Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-TNeu073m24.3                         67 END     1           1        1                Hypothetical LOC496639 [Xenopus tropicalis]
     2   2.0    0Xt7.1-XZG56984.3                            9 END     1           1       11                (no blast hit)

 This cluster: approximate FL confidence score = 88%

 1012071593 Xt7.1-XZT72772.5.5 - 71 ESTs
                                                                       ........-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZT72772.5.5                                                                                                                                                                                                                 CCGCATTGGCCGGTAGGGGGCACTGGGACACGCCTTGCAGGAAGATGGCGTAAAGGCACTGCCCGTTGTTTTGGGGAGGAGATTAAGTGGAGGAGCTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTCTTCCTGAGATTGCTAGAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTTTGTTTTTTTTTTAAGTGCCAACATTTATCTTCCCCCCCCCCCCCCCCCACTCCTGGGGAACTATATATAGTATATAAAGGCCACAAACTCCCTTCTTCCTGAATGGGGGGGGG
                                                  Xt7.1-CHK-1008224325                                                                                                                                                                                                                       TGGCCGGTAGGGGGCACTGGGACACGCCTTGCAGGAAGATGGCGTAAAGGCACTGCCCGTTGTTTTGGGGAGGAGATTAAGTGGAGGAGCTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTCTTCCTGAGATTGCTAGAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTTTGTTTTTTTTTTAAGTGCCAACATTTATCTTCCCCCCCCCCCCCCCCCACTCCTGGGGAACTATATATAGTATATAAAGGCCACxxAxTCCCTTCTTxxxxAATGGGGGGGGGGGGGGG
                                                      consensus depths                                                                                                                                                                                                                      2     2     2     2     2     2     2     2     2     2     3     3     3     3     4     6     7    11    11    15    15    20    25    30    45    50    48    52    48    52    50    53    50    53    50    53    51    54    51    54    51    55    52    56    52    56    52    56    51    56    51    56    54    57    55    57    55    57    55    57    55    58    56    59    55    59    56    59    56    59    56    59    57    60    57    60    57    60    57    60    55    59    55    59    55    59    55    59    57    58    57    58    56    58    56    58    56    57    54    56    53    56    56    58    55    57    51    57    51    58    52    58    51    58    50    58    48    55    47    55    42    50    40    48    38    47    39    46    37    45    36    43    22    30    23    29    23    29    23    29    22    29    22    28    21    28    20    27    19    24    18    24    17    24    15    22    13    18    11    16    12    16    11    16    10    14     5    11     7    10     6    10     6     9     6    11     4    11     3     9     3    10     4     9     4    10     4    10     3     9     3     9     5     8
  5   1   2  SIG                                      Xt7.1-XZT72772.5                                                                                                                                                                                                                 CCGCATTGGCCGGTAGGGGGCACTGGGACACGCCTTGCAGGAAGATGGCGTAAAGGCACTGCCCGTTGTTTTGGGGAGGAGATTAAGTGGAGGAGCTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTTTTCCTGAGATTGCTAGAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTTTGTTTTTTTTTTAAGTG
  5   1   2  SIG                                    Xt7.1-TTpA068n13.5                                                                                                                                                                                                                                                                                                                                                        CACGCCTTGCAGGAAGATGGCGTAAAGGCACTGCCCGTTGTTTTGGGGAGGAGATTAAGTGGAGGAGCTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTCTTCCTGAGATTGCTAGAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTGTTTTTTTTTTTTAAGTGCCAACATTTATCTTCCCCCCCCCCCCCCCCCACTCCTGGGGAACTATATATAGTATATAAAGGCCACAAACTGAGAGTTTGTAAAATGGGGGGGGGGGGTTCATTAACCCCCCACACTTTTTTTTTTTTGATTTTTTTTTTAAAGAACCAACATTTTTTTCCCCCCCCCCCCATTCCTGGGGAACTATATTTAGTATATAAAGGCCCCAAACTGAAATTTTTTAAAATGGGGGGGGGGGGGCCCTTCATCAAACGAAAGATTTTATTTATACTGAAAATTATGGGGAGAAAGCAATAAAGTTGTTTTTTTTCCAAAAAAAAAAAAAAAAAAAAATAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGTACCCCGCCAGCAAATGCCCTTCAGTGGGGCTATTGTGCCCAAGGTGCCCCTTTGTTCCGCCCAATGTTACAAGCAGCCAGTGAGAGAGCTCCTAGATCTCCTATACACATCTAGGTATGGGCTGCACCCAATAGAAATGAATGTGCCCTCACATTGCTGCTCCATAGTCAGGGCTG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----G-------
                                               BLH ATG     137     354                                                                                                                                                                                                                 
                                               BLH MIN     137      71                                                                                                                                                                                                                 
                                               BLH OVR     137      64                                                                                                                                                                                                                 
                                               CDS MIN     137      57                                                                                                                                                                                                                 
                                               EST CLI     136      57                                                                                                                                                                                                                 
                                               ORF LNG     137       2                                                                                                                                                                                                                 
                                                                       PREDICTED - Gg ---- 4e-011     XP_423326.2 PREDICTED: similar to MGC83094 protein [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sc ---- 1e-015     NP_010451.1 TFIID subunit (TBP-associated factor) with predicted molecular weight of 23 kD.;Taf10p [Saccharomyces cerevisiae] --------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 7e-021     NP_504261.1 TBP-Associated transcription Factor family member (19.6 kD) (taf-10)[Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dm ---- 5e-032     NP_477418.1 TBP-associated factor 10b CG3069-PA [Drosophila melanogaster] ================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 2e-039     XP_001179559.1 PREDICTED: similar to TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Dr ---- 3e-067     NP_001038276.1 hypothetical protein LOC556710 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN -== Mm ==== 1e-071     NP_064408.2 TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor; TATAbox binding protein (TBP)-associated factor, RNA polymerase II, H, 30 kDa; TAF10RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30 kDa [Musmusculus] ==============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN -== Hs ==== 1e-074     NP_006275.1 TBP-related factor 10; TATA box binding protein (TBP)-associated factor, RNApolymerase II; TAF10 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 30 kD; TATA box binding protein (TBP)-associatedfactor, RNA polymerase II, H, 30kD; transcr [Homo sapiens]  ======================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 6e-102     AAI23260.1 Taf10b protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === ?? ==== 6e-102     NP_001090514.1 Taf16-P1 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 3e-108     NP_001017279.1 TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZT72772.5.5                                                                                                                                                                                                                                                             ATG---TAA------------------------------TAA---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------TAG------------------------------------------------------ATG------------------------------------------------------------------------TGA------------------------------------------------------------------------------------TAA------------------ATGTAG------------------TGA------------TGA------TAG------------------------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2  SIG                                      Xt7.1-XZT72772.5                                                                                                                                                                                                                 CCGCATTGGCCGGTAGGGGGCACTGGGACACGCCTTGCAGGAAGATGGCGTAAAGGCACTGCCCGTTGTTTTGGGGAGGAGATTAAGTGGAGGAGCTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTTTTCCTGAGATTGCTAGAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTTTGTTTTTTTTTTAAGTG
                                                  Xt7.1-CHK-1008283786                                                                                                                                                                                                                       TGGCCGGTAGGGGGCACTGGGACACGCCTTGCAGGAAGATGGCGTAAAGGCACTGCCCGTTGTTTTGGGGAGGAGATTAAGTGGAGGAGCTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTCTTCCTGAGATTGCTAGAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTTTGTTTTTTTTTTAAGTGCCAACA
  0   1   1           Gas  FL                     TGas007i24.FL-Sanger                                                                                                                                                                                                                                                                                                                                               CAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTCTTCCTGAGATTGCTAGAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTTGTTTTTTTTTTTTAAGTGCCAACATTTATCTTCCCCCCCCCCCAA
  5   1   2       ext Gas  5g                        TGas064l19.p1cSP6                                                                                                                                                                                     GTTATGTTTCTCCTGAGCTGTGTAGCTGCCGCATTGGCCGGTAGGGGGCACTGGGACACGCCTTGCAGGAAGATGGCGTAAAGGCACTGCCCGTTGTTTTGGGGAGGAGATTAAGTGGAGGAGCTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGT
  5   1   3        nb Egg  5g                        TEgg034i17.p1kSP6                                                                                                                                                                                                                 CCGCATTGGCCGGTAGGGGGCGCTGGGACACGCCTTGCAGGAAGATGGCGTAAAGGCACTGCCCGTTGTTTTGGGGAGGAGATTAAGTGGAGGAGCTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATT
  5   1   2   22  add Gas7 5g                              XZG48026.5p ............................................................................................................................................................................................................................................................................GCCCGTTGTTTTGGGGAGGAGATTAAGTGGAGGAGCTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGTACCCCGCCAGCAAATGCCCTTCAGTGGGGCTATTGTGCCCAAGGTGCCCCTGTGTTCCTGCCAATG
  5   1   2       ext Egg  5g                        TEgg065j11.p1kSP6                                                                                                                                                                                                                                                                                                CCCGGGGCCCGGGGAGCTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTT
  5   1   2   34  ext Brn4 5g                             CAAL11141.5p ....................................................................................................................................................................................................................................................................................................AAGTGGAGGAGCTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGGCATTGCCTAACTCACTGCCAGGAAATAT
  5   1   2       add In66 5x3                        IMAGE:8963935.5p                                                                                                                                                                                                                                                                                                     TTTTTTTTAAAAGTTTTTCATAATTAAAAAATTAAATCCGTCCTGGGTGAAGATGAGCGGGACGGAGACTTGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCTCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCTCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGAGAGCCATGATCCACTCAACGAGCTGAACTGTCTCTTATTGGTATTACTCCCGGGGGGGCATTGCCCAACTTCACTGCCAGGAAATATTGCTTATGGGAAAAGCCCCAGTAATGTACAATGTAATTAAGCTGAATCCCTTTCTCCTGAGATTGCCAGAAAGCTTCATTAGCCCCACCTTTTTTATGGATTTTTGAAGGTCACCAACAGTTATCGTCTTGTCG
  5   1   2       ext Gas  5g3  in                   TGas103a16.p1cSP6                                                                                                                                                                                                                                                                                                               GAGCTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAAAGTTCATCTCTGACATTGCAAATGA
  5   1   3        nb Egg  5g                        TEgg121a14.p1kSP6                                                                                                                                                                                                                                                                                                                CTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCG
  5   1   3        nb Gas  5g                        TGas076h05.p1kSP6                                                                                                                                                                                                                                                                                                                CTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACT
  5   1   3        nb Gas  5g                        TGas028l11.p1kSP6                                                                                                                                                                                                                                                                                                                 CTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGC
  5   1   3        nb Gas  5g                        TGas037m08.p1kSP6                                                                                                                                                                                                                                                                                                                 CTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAAGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCG
  5   1   3        nb Egg  5x3  ?                    TEgg013b06.p1kSP6                                                                                                                                                                                                                                                                                                                   TTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCG
  5   1   0       add Egg  5g3  in                   TEgg013b10.p1kSP6                                                                                                                                                                                                                                                                                                                   TTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTT
  5   1   3        nb Gas  5g                        TGas106j08.p1kSP6                                                                                                                                                                                                                                                                                                                         GGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGT
  5   1   3   32   nb Gas7 5x3  ?                          XZG21650.5p ...........................................................................................................................................................................................................................................................................................................................GTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAA
  5   1   2   20  add Tbd1 5g                             CBXT12992.b1 ..............................................................................................................................................................................................................................................................................................................................GACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGTACCCCGCCAGCAAATGCCCTTCAGTGGGGCTATTGTGCCCAAGGTGCCCCTTTGTTCCGCCCAATGTTACAAGCAGCCAGTGAGAGAGCTCCTAGATCTCCTATACACATCTAGGTATGGGCTGCACCCAATAGAAATGAATGTGCCCTCACATTGCTGCTCCATAGTCAGGGCTGGGGGGCCTTCATCAAACGAAAGATTTTATTTATACTGATAAT
  5   1   2   32  ext Gas7 5g                              XZG45460.5p ................................................................................................................................................................................................................................................................................................................................CGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGNGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGNGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAA
  5   1   3   34   nb Brn4 5g                             CAAL11405.5p ....................................................................................................................................................................................................................................................................................................................................AGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGNGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGNGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAA
  5   1   3   34   nb Te3  5g                              CAAM8729.5p ....................................................................................................................................................................................................................................................................................................................................AGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGNGTATT
  5   1   3        nb Neu  5g                        TNeu035a22.p1kSP6                                                                                                                                                                                                                                                                                                                                        TTCCTGTCCAAGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCC
  5   1   2   33  add Gas7 PIPE                            XZG12354.5p .........................................................................................................................................................................................................................................................................................................................................GTTCTGTCCAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCCCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGNGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCCTTCATCAAACGAAAGATTTTATTTATACTGATAATTATGT
  5   1   2       add Gas7      ?                           XZG6053.5p                                                                                                                                                                                                                                                                                                                                             GCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATTGATCCGCTGACCCCACCGCTTGTCTCTCCTAGAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTTACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGNGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGNGTATTTACCCCCGGNGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGNGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCT
  5   1   3        nb Gas  5g                        TGas128e06.p1kSP6                                                                                                                                                                                                                                                                                                                                              TCCAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAG
  5   1   3        nb Gas  5g                        TGas046m10.p1kSP6                                                                                                                                                                                                                                                                                                                                              TCCAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGC
  5   1   3        nb Gas  FL                        TGas007i24.p1kSP6                                                                                                                                                                                                                                                                                                                                               CAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCC
  5   1   4   32 seed Tad5 5g                              XZT72772.5p ..............................................................................................................................................................................................................................................................................................................................................CAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTC
  5   1   3        nb Gas  5g                        TGas115l14.p1kSP6                                                                                                                                                                                                                                                                                                                                                AAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGC
  5   1   3        nb HdA  5g                       THdA013g02.p1kbSP6                                                                                                                                                                                                                                                                                                                                                   GGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTA
  5   1   3   30   nb Eye  5x3                             CCAX3667.b1 ...................................................................................................................................................................................................................................................................................................................................................GTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTACGCCCGGGGCAAAGACTTTAGTT
  5   1   3        nb Egg  5x3                       TEgg069c22.p1kSP6                                                                                                                                                                                                                                                                                                                                                     ATCCCCGGGGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTC
  5   1   3        nb Gas  5g                        TGas116n06.p1kSP6                                                                                                                                                                                                                                                                                                                                                      TCCCCGGGGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGT
  5   1   3        nb Neu  5g                        TNeu103d15.p1cSP6                                                                                                                                                                                                                                                                                                                                                      GAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAAC
  5   1   3   32   nb Gas7 5g                              XZG38322.5p ........................................................................................................................................................................................................................................................................................................................................................GATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTA
  5   1   3        nb Gas  5x3                       TGas131g09.p1kSP6                                                                                                                                                                                                                                                                                                                                                          AAGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCACGGCACGGATCTCCATGTTA
  5   1   3        nb TbA  5g                        TTbA013g08.p1kSP6                                                                                                                                                                                                                                                                                                                                                          ATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGNGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAATATAAAGCCTGATTCCC
  5   1   3        nb Gas7                                 XZG50588.5p                                                                                                                                                                                                                                                                                                                                                            GAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCTGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAAT
  5   1   3        nb Gas7                                 XZG50270.5p                                                                                                                                                                                                                                                                                                                                                              GCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGNGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCC
  5   1   3        nb Gas7                                 XZG63137.5p                                                                                                                                                                                                                                                                                                                                                              GCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGNGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCA
  5   1   3        nb Egg       ?                    TEgg009h10.p1kSP6                                                                                                                                                                                                                                                                                                                                                               CGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATG
  5   1   3        nb Egg                            TEgg029d01.p1kSP6                                                                                                                                                                                                                                                                                                                                                               CGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGCACCCAAGAGCCAGCGTCCC
  5   1   3        nb Egg                            TEgg048b20.p1kSP6                                                                                                                                                                                                                                                                                                                                                               CGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGG
  5   1   2       ext Neu       in                   TNeu058n18.p1cSP6                                                                                                                                                                                                                                                                                                                                                               CGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGC
  5   1   3        nb Gas                            TGas019e12.p1kSP6                                                                                                                                                                                                                                                                                                                                                               CGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTNTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCC
  5   1   3        nb Gas                            TGas032k16.p1kSP6                                                                                                                                                                                                                                                                                                                                                               CGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCA
  5   1   3        nb Gas                            TGas037m24.p1kSP6                                                                                                                                                                                                                                                                                                                                                               CGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCC
  5   1   3        nb Neu                            TNeu020d11.p1kSP6                                                                                                                                                                                                                                                                                                                                                               CGGGACGGAGACAGCGCCANACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCATCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCNGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCC
  5   1   3        nb Neu                            TNeu034j16.p1kSP6                                                                                                                                                                                                                                                                                                                                                               CGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTNTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGC
  5   1   3        nb Neu                            TNeu039j03.p1kSP6                                                                                                                                                                                                                                                                                                                                                               CGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCC
  5   1   3        nb Gas7                                 XZG22145.5p                                                                                                                                                                                                                                                                                                                                                                GGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGG
  5   1   3        nb Gas                            TGas018g21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                  GACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCC
  5   1   3        nb Gas                            TGas113e13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                             CGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCC
  5   1   3        nb Gas7                                 XZG50427.5p                                                                                                                                                                                                                                                                                                                                                                                                    GCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTCCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGNGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGGTAATATAAAGCCTGATTCCCTTTCTCCTGTGATTGCTAGAAAGCTTCACTGACCCCCCCCAC
  5   1   3        nb Eye                                  CCAX1551.b1                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGAT
  5   1   2       add Egg                            TEgg005e14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGATTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTA
  5   1   2       add Gas6                                 ANBT1173.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGCCGCGGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGTACCCCGCCAGCAAATGCCCTTCAGTGGGGCTATTGTGCCCAAGGTGCCCCTTTGTTCCGCCCAATGTTACAAGCAGCCAGTGAGAGAGCTCCTAGATCTCCTATACACATCTAGGTATGGGCTGCACCCAATAGAAATGAATGTGCCCTCACATTGCTGCTCCATAGTCAGGGCTGGGGGGTAAGTATGTAGAGAGCCGATTGGATAATGATTTTGGGGGTGGGGGTAGAGAGACCCCAGTAACCCCGAGATGATGCCCTCCTGCTCTAGTCCTGTGTCGGTGCCAAGGCACATACTTGGTACTGTCTGGGTCAGCGCC
  5   1   3        nb Egg                            TEgg121o04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCATCCTCGGCTGCTGCCCCCTCCTAGGGATCCCTCTCACATGGCGTGAACCTGCCCCCGGGGGCGGCAAATGGCTATCTTAAAGCTGTGATTTCCACTACCCCCCTGGTGCATTTCCTGATGCAGCTGGAGGACTATACCCCTACTAACTCAGATGCCGTCACTGGATATTACCTGAAC
  5   1   2       add Gas                            TGas068g05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAGTTGCTTTCATTAGTCTTACTGCAGTTATCCAATCAGGCCTGTATGGTGATTACTATGAGTTCAGCACAGCATCTGTATTGACTTCGCTTATTTTGAATTTCACACCGGATCCTCTCGATCTCTGTAGTGATCCGCTGACCCCACCGCTTGTCTCTCCTAGAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGTACCCCGCCAGCAAATGCCCTTCAGTGGGGCTATTGTGCCCAAGGTGCCCCTTTGTTCCGCCCAATGTTACAAGCAGCCAGTGAGAGAGCTCCTAGATCTCCTATACACATCTAGGTATGGGCTGCACCCAATAGAAATGAATGTGCCCTCACATTGCTGCTCCATAGTCAGGGCTGGGGGGTAAGTATGTAGGGAGCCGATTGGATAATGATTTGGGGGTGGGGGGTAGAGAGACCCCAGTACCCCGAGATGATGCCCTTCTGCTCTAGTCCTGTGTCGGTGCCAAGGCACATACTTGGTAC
  5   1   3        nb Egg                            TEgg136n06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGGCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTCTTCCTGAGATTGCTA
  5   1   3        nb Neu                            TNeu043k02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTCTTCCTGAGATTGCTAGAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTTGTTTTTTTTTTTAAGTGCCAACATTT
  3   1   2       ext Gas  5g3  in                    TGas103a16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTGACATTGCAAATGACCCCTTGCACCACTTTAAAATGAAGGGGACGGCTTCCGGGAGTTTTTGCAGCAAAAGCAAGGATAAGAAATACCCTTTCCTTATGGAAGACCTGATTCCGGCGCTGGGGGAATATGGCATCAACGTAAAAAAGCCCCATTTTTTCCCCTAGGGTTTTGGCCCAGGGGGTTTTCCCGTTTCCCACGGACTGGGGGCAGGGATTTCCATTTTACCCCCGGGGCAAAAAACTTTTAGTTCCCCTGAGGATTTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCCCTCCCCGAGGTGAACTTTTTTTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAATTCATTCCCAGGAAATATTTGGTTTAATGGGAAAAACCCCCAGTAATGTACCAGTGTAAATATAAACCCTGATTCCCTTTTTCCTGAGATTGTTAGAAAGTTTCATTAACCCCCCCCACTTTTTTTTTTTTTGTTTTTTTTTTTTTAAGTGCCAACATTTTTTTCCCCCCCCCCCACTCCTGGGGAATTATATATAGTATATAAAGCCCCCAAACTGAGATTTTTTAAAATGGGGGGGGGGGGGCCCTTCTTCAAACGAAAGATTTTATTTATACTGATAATTATGTGGTAGAAAGCCAATAAAGTTTGTTTTTGTTTCCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       ext Neu       in                    TNeu058n18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCATTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATTTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGTTGAACTGTCTTTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTTTTCCTGAGATTGCTAGAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTTGTTTTTTTTTTTAAGTGCCAACATTTATCTCCCCCCCCCCCCACTCCTGGGGAACTATATATAGTATATAAAGGCCACAAACTGAGAGTTTGTAGAATGGGGGGGGGGGGGGCCTTCATCAAACGAAAGATTTTATTTATACTGATAATTATGTGGTAGAAAGCAATAGTGTAGATGTTTTTGTTTCCAAAAAAAAAAAAAAAAAAAAA
  5   1   2       add Gas                            TGas066d17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTCTTCCTGTGATTGCTAGAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTTTGTTTTTTTTTTTTTTTAAGTGCCAACATTTATCTTCCCCCCCCCCCCCCCACTCCTGGGGAACTATATATAGTATATAAAGGCCACAAACTGAGAGTTTGTAGAATGGGGGGGGG
  5   1   3        nb Gas                            TGas130p05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTCTTCCTGTGATTGCTAGAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTTTGTTTTTTTTTTTTTTTAAGTGCCAACATTTATCTTCCCCCCCCCCCCCC
  5   1   2  SIG                                    Xt7.1-TTpA068n13.5                                                                                                                                                                                                                                                                                                                                                        CACGCCTTGCAGGAAGATGGCGTAAAGGCACTGCCCGTTGTTTTGGGGAGGAGATTAAGTGGAGGAGCTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTCTTCCTGAGATTGCTAGAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTGTTTTTTTTTTTTAAGTGCCAACATTTATCTTCCCCCCCCCCCCCCCCCACTCCTGGGGAACTATATATAGTATATAAAGGCCACAAACTGAGAGTTTGTAAAATGGGGGGGGGGGGTTCATTAACCCCCCACACTTTTTTTTTTTTGATTTTTTTTTTAAAGAACCAACATTTTTTTCCCCCCCCCCCCATTCCTGGGGAACTATATTTAGTATATAAAGGCCCCAAACTGAAATTTTTTAAAATGGGGGGGGGGGGGCCCTTCATCAAACGAAAGATTTTATTTATACTGAAAATTATGGGGAGAAAGCAATAAAGTTGTTTTTTTTCCAAAAAAAAAAAAAAAAAAAAATAAAA
                                                  Xt7.1-CHK-1008283784                                                                                                                                                                                                                                                                                                                                                              TTGCAGGAAGATGGCGTAAAGGCACTGCCCGTTGTTTTGGGGAGGAGATTAAGTGGAGGAGCTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTCTTCCTGAGATTGCTAGAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTGTTTTTTTTTTTTAAGTGCCAACATTTATCTTCCCCCCCCCCCCCCCCCACTCCTGGGGAACTATATATAGTATATAAAGGCCACAAACTGAAAGTTTGTAAAATGGGGGGGGGGGGxxxxTTAACCCCCCACACTTTTTTTTTTTTGATTTTTTTTTTAAAGAACCAACATTTTTTTCCCCCCCCCCCCATTCCTGGGGAACTATATTTAGTATATAAAGGCCCCAAACTGAAATTTTTTAAAATGGGGGGGGGGGGGCCCTTCATCAAACGAAAGATTTTATTTATACTGAAAATTATGGGGAGAAAGCAATAAAGTTGTTTTTTTTCCAAAAAAAAAAAAAAAAAAAAATAAAAAAAAAA
  5   1   2       ext Te5                                  CAAO1832.5p                                                                                                                                                                                                                                                                                                                                                        CACGCCTTGCAGGAAGATGGCGTAAAGGCACTGCCCGTTGTTTTGGGGAGGAGATTAAGTGGAGGAGCTGTTTCCGGGTGTTGACGGAAGTTCCTGTCCAAGGGTGAAGATGAGCGGGACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTGATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGNGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTG
  5   1   4      seed TpA       in                   TTpA068n13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACGGAGACAGCGCCAGACTCTCTATCTGCTATTGCCTCAGTCCAGCCCGGTCCGGCCCCAGAGAGTAAGCCCAGCCCGGCAAACATTCCCAAACCCGGGCCTGCCGCGGCCTCTGCAGCTGCTCTACCCGGGAGGGACACGGGGGAGCGAAGAGCCAGCGTTCCTGCATCAGCGGCTGCTGCCCCCTCCGAGGGATCCCTCTCTAATGGCGTGTACCTGCCCCCGGGGGTGGCAAATGGCGATGTCAAACCTGTCATTTCCACTACCCCCCTGGTGGATTTCCTGATGCAGCTGGAGGACTATACCCCTACGATCCCAGATGCCGTCACTGGATATTACCTGAACCGGGCCGGGTTTGAAGCATCCGACCCACGCATAATCCGGCTGATCTCCTTGGCATCTCAGAAGTTCATCTCTGACATTGCAAATGACGCCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCNCACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTCTTCCTG
  5   1   2       ext Tad5                                 XZT56136.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTTGCAGCACTGTAAGATGAAGGGGACGGCCTCCGGGAGCTCTCGCAGCAAAAGCAAGGATAAGAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTCTTCCTGAGATTGCTAGAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTGTTTTTTTTTTTAAGTGCCAACATTTATCTTCCCCCCCCCCCCCCCCCACTCCTGGGGAACTATATATAGTATATAAAGGCCCCAAACTGAAAGTTTGTAAAATGGGGGGGGGGGGGGGGTTAA
  5   1   2       ext Gas7                                 XZG53774.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAATACACTCTCACTATGGAAGACCTGACTCCGGCGCTGGCGGAATATGGCATCAACGTAAAGAAGCCGCACTATTTCACCTAGCGCTTCGGCCCAGCGGGCTTTCCCGTATCCCACGGACTGGCGGCACGGATCTCCATGTTACGCCCGGGGCAAAAGACTTTTAGGTCCCCTGAGGATCTTTATTGGGCTCACGTCATTGGTGGAGAGCCATGATCCACTCACCGAGCTGAACTGTCTCTATTGGGTATTTACCCCCGGGGGGGCATTGCCCAACTCACTGCCAGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTCTTCCTGAGATTGCTAGAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTGTTTTTTTTTTTTAAGTGCCAACATTTATCTTCCCCCCCCCCCCCCCCCACTCCTGGGGAACTATATATAGTATATAAAGGCCACAAACTGAGAGTTTGTAAAATGGGGGGGGGGGGGGGTTTAAAGGGGGGGGGGGCCCTTCCCCAACAAAAAAATTTTTTTTTACCGGGAAATTTGGGGGAAAA
  5   1   3        nb Neu                            TNeu029n17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTTTTTTTGTTTTTTTTTTTAAATGCCAACATTTATCTTCCCCCCCCCCCCCCCCCCCACTCCTGGGGAACTATATATAGTATATAAAGGCCACAAACTGAAAGTTTGTAAAATGGGGGGGGGGGG
  3   1   4      seed TpA       in                   TTpA068n13.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCCGGGGGGACTTTTCCCAACTCCATGCCGGGAAATTTTTGTTTTAATGGGAAAAAGCCCCCTTAATCTACCAGTTTAAATATAAACCCGGATTCCTTTTTTCCGGAGATTGCTAAAAAGCTTCATTAACCCCCCACACTTTTTTTTTTTTGATTTTTTTTTTAAAGAACCAACATTTTTTTCCCCCCCCCCCCATTCCTGGGGAACTATATTTAGTATATAAAGGCCCCAAACTGAAATTTTTTAAAATGGGGGGGGGGGGGCCCTTCATCAAACGAAAGATTTTATTTATACTGAAAATTATGGGGAGAAAGCAATAAAGTTGTTTTTTTTCCAAAAAAAAAAAAAAAAAAAAATAAAAAAAAAAAA
  5   1   0       chi TbA       out                  TTbA002b03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCAACTCACTGCCGGAAATATTTGGCTTAATGGGAAGAAGCCCCAGTAATGTAGCAGTGTAAATATAAAGCCTGATTCCCTTCTTCCTGAGATTGCTAGAAAGCTTCATTAACCCCCCACAGCTTTTTTTTTTTTGTTTTTTTTTTTAAGTGCCAACATTTATCTCCCCCCCCCCCCACTCCTGGGGAACTATATATAGTATATAAAGGCCACAAACTGAGAGTTTGTCAATGGGGGGGGGGGGCACGATACGGGTGTAGTTCTGGAAGGCCTTCTGAAAAGAACTTGTATGCTGACATTGATGCAGCATGGCATGCTCTCCGGACAAGGTATGGAATCAGTCCAGAAAACATCCTTCTTTATGGCCAAAGTATTGGCACAGTCCCAGCTGTGGATTTAGCATCCCGTTATGAGTGCGCTGCTGTAATCCTGCATTCAGCTCTAACCTCTGGTATGCGGGTCGTCTTGCCGGACACTAAGAAAACCTATTGCTTTGATGCCTTCCCAAATATTGATAAAGTGTCAAAGATAACTTCCCCAGTACTGATAATGCATGGGACAGAAGATGAAGTCATTGATTTCTCGCATGGCTTGGCACTGTATGAACGATGTCCCAAGACGGTGGAGCCTCTGTGGGTAGAAGGAGCTGGACATAATGACATTGAACAATACAGTCAATACTTGGAGCGTCTAAAACGCTTTATCACACAAGAGCTGGTTTCTCAAAACAGTAACTGATGTCCAACCTTGCTATTTCCGTTCTCCCTACTTTGATTTATCCCAAATCAAACTTTCTGACTTTATGATCTCTGTATC
  3   1   0       add Egg  5g3  in                    TEgg013b10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTCCTGGGGAACTATATATAGTATATAAAGCCCACAAAGGAGAGTGTAGAAGGGGGGGGGGGGGGGGTTGAAGGGGGGGGGCCTCTCATCAAACGAAAGATTTTATTTATACTGATAATTACTGTGTAGAAAGCAATAAACTCTGTTTTTTTTCCAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)