573104.1 CG9214-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Br ==== 3e-018     AAB53747.1 anti-proliferation factor [Branchiostoma lanceolatum] ===========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Sp ==== 8e-026     XP_792782.1 PREDICTED: similar to BTG3 protein (Tob5 protein) (Abundant in neuroepithelium area protein) [Strongylocentrotus purpuratus] ================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Gg ==== 1e-045     XP_417919.1 PREDICTED: similar to p30 B9.10 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 1e-045     CAA51746.1 p30 B9.15 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Dr ==== 9e-052     XP_707837.1 PREDICTED: similar to BTG3 protein (Rbtg3) isoform 2 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Mm ==== 1e-061     XP_622699.2 PREDICTED: similar to BTG3 protein (Tob5 protein) (Abundant in neuroepithelium area protein) [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 7e-064     NP_006797.3 B-cell translocation gene 3; abundant in neuroepithelium area [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 1e-149     AAI18747.1 Unknown (protein for MGC:145337) [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 1e-149     NP_001090840.1 BTG family, member 3 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA043j03.3                                                                                                                                          ATG---------------------------------------------------TAG---------------------------------------------------TAG---------------------------------------ATG------TGA---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------ATG------------------------------------------------------------------------------------------------TAA---ATG---------------------------------------ATG---------------------------------------TAG------------------TAA---------------------------TAG------TAG---------------------------------------------------------------------TAA---------------------------TAA------------------------ATG---------------------------------------------------------ATGTAG------------------TAATAATAA---------TAA---------------ATG---------------------------TAAATG------ATG------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  0   1   1           Brn4 FL                         CAAL21426.FL-MGC                                                                                                                                                                                                                                                                                         GTCCCGGATGGAGGTGTGACGTCAGTATGAGCGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATTGGAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg037n13.FL-Sanger                                                                                                                                                                                                                                                                                                                                        AGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATTGGAACCATGGATGTGGCCGTTGCCTTATTGTACTGCTAAATGTGTTACATGCAAAAGCAGAAATGTGACTGAAATATAATATGGAAACTCTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5g                        TEgg104k01.p1kSP6 TGTCATGCAGCACCGCGGTCTCTCACAGGGAAACACAAAGCCCTTCCGCGTCCCCGCAGGTTAAGGTCCGCCTAACAGCACAATACTATTAGCGCTAAACCGATCAGCGCTTTACCTAAATCACACATTGTCAATGAAATGAAAAAAAAAAAAAACTACGACCGAACCAAAGACTACTTAGTGCATCGCTATAGCAACAGGCTCCGCCTCTGTGTTCGCTCCGGATCCACGCCTACTGCGCCACCTAGAGGCTGCCGGCCCGCTCAGTTAATGGAGCGCAGTCCCGGATGGAGGTGTGACGTCAGTATGAGCGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCC
  5   1   2       bld Egg  5g                        TEgg122m05.p1kSP6   CATGCAGCACCGCGGTCTCTCACAGGGAAGCACAAAGCCCTTCCGCGTCCCCGCAGGTTAAGGTCCGCCTAACAGCACAATACTATTAGCGCTAAACCGATCAGCGCTTTACCTAAATCACACATTGTCAATGAAATGAAAAAAAAAAAAAAACTACGACCGAACCAAAGACTACTTAGTGCATCGCTATAGCAACAGGCTCCGCCTCTGTGTTCGCTCCGGATCCACGCCTACTGCGCCACCTAGAGGCTGCCGGCCCGCTCAGTTAATGGAGCGCAGTCCCGGATGGAGGTGTGACGTCAGTATGAGCGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAGAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCT
  5   1   2   10  bld Eye  5g3  in                         CCAX5178.b1 .......................................................................................................CAGCGCTTTACCTAAATCACACATTGTCAATGAAATGAAAAAAAAAAAAAAACTACGACCGAACCAAAGACTACTTAGTGCATCGCTATAGCAACAGGCTCCGCCTCTGTGTTCGCTCCGGATCCACGCCTACTGCGCCACCTAGAGGCTGCCGGCCCGCTCAGTTAATGGAGCGCAGTCCCGGATGGAGGTGTGACGTCAGTATGAGCGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGGGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAGAAAATAAGGAAGGGGGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGG
  5   1   2   10  bld Ovi1 5g3  in                        CABI12521.5p ......................................................................................................................................................................................................................................................................CTCAGTTAATGGAGCGCAGTCCCGGATGGAGGTGTGACGTCAGTATGAGCGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAGAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCATGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCT
  5   1   2       bld Egg  5g3  in                   TEgg045k08.p1kSP6                                                                                                                                                                                                                                                                                   AGCGCAGTCCCGGATGGAGGTGTGACGTCAGTATGAGCGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCATGCTGATAATAAAGAATGAAAAAATAA
  5   1   2       bld Brn4 FL   in                        CAAL21426.5p                                                                                                                                                                                                                                                                                          TCCCGGATGGAGGTGTGACGTCAGTATGAGCGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGC
  5   1   2       bld Egg  5g3  in                   TEgg024f14.p1kSP6                                                                                                                                                                                                                                                                                            CCGGATGGAGGTGTGACGTCAGTATGAGCGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAGAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTG
  5   1   2       bld BrSp 5g3  in                     EC2BBA28CH03.g1                                                                                                                                                                                                                                                                                                        GGGACGTCAGTATGAGCGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGAC
  5   1   2       bld Egg  5g3  in                   TEgg005l15.p1kSP6                                                                                                                                                                                                                                                                                                          GACGTCAGTATGAGCGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAG
  5   1   2       bld HeRe 5g                          EC2CAA44DH02.g1                                                                                                                                                                                                                                                                                                          GACGTCAGTATGAGCGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAG
  5   1   2       bld HeRe 5g3  in                     EC2CAA16DG05.g1                                                                                                                                                                                                                                                                                                            GGTCAGTATGAGCGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCC
  5   1   2       bld BrSp 5g3  in                     EC2BBA35CB08.g1                                                                                                                                                                                                                                                                                                             GGGAGTATGAGCGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGGTGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAA
  5   1   2       bld BrSp 5g3  in                     EC2BBA31DA03.g1                                                                                                                                                                                                                                                                                                                        GGGGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGATGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATC
  5   1   2       bld HeRe 5g3  in                     EC2CAA41DA04.g1                                                                                                                                                                                                                                                                                                                          GGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGA
  5   1   2   10  bld Tbd1 5g3  in                        CBXT10984.b1 .........................................................................................................................................................................................................................................................................................................................GGAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAGAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATAGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCC
  5   1   2   12  bld Gas7 5g3  in                         XZG31457.5p ..........................................................................................................................................................................................................................................................................................................................GAGCCCAGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGTCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAGAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGNGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCT
  5   1   2       bld HdA  5g3  in                   THdA022k12.p1kSP6                                                                                                                                                                                                                                                                                                                               CCCGGCGGGAGGTTTCTGTGAGCGGCACCGTGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCT
  5   1   2       bld TpA  5g                        TTpA043h01.p1kSP6                                                                                                                                                                                                                                                                                                                                CCGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCANATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATAT
  5   1   2   11  bld Limb 5g3  in                        CBSU3479.fwd ...............................................................................................................................................................................................................................................................................................................................GGGCGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCA
  5   1   2       bld Egg  5g                        TEgg081h18.p1kSP6                                                                                                                                                                                                                                                                                                                                    CGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTAT
  5   1   2       bld Gas  5g                        TGas041g13.p1kSP6                                                                                                                                                                                                                                                                                                                                    CGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAGAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCANGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGNGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGC
  5   1   2       bld HeRe 5g3  in                     EC2CAA18CE07.g1                                                                                                                                                                                                                                                                                                                                    GGGGAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTT
  5   1   2       bld Egg  FL   in                   TEgg037n13.p1kSP6                                                                                                                                                                                                                                                                                                                                       GAGGTTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAA
  5   1   2       bld Egg  5g3  in                   TEgg069a02.p1kSP6                                                                                                                                                                                                                                                                                                                                           TTTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCCAGCTGCAACCAGTTCCAGCTTG
  5   1   2   10  bld Ova1 5g3  in                         CABE5250.5p ...........................................................................................................................................................................................................................................................................................................................................TTCTGTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAGAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCATGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTG
  5   1   2   10  bld Thy1 5g3  in                        CBST5871.fwd ...............................................................................................................................................................................................................................................................................................................................................GTGAGCGGCACCGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGNGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAA
  5   1   2   12  bld Tad5 5g3  in                         XZT69406.5p ..........................................................................................................................................................................................................................................................................................................................................................CGAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAAATATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAAT
  5   1   2       bld Egg  5g                        TEgg091d18.p1kSP6                                                                                                                                                                                                                                                                                                                                                            GAGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCAT
  5   1   2       bld TpA  5g3  in                   TTpA059h04.p1kSP6                                                                                                                                                                                                                                                                                                                                                             AGCGGCCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAGAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGGTAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCNAATTCTATAGAAAAAAGTATTT
  5   1   2       bld TpA  5g3  in                   TTpA057m24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                  CCTGTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAAAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAGTATTTTCTACTTT
  3  -1   2       bld Ova1      in                        CABE13397.3p                                                                                                                                                                                                                                                                                                                                                                     GTGGGAGAGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAGAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCATGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCCATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAG
  5   1   2       bld TpA  5g                        TTpA039d23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                            AGCACAGATGGTTGAAGATGAAGAACGAAATAGCCGCCGTGGTGTTTTTTCTTTCCAAGCTGATAAGAAAGAATGAGAAAATAAGGAAGGAGGAGGTGGACAGGTTTTCAGAGGAACTGACGAGGCTGCTGTACGACAAGTTTGTGAATCACTGGTACCCAGCAACGCCAACGAAGGGTCAGGCATACAGATGTATCCGCGTCAACAAATTTCAAGGTCCTGATCCTGACCTCCTGAAAGCTTGCCTGAATAGCGGCCTGGAGTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCATACTGGCCCCGGCTTCATAGGCGCAACTCACACACAT
  3   1   2       bld Egg  5g3  in                    TEgg069a02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTATGAAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTGTAATAATAAATTATTTTGTAACTCAGTATGGAAAAAAAAAAAAAAAAAA
  5   1   2       bld HdA       in                  THdA010h10.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGACCTGGGACTGCCCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCATACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTC
  3   1   2      seed TpA       out                   TTpA043j03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAAGGAATTCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1 5g3  in                         CABE5250.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCACTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCATGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTC
  3   1   2       bld Ovi1 5g3  in                        CABI12521.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCATGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATGG
  3   1   2       bld HdA       in                    THdA010h10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTATGGGTGGATCCATGGGAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCATACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACCAGTTTATTCTAATAATAAATTATTTTGAACTCAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Brn4 FL   in                        CAAL21426.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCCATGGAAAGTGTGCTGCAGGTGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATGG
  3   1   2       bld Te1       in                        CBWN16739.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCGGAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCATACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTTTAATTTAGTATATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATCCCCATAAA
  3   1   2       bld Ova1      in                        CABE11561.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCATGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCGAGTATTGG
  5   1   2       bld Ova1      in                        CABE11561.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAGAAGAATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCATGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATTGGAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg045k08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCGAGTATTGGAACCCATGGATGTGGCCGTTGCCTTATTGTACTGCTAAATGTGTTACATGCAAAAAAGGAAATGTGACTGAAATATAATATGAAACTCTAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                     EC2BBA31DA03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATGCATTCCTTGTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGATGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCCGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTT
  3   1   2       bld HdA  5g3  in                    THdA022k12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld TpA  5g3  in                    TTpA059h04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCAAGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTAT
  5   1   2       bld Brn4      in                        CAAL22733.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCATTGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCATACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATTGGAAACCATGGATGTGGCCGTTGCCTTATTGTACTGCTAAATGTGTTACATGCAA
  3   1   2       bld TpA  5g3  in                    TTpA057m24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAAAGTAAAGATAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Thy1 5g3  in                        CBST5871.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAATGATAGGATGGAGATCTCTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGT
  3   1   2       bld HeRe 5g3  in                     EC2CAA41DA04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGATGGAGATCTTTGAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTA
  5  -1   2       bld Ova1      in                        CABE13397.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGCAAGTTACCCATGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATTGGAACCATGGATGTGGCCGTTGCCTTATTGTACTGCTAAATGTGTTACATGCAAAAGCAGAAATGTGACTGAAATATAATATGGAAACTC
  3   1   2       bld Gas7 5g3  in                         XZG31457.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGCAAGTTACCCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTC
  5   1   2       bld Egg       in                   TEgg012g20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGT
  3   1   2       bld Tbd1 5g3  in                        CBXT10984.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACGTGGTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATAGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu103h20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGGATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATT
  3   1   2       bld Brn4      in                        CAAL22733.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGATAAAGCAGTGACATCCGATTACCATTCCCGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCATACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATTGGAACCATGGATGTGGCCGTTGCCTTATTGTACTGCTAAATGTGTTACATGCAAAAGCAGAAATGTGACTGAAATATAATATGGAAACTCT
  3   1   2       bld Tad5 5g3  in                         XZT69406.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAAAGCAGTGACATCCGATTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATTGGAACCATGGATGTGGCCGTTGCCTTATTGTACTGCTAAATGTGTTACATGCAAAAGCAGAAATGTGACTGAAATATAATATGGAAACTCTAAAAAAAAAAAAAAAGG
  3   1   2       bld HeRe 5g3  in                     EC2CAA16DG05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTACCATTCCGGATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAAT
  3   1   2       bld Limb 5g3  in                        CBSU3479.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCCTCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATTGGAACCATG
  5  -1   2       bld Brn4      out                        CAAL6524.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTTCAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCATACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATTGGAACCATGGATGTGGCCGTTGCCTTATTGTACTGCTAAATGTGTTACATGCAAAAGCAGAAATGTGACTGAAATATAATATGGAAACTCTAAAAAAAAAAAAAAAGGGCGCCGCTCGCGATCTAGAACTAGT
  3   1   2       bld Neu       in                    TNeu103h20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGATGATGAAGTCTACTTCAGTACTAGAAAAGCTCAGACTGGCCCCGGCTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGAACTCAAAAAAAAAAAAAAATAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg                            TEgg122f23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAAC
  5   1   2       bld Egg                            TEgg122g01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTC
  3   1   2       bld Egg       in                    TEgg012g20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATAGGCGCAACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp 5g3  in                     EC2BBA28CH03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACTCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGAATAAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATTGGAACCATGGATGTGGCCGTTGCCTTATTGTACTGCTAAATGTGTTACATGCAAAAGCAGAAA
  3   1   2       bld Eye  5g3  in                         CCAX5178.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCACACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATTGG
  3   1   2       bld Egg  FL   in                    TEgg037n13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACACATCAGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTCAGTATTGGAACCATGGATGTGGCCGTTGCCTTATTGTACTGCTAAATGTGTTACATGCAAAAGCAGAAATGGACGAAATATAATAGGAAACTCTAAAAAAAAAAAAAAAAA
  5   1   2       bld HeRe                             EC2CAA44DF01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGGTCTGGGAGTCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATG
  3   1   2       bld Egg  5g3  in                    TEgg005l15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAAGCTGCAACCAGTTCCAGCTTGGAATAAGTATCATAAGAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCCCAGCCAGGTGCCATGGCTACCCCCGATTTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGGGTAAATAAAGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGGCCAAATTTTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTTTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTTTAATAATAAATTATTTTGTACCTCGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2       bld Neu                            TNeu068i13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAAAGCAGGGGCCCCTCTATCAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTC
  3   1   2       bld Egg  5g3  in                    TEgg024f14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTATGATCAGCGCATGATGGCGGGTTATGTGCAGCAACCAAGGGGAAGCAAGATGCACAGCCAGGTGCCATGGCTACCCCCGATCTTGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTTTATTCTAATAATAAATTATTTTGTAACTC
  3   1   2       bld BrSp 5g3  in                     EC2BBA35CB08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCAGAATGACAGCAGCCACTGGGCTGGGCTACCTTTACTCCCTGCCGGCCCCCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAGTAATGTACAAATTATACAAATGCAGTGGACCAAATTCTATAGAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCTGTTCTTTGATATTACTGTAGTAGAGTATTTATTTACAATTCATATTTTATGCTTTATGTAGACTAATGACAGTT
  5   1   2       bld Te1       in                        CBWN16739.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAATGCCTGGTGTAAATAATGTGTTCTATATATGTTCTCAATAATGTACAAATTATACTAATGCAGTGGACCAAATTCTATATAAAAAAGTATTTTCTACTTTAGTCTATATTTTTTTCTTTTTAATGTAACTTAACGTTTTTGCACTTTGGATAGCTTATATAGCGTTGTAGCAAGAAACACTTTATTAGGGTTATAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTGTGACTTGCACATAATCAT
  5  -1   2       bld Egg                            TEgg106p15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCCAAATTTTATAGAAAAAAGTATTTTGTCCTTCTAGTCCATATTTTTTTTTTCTTTTTAATGTAAGTTTACGTTTTTGCACTTTGGATAGGTTATATAGCGTTGTAGCAAGAAACCCTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAA
  3   1   2       bld HeRe 5g3  in                     EC2CAA18CE07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGTTATATAGCGTTGTAGCAAGAAACACTTTAGTAGGGTTAGAGAAAGTGCCTCAATATTTTTAATATTGGAATTGTATTAATATAATATATATATTTGTGACTTGCACATAATCATGTGACCTGTATTGTAATGAAATGCGGTTCTTTGATATTACTGTAGTAGAGTATTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)