Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK2702.5                            3 END     2           1       66                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012071605 Xt7.1-CABI13495.3.5 - 164 ESTs
                                                                       .....-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960......4970......4980......4990......5000......5010......5020......5030......5040......5050......5060......5070......5080......5090......5100......5110......5120......5130......5140......5150......5160......5170......5180......5190......5200......5210......5220......5230......5240......5250......5260......5270......5280......5290......5300......5310......5320......5330......5340......5350......5360......5370......5380......5390......5400......5410......5420......5430......5440......5450......5460......5470......5480......5490......5500......5510......5520......5530......5540......5550......5560......5570......5580......5590......5600......5610......5620......5630......5640......5650......5660......5670......5680......5690......5700......5710......5720......5730......5740......5750......5760......5770......5780......5790......5800......5810......5820......5830......5840......5850......5860......5870......5880......5890......5900......5910......5920......5930......5940......5950......5960......5970......5980......5990......6000......6010......6020......6030......6040......6050......6060......6070......6080......6090......6100......6110......6120......6130......6140......6150......6160......6170......6180......6190......6200......6210......6220......6230......6240......6250......6260......6270......6280......6290......6300......6310......6320......6330......6340......6350......6360......6370......6380......6390......6400......6410......6420.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CABI13495.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGTCTCTTAAATAACGAAATGATCATGCGCTCTTCAGTTCTCAAACAAGCGCACCACAAAGTTAAGATCGCCAATGGAAAAAAGCCTTAACTAGCTGCTCTGACAGTCTCTGGCACTGCAAGTCAATGGTAAACTTGGGAGCAAAACACAGGCTTGTTTGTTTCTGCTTCCGTCTGTGCTCTATATACGACCTGCTCAACATTTTACAATAAGCATCTCAACATGGACAATTATGTTACGAATATTGCAAAACCTAACATGTCTTCAGCTTTCTCCTGGTTGTGGTCCCTTTAATAAAAGGGAAAGAGTTTGTTTTGGATCTGTTACTGTGCTATTAGGAATCAGGCCATGGCTGCCAAATTTTACAGAAAATTGTGTTACTCAGCTGGCTTAGGTGCCATGAATACCATCATCGAAAAGTTTTGGACAGCCAATGATATTCAATTTTTTAACCTGATTTATCTTTTTAAATATTGTATTGTTCTATTATCACCTTATAATGATAAAAGAGTGTTTTGAAGTGTATATTTTGGTTTTATCACACATACTTGCTGTTTATTTATAACCCCTTTGTGTTAGTGACTGCATACTGTGTTTATCTATTTATGTATTTGCAGTATGTTTTTAACACAAAGACCACCACAGCATTACTGTCACAATGGGGTTAGTAGAGGAAAATAAAACACAACCAGAAAAAAGTTTTTGTCCTAAAAAGAAATGTTTAAAAATATTGGTTTATCAATAGTTTTTGTATTTTTATGGTTAATTCTTTTGGATGTTAGACACAAGATATGTAAAGAGAACAAAGCATTTTTACATTACTGTGTGATCACAGACTGGCTAGACTTTCAAGCACTCCTTGAGAAAAAGGTATTCCCAAAATTATATTCTTGAACAAAGCTCTATTTAAGGTGGTCCTGCACTGTAAGATCCACTATTTGGACAAGAAGACATTGGGCTGATCTGATCATCTGATCCCCAGGCCAACAATTTGATCAGAATGGGGGCCTAGGGATATGGTTCTCATATGATTTTGTAACCTGCCCTGATTTTCTGGCACATATCAGTAAAAAAGACATTAGAATGGCACCATACATGGGCCAAAATGTTGACAACTTGGTCTGGAGGGGCTGAGATGGCAGCTTTTATCAATTTGTGTATGTGCACCTTTACTTGAATATTGATGTTGCTGGATTCTGAAAACATGTCTCCCTGTCTATCTGTAATGTAACGTTAGAGGTATTTTTTTTTTTATAAAAAAAAAAAACCTACAAGTACTGATTATTTACTCGGTATGTGGTACAGGTTCCGTGCATGGAATGGTAAACAGAAATGGCTGTGTGAGTTTTATGGTATTGCCTTAACCTGATTCAAATATATAAATGGCACAAGCTAGTTAAGAGACATTTCCTGAAAATTGAAGCCTGCTCTTACACATGGGCTGTGTTAAACAGTGTAATTTTACTTAAAATATAAGCTTCATATGCACAATGGCAGTATCTTTCTTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTCTTCATTACTCATCAGCTCTTTTGGTCAGTCACTTCTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAAAACAAATCAATCCTTACTAAATCCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAGAAAAAGAAAAAATAAAGCGGAAAATCCCAACTAACACAAAGTGACATTGATGCCCTATCTAGGTTTTGGTGGAAGGTACCAGAATCGTTGACGAGTTCGTTTCGGTGAGTTGTTGGGCGACACGGCTGCACTTCGATATTGGCAGTTAAGGAGTTGTTTTCCCTTGTTGCCGTGGACTGATTTTGTGACAGCAAGTACTTTATTTGAGATAATCTGTCCAAAATGCCTGGCAGGAAAAGGCCTGTCCTGTGTCAGCCATGGGAAGAGGATGAGTGCCTGGACTACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCCCAACTAACACAAAGTGACATTGATGCCCTATCTTTCCTGCTCCATGAAACACACCCCTTTACACATCCCTTGGATCCCCAGCTATGGACAGCTGAAGACGAGAGTGGTGAAGCAATGCCTAACAGTGCCTTGCTATCAGCTTGGCAAAGGTTGAATCGTGACAGTAGGACACTTAATGAGAATAAGTTGGACTCTCCAGATCTTCAACCCAAGGATGGGACTGAGCTACTGCTTAAACTTGAGAGAATGGGAAAATGTGATGAGAGCAACTTTACACATCTCTTGCAACTGTTACGTGTATTAACACGTCATGACCTGCTCCCATATGTTTCCATGAAAAGACCCCGCACAGTGTCCCCTGAGAGGTATACACATGGCCCATCTATATTGGATTCTGACAAGCAAATGGATAAATGTCTTAACCCAACCCCTTCAGGCACCAGTGAAGAAAACTGGGAAACAGGGTCTAACGCCAGCAAAAGAAAGAGAAGCGGGACTTGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAATGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAACAAAAAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTTATGCCATCCGTGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTC
                                                  Xt7.1-CHK-1008222163                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTTAAATAACGAAATGATCATGCGCTCTTCAGTTCTCAAACAAGCGCACCACAAAGTTAAGATCGCCAATGGAAAAAAGCCTTAACTAGCTGCTCTGACAGTCTCTGGCACTGCAAGTCAATGGTAAACTTGGGAGCAAAACACAGGCTTGTTTGTTTCTGCTTCCGTCTGTGCTCTATATACGACCTGCTCAACATTTTACAATAAGCATCTCAACATGGACAATTATGTTACGAATATTGCAAAACCTAACATGTCTTCAGCTTTCTCCTGGTTGTGGTCCCTTTAATAAAAGGGAAAGAGTTTGTTTTGGATCTGTTACTGTGCTATTAGGAATCAGGCCATGGCTGCCAAATTTTACAGAAAATTGTGTTACTCAGCTGGCTTAGGTGCCATGAATACCATCATCGAAAAGTTTTGGACAGCCAATGATATTCAATTTTTTAACCTGATTTATCTTTTTAAATATTGTATTGTTCTATTATCACCTTATAATGATAAAAGAGTGTTTTGAAGTGTATATTTTGGTTTTATCACACATACTTGCTGTTTATTTATAACCCCTTTGTGTTAGTGACTGCATACTGTGTTTATCTATTTATGTATTTGCAGTATGTTTTTAACACAAAGACCACCACAGCATTACTGTCACAATGGGGTTAGTAxAGxxxAATAAAACACAACCAGAAAAAAGTTTTTGTCCTAAAAAGAAATGTTTAAAAATATTGGTTTATCAATAGTTTTTGTATTTTTATGGTTAATTCTTTTGGATGTTAGACACAAGATATGTAAAGAGAACAAAGCATTTTTACATTACTGTGTGATCACAGACTGGCTAGACTTTCAAGCACTCCTTGAGAAAAAGGTATTCCCAAAATTATATTCTTGAACAAAGCTCTATTTAAGGTGGTCCTGCACTGTAAGATCCACTATTTGGACAAGAAGACATTGGGCTGATCTGATCATCTGATCCCCAGGCCAACAATTTGATCAGAATGGGGGCCTAGGGATATGGTTCTCATATGATTTTGTAACCTGCCCTGATTTTCTGGCACATATCAGTAAAAAAGACATTAGAATGGCACCATACATGGGCCAAAATGTTGACAACTTGGTCTGGAGGGGCTGAGATGGCAGCTTTTATCAATTTGTGTATGTGCACCTTTACTTGAATATTGATGTTGCTGGATTCTGAAAACATGTCTCCCTGTCTATCTGTAATGTAACGTTAGAGGTATTTTTTTTTTTATAAAAAAAAAAAACCTACAAGTACTGATTATTTACTCGGTATGTGGTACAGGTTCCGTGCATGGAATGGTAAACAGAAATGGCTGTGTGAGTTTTATGGTATTGCCTTAACCTGATTCAAATATATAAATGGCACAAGCTAGTTAAGAGACATTTCCTGAAAATTGAAGCCTGCTCTTACACATGGGCTGTGTTAAACAGTGTAATTTTACTTAAAATATAAGCTTCATATGCACAATGGCAGTATCTTTCTTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTxxxxxxTACTCATCAGCTxTTxTxGTCAGTCACTTCxxxxxxAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAAxTAxAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCxCAxAAACAAATCAATCCTTACTAAATCxxxxxxTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAGAAAAAGAAAAAATAAAGCGGAAAAxxxxxACTAACACAAAGTGACATTGATGCCCTATCTxxxxTxTGGTGGAAGGTACCAGAATCGTTGACGAGTTCGTTTCGGTGAGTTGTTGGGCGACACGGCTGCACTTCGATATTGGCAGTTAAGGAGTTGTTTTCCCTTGTTGCCGTGGACTGATTTTGTGACAGCAAGTACTTTATTTGAGATAATCTGTCCAAAATGCCTGGCAGGAAAAGGCCTGTCCTGTGTCAGCCATGGGAAGAGGATGAGTGCCTGGACTACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCCCAACTAACACAAAGTGACATTGATGCCCTATCTTTCCTGCTCCATGAAACACACCCCTTTACACATCCCTTGGATCCCCAGCTATGGACAGCTGAAGACGAGAGTGGTGAAGCAATGCCTAACAGTGCCTTGCTATCAGCTTGGCAAAGGTTGAATCGTGACAGTAGGACACTTAATGAGAATAAGTTGGACTCTCCAGATCTTCAACCCAAGGATGGGACTGAGCTACTGCTTAAACTTGAGAGAATGGGAAAATGTGATGAGAGCAACTTTACACATCTCTTGCAACTGTTACGTGTATTAACACGTCATGACCTGCTCCCATATGTTTCCATGAAAAGACCCCGCACAGTGTCCCCTGAGAGGTATACACATGGCCCATCTATATTGGATTCTGACAAGCAAATGGATAAATGTCTTAACCCAACCCCTTCAGGCACCAGTGAAGAAAACTGGGAAACAGGGTCTAACGCCAGCAAAAGAAAGAGAAGCxxxxxxTGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAATGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAACAAAAAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTTATGCCATCCGTGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTCATTTTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       3     4     3     4     3     4     3     4     3     4     5     5     5     5     6     6     6     6     6     6     6     6     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     2     4     2     4     2     4     2     4     3     5     3     5     3     5     3     5     4     6     4     6     4     6     4     6     4     6     4     6     4     6     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     6     7     6     7     8     9     8     9     8    10     8     9     9    10    10    12    13    13    14    15    15    17    16    18    16    18    16    18    16    18    18    20    19    22    19    22    19    22    20    22    23    25    23    25    23    25    23    25    23    25    23    25    23    25    22    24    22    24    22    24    22    24    22    24    22    24    22    24    22    25    22    25    22    25    22    25    22    26    22    26    22    26    22    26    22    26    23    27    22    26    22    26    21    26    21    25    21    25    21    25    21    25    21    25    21    25    21    26    21    26    22    27    22    27    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    28    23    29    22    30    22    34    23    34    20    33    23    35    23    37    14    29    13    26    13    27    14    27    15    28    15    29    15    29    15    29    15    28    15    30    15    30    15    30    15    30    15    30    15    30    16    31    16    31    16    31    16    31    15    31    15    31    16    32    16    32    16    32    16    32    16    32    18    34    18    34    18    33    17    32    18    33    18    33    18    33    18    33    18    33    18    33    18    33    18    33    18    33    18    33    18    33    18    33    17    32    17    32    17    32    17    33    16    33    16    34    16    34    15    34    15    34    14    32    14    32    14    32    14    32    13    31    13    31    13    31    13    31    12    30    12    30    13    31    12    30    12    30    12    30     9    13     7    12     5    11     4     9     4    11     4    13     5    15     6    17     8    19     8    19     8    20     8    20     8    20     8    20     8    20    10    21    11    22    11    22    11    22    11    22    11    22    11    22    11    23    11    22    11    22    11    22    11    23    11    23    11    23    11    23    11    23    11    23    11    24    11    25    11    25    12    26    12    26    12    25    12    23    12    23    12    23    12    23    12    22    12    23    12    23    12    23    12    22    12    24    11    23    12    24    12    24    12    24    12    24    12    24    12    24    12    25    12    25    12    25    12    25    12    25    12    25    12    25    13    25    13    25    12    24    11    24    11    24    11    26    11    26    11    26     9    23     9    21     9    19    11    21    12    21    12    21    12    20    12    20    12    20    12    21    12    20    12    20    12    20    12    20    12    20    12    20    12    21    12    21    13    21    12    20    13    21    13    20    13    20    13    20    13    20    13    20    13    21    13    21    12    20    12    21    12    21    12    20    12    21    13    21    13    21    12    20    12    20    12    20    12    19    12    18    12    18    12    18    12    18    13    20    13    20    13    18    13    18    13    18    13    18    13    18    12    16    12    17    12    17    13    18    13    18    13    18    13    18    13    18    14    19    10    16    10    15     9    15     9    15     9    16    10    16    10    16     8    14     8    14    10    16    11    17    12    18    12    18    18    26    20    26    21    27    24    29    23    29    25    28    27    32    31    32    30    32    31    32    34    35    33    35    38    39    41    42    41    42    42    43    43    44    43    44    43    44    45    46    47    48    47    48    47    48    45    46    45    46    45    46    45    46    45    46    45    46    45    46    45    46    45    46    47    48    47    48    47    48    47    48    47    48    47    48    47    48    47    48    47    47    46    46    46    46    45    46    45    46    45    46    46    46    46    46    46    46    45    46    45    45    42    43    42    43    41    42    41    42    41    42    41    42    41    42    41    42    41    42    41    42    40    42    40    42    40    42    39    41    39    41    39    41    35    41    35    41    37    39    18    21    15    15    10    14    10    14    10    14    10    14    10    14    10    14     9    13
  5   1   2  SIG                                     Xt7.1-CABI13495.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCCTTAACTAGCTGCTCTGACAGTCTCTGGCACTGCAAGTCAATGGTAAACTTGGGAGCAAAACACAGGCTTGTTTGTTTCTGCTTCCGTCTGTGCTCTATATACGACCTGCTCAACATTTTACAATAAGCATCTCAACATGGACAATTATGTTACGAATATTGCAAAACCTAACATGTCTTCAGCTTTCTCCTGGTTGTGGTCCCTTTAATAAAAGGGAAAGAGTTTGTTTTGGATCTGTTACTGTGCTATTAGGAATCAGGCCATGGCTGCCAAATTTTACAGAAAATTGTGTTACTCAGCTGGCTTAGGTGCCATGAATACCATCATCGAAAAGTTTTGGACAGCCAATGATATTCAATTTTTTAACCTGATTTATCTTTTTAAATATTGTATTGTTCTATTATCACCTTATAATGATAAAAGAGTGTTTTGAAGTGTATATTTTGGTTTTATCACACATACTTGCTGTTTATTTATAACCCCTTTGTGTTAGTGACTGCATACTGTGTTTATCTATTTATGTATTTGCAGTATGTTTAACACAAAGACCACCACAGCATTACTGTCACAATGGGGTTAGTATAGAGGAAAATAAAACACAACCAGAAAAAAGTTTTTGTCCTAAAAAGAAATGTTTAAAAATATTGGTTTATCAATAGTTTTTGTATTTTTATGGTTAATTCTTTTGGATGTTAGACACAAGATATGTAAAGAGAACAAAGCATTTTTACATTACTGTGTGATCACAGACTGGCTAGACTTTCAAGCACTCCTTGAGAAAAAGGTATTCCCAAAATTATATTCTTGAACAAAGCTCTATTTAAGGTGGTCCTGCACTGTAAGATCCACTATTTGGACAAGAAGACATTGGGCTGATCTGATCATCTGATCCCCAGGCCAACAATTTGATCAGAATGGGGGCCTAGGGATATGGTTCTCATATGATTTTGTAACCTGCCCTGATTTTCTGGCACATATCAGTAAAAAAGACATTAGAATGGCACCATACATGGGCCAAAATGTTGACAACTTGGTCTGGAGGGGCTGAGATGGCAGCTTTTATCAATTTGTGTATGTGCACCTTTACTTGAATATTGATGTTGCTGGATTCTGAAAACATGTCTCCCTGTCTATCTGTAATGTAACGTTAGAGGTATTTTTTTTTTTATAAAAAAAAAAAACCTACAAGTACTGATTATTTACTCGGTATGTGGTACAGGTTCCGTGCATGGAATGGTAAACAGAAATGGCTGTGTGAGTTTTATGGTATTGCCTTAACCTGATTCAAATATATAAATGGCACAAGCTAGTTAAGAGACATTTCCTGAAAATTGAAGCCTGCTCTTACACATGGGCTGTGTTAAACAGTGTAATTTTACTTAAAATATAAGCTTCATATGCACAATGGCAGTATCTTTCTTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAGAAAAAGAAAAAATAAAGCGGAAAAAAATCACTAAATAAGCGTATGTAACAAGACAATTTTATTTATAAAGATACCTGTATTAGTTGTTTTGGACATAGGATTTTTTTTTCTATTTTTTTTTTGGTTTAGACCCAAGAAATCGGTATGAAGAAAACAAATCCAGTATAAATGTTCTGACTGAACCATTTATTCAGCTGACCATTTTAAATCTAACTGTTGCTACAGTTCTCTTCAGTGAGCCAAACCAGCAGTATACCATGCTAAGAATTATTGCAGTGTGTTTTCTTTCATCATTTTGTGTAAGAGGGGCTGTCCTAATGTTAGGCCTTATGGAAAATGTCACTGAAAATGGCACTTTAAAGAAATCTGGATTTGAAATTTCAAAAGTTGGCCTGCTCCTATATGCTTTTATTGATTGTTATACTTAATGCTTTTTTGGAGCTATACTGGGTCCTTCTTATCTAGAAAAAAATTAAGTTACCAAGTTTTAATTCTTGCATGACCTAATTTCATTCATGAATGAATGTCTGTAATCTTAAATTCCCAATTTTAATAGATTCTGTTTTTCTCCTCCCTTCCCCTTTCTCCCTTTGTCCCGTTGCCCTTTCTTCTAGGAATACGCTTACGTGTGCGAGCAGAGTACTGCCAACATGACTCAGTCTTGAGTCAAAACGTGCTGTCTGTCAAGCAGAACCTGTTGGAGAAGCAGTTTGATCTGTTCAGCCAGTCAAACACGGTTCTGAAATCCCGGGACCTTGGCTCAATTATTTGTGACATCAAGTTCTCTGAGATTTCCTACCTGGATGCATTCTGGACTGATTATATGAATGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAATGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAACAAAAAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTTATGCCATCCGTGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTC
  5   1   2  SIG                                     Xt7.1-CAAJ14334.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTGCAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAGTATGACTTTACCAACTAGAACAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAGTTTTGGTGGAAGGTACCAGAATCGTTGACGAGTTCGTTTCGGTGAGTTGTTGGGCGACAGCGCAGTGGCAGGTTTTGGTGGAAGGTACCAGAATCGTTGACGAGTTCGTTTCGGTGAGTTGTTGGGCGACACGGCTGCACTTCGATATTGGCAGTTAAGGAGTTGTTTTCCCTTGTTGCCGTGGACTGATTTTGTGACAGCAAGTACTTTATTTGAGATAATCTGTCCAAAATGCCTGGCAGGAAAAGGCCTGTCCTGTGTCAGCCATGGGAAGAGGATGAGTGCCTGGACTACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCCCAACTAACACAAAGTGACATTGATGCCCTATCTTTCCTGCTCCATGAAACACACCCCTTTACACATCCCTTGGATCCCCAGCTATGGACAGCTGAAGACGAGAGTGGTGAAGCAATGCCTAACAGTGCCTTGCTATCAGCTTGGCAAAGGTTGAATCGTGACAGTAGGACACTTAATGAGAATAAGTTGGACTCTCCAGATCTTCAACCCAAGGATGGGACTGAGCTACTGCTTAAACTTGAGAGAATGGGAAAATGTGATGAGAGCAACTTTACACATCTCTTGCAACTGTTACGTGTATTAACACGTCATGACCTGCTCCCATATGTTTCCATGAAAAGACCCCGCACAGTGTCCCCTGAGAGGTATACACATGGCCCATCTATATTGGATTCTGACAAGCAAATGGATAAATGTCTTAACCCAACCCCTTCAGGCACCAGTGAAGAAAACTGGGAAACAGGGTCTAACGCCAGCAAAAGAAAGAGAAGCGGGACTCAAAAAAGGGGTCGCTGCCCCAAACCAAAGAGAAATAAAGCGAGCAACACTCCCTCGCAGAATCCAATTAACCAGAGCAAAGTAACATGTGGTAAGTTGTATTCAGGCTATGTCTTTGGCCATAATCTAATGGAAGTAAATATCTTACTGTAAAAGGTGGGAAACCTATGCATATAGTTTTTTCCCACTTAAAGAAAATATTATTACAACAGCTATAAACTATAAGACAAGCTGGCATTTAAAGGGGTTTATATAAAGATAGGCACATCAAGAGCAAAAATTATGTAAGAATTAGTTAAACTTTACTAGTTGCTCTTGTCAAATATCCCTAACTGTGGAAACTCAATGGCTCAGTTGCTTTATGTGGTTTAGTACTAAGGTTCTGTAGTTTAAACACTTATGTACTTCTTGTGTGTCTACAGCATTGTTGCCTTTACCTTCTGAAGGCAGAATCTGTATCTCTTTTGTGTCATTTCACTAACAAATTTTTACCACTGGCCTTCAACACATTGTAAAGATTTTTTGTCTTTATATGGTTGAATTAACTTGCTCTTCCATATCGCTTTTGAAGAAAGCTCTAACTATCTGAGAATTTCCACCACTGCCTCACTGCATTGTTTATTGCCCACAGAGAGCAAAATGAAGATCAAGTCAAATAATATAGTGATTTTGCAAACAACTGATGTTTCTGGCACTTAAAAACTTTTATT
  5   1   2                                           Xt7.1-CBSS3115.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTGCAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAGTATGACTTTACCAACTAGAACAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTT
  5   1   2  SIG                                     Xt7.1-CAAK10103.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAACCCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTC------------------------TGGCAGGTTTTGGTGGAAGGTACCAGAATCGTTGACGAGTTCGTTTCGGTGAGTTGTTGGGCGACACGGCTGCACTTCGATATTGGCAGTTAAGGAGTTGTTTTCCCTTGTTGCCGTGGACTGATTTTGTGACAGCAAGTACTTTATTTGAGATAATCTGTCCAAAATGCCTGGCAGGAAAAGGCCTGTCCTGTGTCAGCCATGGGAAGAGGATGAGTGCCTGGACTACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCCCAACTAACACAAAGTGACATTGATGCCCTATCTTTCCTGCTCCATGAAACACACCCCTTTACACATCCCTTGGATCCCCAGCTATGGACAGCTGAAGACGAGAGTGGTGAAGCAATGCCTAACAGTGCCTTGCTATCAGCTTGGCAAAGGTTGAATCGTGACAGTAGGACACTTAATGAGAATAAGTTGGACTCTCCAGATCTTCAACCCAAGGATGGGACTGAGCTACTGCTTAAACTTGAGAGAATGGGAAAATGTGATGAGAGCAACTTTACACATCTCTTGCAACTGTTACGTGTATTAACACGTCATGACCTGCTCCCATATGTTTCCATGAAAAGACCCCGCACAGTGTCCCCTGAGAGGTATACACATGGCCCATCTATATTGGATTCTGACAAGCAAATGGATAAATGTCTTAACCCAACCCCTTCAGGCACCAGTGAAGAAAACTGGGAAACAGGGTCTAACGCCAGCAAAAGAAAGAGAAGCGGGACTCAAAAAAGGGGTCGCTGCCCAAACCAAAGAGAAATAAAGCGAGCCAACACTCCCTCGCAGAATCCAATTAACCAGAGCAAAGTAACATGTGGTAAGTTGTATTCAGGCTATGTCTT
  5   1   2  SIG                                     Xt7.1-CAAJ12141.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGCGCAGTGGCAGGTTTTGGTGGAAGGTACCAGAATCGTTGACGAGTTCGTTTCGGTGAGTTGTTGGGCGACACGGCTGCACTTCGATATTGGCAGTTAAGGAGTTGTTTTCCCTTGTTGCCGTGGACTGATTTTGTGACAGCAAGTACTTTATTTGAGATAATCTGTCCAAAATGCCTGGCAGGAAAAGGCCTGTCCTGTGTCAGCCATGGGAAGAGGATGAGTGCCTGGACTACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCCCAACTAACACAAAGTGACATTGATGCCCTATCTTTCCTGCTCCATGAAACACACCCCTTTACACATCCCTTGGATCCCCAGCTATGGACAGCTGAAGACGAGAGTGGTGAAGCAATGCCTAACAGTGCCTTGCTATCAGCTTGGCAAAGGTTGAATCGTGACAGTAGGACACTTAATGAGAATAAGTTGGACTCTCCAGATCTTCAACCCAAGGATGGGACTGAGCTACTGCTTAAACTTGAGAGAATGGGAAAATGTGATGAGAGCAACTTTACACATCTCTTGCAACTGTTACGTGTATTAACACGTCATGACCTGCTCCCATATGTTTCCATGAAAAGACCCCGCACAGTGTCCCCTGAGAGGTATACACATGGCCCATCTATATTGGATTCTGACAAGCAAATGGATAAATGTCTTAACCCAACCCCTTCAGGCACCAGTGAAGAAAACTGGGAAACAGGGTCTAACGCCAGCAAAAGAAAGAGAAGCGGGACTCAAAAAAGGGG------------------------TCACTGAAAATGGCACTTTAAAGAAATCTGGATTTGAAATTTCAAAAGTTGGCCTGCTCCTATATGCTTTTATTGATTGTTATACTTAATGCTTTTTTGGAGCTATACTGGGTCCTTCTTATCTAGAAAAAAATTAAGTTACCAAGTTTTAATTCTTGCATGACCTAATTTCATTCATGAATGAATGTCTGTAATCTTAAATTCCCAATTTTAATAGATTCTGTTTTTCTCCTCCCTTCCCCTTTCTCCCTTTGTCCCGTTGCCCTTTCTTCTAGGAATACGCTTACGTGTGCGAGCAGAGTACTGCCAACATGACTCAGTCTTGAGTCAAAACGTGCTGTCTGTCAAGCAGAACCTGTTGGAGAAGCAGTTTGATCTGTTCAGCCAGTCAAACACGGTTCTGAAATCCCGGGACCTTGGCTCAATTATTTGTGACATCAAGTTCTCTGAGATTTCCTACCTGGATGCATTCTGGACTGATTATATGAATGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTATCAGGAATACAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAATGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAACAAAAAAAAAGCACAAAAAGAGAAATCCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTTATGCCATCCGTGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAATCTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTGCCAAAAGCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCAATTGTAGGTGTCCTGCATATTGCACTGCAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAGTATGACTTTACCAACTAGAACAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATCACTAAATAAGCGTATGTAACAAGACAATTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCTGCTCCATGAAACACACCCCTTTACACATCCCTTGGATCCCCAGCTATGGACAGCTGAAGACGAGAGTGGTGAAGCAATGCCTAACAGTGCCTTGCTATCAGCTTGGCAAAGGTTGAATCGTGACAGTAGGACACTTAATGAGAATAAGTTGGACTCTCCAGATCTTCAACCCAAGGATGGGACTGAGCTACTGCTTAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTCATCGCATGTTTGACATAGTTGGTTCCCAACTAACACAAAGTGACATTGATGCCCTATCTTTCCTGCTCCATGAAACACACCCCTTTACACATCCCTTGGATCCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGAAATTTCAAAAGTTGGCCTGCTCCTATATGCTTTTATTGATTGTTATACTTAATGCTTTTTTGGAGCTATACTGGGTCCTTCTTATCTAGAAAAAAATTAAGTTACCAAGTTTTAATTCTTGCATGACCTAATTTCATTCATGAATGAATGTCTGTAATCTTAAATTCCCAATTTTAATAGATTCTGTTTTTCTCCTCCCTTCCCCTTTCTCCCTTTGTCCCGTTGCCCTTTCTTCTAGGAATACGCTTACGTGTGCGAGCAGAGTACTGCCAACATGACTCAGTCTTGAGTCAAAACGTGCTGTCTGTCAAGCAGAACCTGTTGGAGAAGCAGTTTGATCTGTTCAGCCAGTCAAACACGGTTCTGAAATCCCGGGACCTTGGCTCAATTATTTGTGACATCAAGTTCTCTGAGATTTCCTACCTGGATGCATTCTGGACTGATTATATGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAAAAGGGGTCGCTGCCCCAAACCAAAGAGAAATAAAGCGAGCAACACTCCCTCGCAGAATCCAATTAACCAGAGCAAAGTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAATGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAATTTATGCTTTATAATAAATC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----T-----
                                               BLH ATG    3318     177                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN    3318      46                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MPR    3318      46                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH OVR    3318     260                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               CDS MIN    3318      46                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               ORF LNG    3318      14                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---- 3e-010     XP_001198205.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Gg ---- 8e-018     XP_423146.1 PREDICTED: similar to death effector domain-containing protein; death effector domain-containing [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Hs ---- 7e-031     NP_579874.1 death effector domain-containing  DNA binding protein 2 [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Mm ---- 2e-031     NP_997560.3 death effector domain-containing DNA binding protein 2 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dr ---- 7e-035     NP_571677.1 death effector domain-conatining 1 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 2e-099     AAH87361.1 LOC495979 protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = ?? ==== 2e-099     NP_001088715.1 hypothetical protein LOC495979 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Xt ==== 2e-117     AAI21907.1 Hypothetical protein MGC145883 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CABI13495.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAA---------TGA---------------------------------------------------ATG---------------TAG------TGA---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------TGA------------------------------ATG------------------TGA------------------------------------------ATG------------------------------------------------------------TAA------------------------------------------------------------TAA------------------------------ATG---------TAG---------------------------------------------------------------------TAG------------------TAA---------ATG------------------------------------------------TGA------------TAG---------------------------------------------------------------TAA---------------TAA------------------------------------TGA---------------------------------ATG------TAG---------------ATG------TAA------------------------------------------------------------------ATG---------------------------ATG---------------------ATG------------TGA------ATG------------------ATG------------------ATGTAA---TAG---------------------------------------------------------ATG---------------------------------------------------------------------TGA------------------------TAG---------------TGA---------------------------------TAA------TAA------------------------ATG------------------------------------------------TAA------------TGA---ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------TAA------------TGA------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------ATGTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTAA---TAA------------------------------------------------------------------------------------------TAA---------TAG------------------------------------------------------------ATG---------------------------TAA------------------------------TAG---------------------------------------------------------------------------------------TAG------TGA------------------ATG---TAA------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------ATGTGA------------------------------------------------------------TAA------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------TGA------------------------TGA---------------ATG------------------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------TGA---------------------------------TAG------------------------------------TAA------TGA---TGA---TGA------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------ATGTAA------------------------------------------------TAG---------------------------------------------------TAA---------ATG---TGA------------------------------------TAA---------------------------TGA------------------------------------------------------------TAG------------------------TAA---------------------------------------ATG------------TAA------------------------------------------------------------------ATGTAG------TAA------------TAG------------------------ATG------------------------------------------------------------TGA---TGA---------------TAG---------------------TAA---TGA------TAA---TAA---------------------------------------TAGTAA------------------------------------------------TAG---TGA------------------------------------------------------------------------------------TGA------------------------TAG---------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------ATG---------------------TAG---TAG------TAA---------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------TAA---------------------TAA------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
  5   1   2  SIG                                     Xt7.1-CABI13495.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCCTTAACTAGCTGCTCTGACAGTCTCTGGCACTGCAAGTCAATGGTAAACTTGGGAGCAAAACACAGGCTTGTTTGTTTCTGCTTCCGTCTGTGCTCTATATACGACCTGCTCAACATTTTACAATAAGCATCTCAACATGGACAATTATGTTACGAATATTGCAAAACCTAACATGTCTTCAGCTTTCTCCTGGTTGTGGTCCCTTTAATAAAAGGGAAAGAGTTTGTTTTGGATCTGTTACTGTGCTATTAGGAATCAGGCCATGGCTGCCAAATTTTACAGAAAATTGTGTTACTCAGCTGGCTTAGGTGCCATGAATACCATCATCGAAAAGTTTTGGACAGCCAATGATATTCAATTTTTTAACCTGATTTATCTTTTTAAATATTGTATTGTTCTATTATCACCTTATAATGATAAAAGAGTGTTTTGAAGTGTATATTTTGGTTTTATCACACATACTTGCTGTTTATTTATAACCCCTTTGTGTTAGTGACTGCATACTGTGTTTATCTATTTATGTATTTGCAGTATGTTTAACACAAAGACCACCACAGCATTACTGTCACAATGGGGTTAGTATAGAGGAAAATAAAACACAACCAGAAAAAAGTTTTTGTCCTAAAAAGAAATGTTTAAAAATATTGGTTTATCAATAGTTTTTGTATTTTTATGGTTAATTCTTTTGGATGTTAGACACAAGATATGTAAAGAGAACAAAGCATTTTTACATTACTGTGTGATCACAGACTGGCTAGACTTTCAAGCACTCCTTGAGAAAAAGGTATTCCCAAAATTATATTCTTGAACAAAGCTCTATTTAAGGTGGTCCTGCACTGTAAGATCCACTATTTGGACAAGAAGACATTGGGCTGATCTGATCATCTGATCCCCAGGCCAACAATTTGATCAGAATGGGGGCCTAGGGATATGGTTCTCATATGATTTTGTAACCTGCCCTGATTTTCTGGCACATATCAGTAAAAAAGACATTAGAATGGCACCATACATGGGCCAAAATGTTGACAACTTGGTCTGGAGGGGCTGAGATGGCAGCTTTTATCAATTTGTGTATGTGCACCTTTACTTGAATATTGATGTTGCTGGATTCTGAAAACATGTCTCCCTGTCTATCTGTAATGTAACGTTAGAGGTATTTTTTTTTTTATAAAAAAAAAAAACCTACAAGTACTGATTATTTACTCGGTATGTGGTACAGGTTCCGTGCATGGAATGGTAAACAGAAATGGCTGTGTGAGTTTTATGGTATTGCCTTAACCTGATTCAAATATATAAATGGCACAAGCTAGTTAAGAGACATTTCCTGAAAATTGAAGCCTGCTCTTACACATGGGCTGTGTTAAACAGTGTAATTTTACTTAAAATATAAGCTTCATATGCACAATGGCAGTATCTTTCTTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAGAAAAAGAAAAAATAAAGCGGAAAAAAATCACTAAATAAGCGTATGTAACAAGACAATTTTATTTATAAAGATACCTGTATTAGTTGTTTTGGACATAGGATTTTTTTTTCTATTTTTTTTTTGGTTTAGACCCAAGAAATCGGTATGAAGAAAACAAATCCAGTATAAATGTTCTGACTGAACCATTTATTCAGCTGACCATTTTAAATCTAACTGTTGCTACAGTTCTCTTCAGTGAGCCAAACCAGCAGTATACCATGCTAAGAATTATTGCAGTGTGTTTTCTTTCATCATTTTGTGTAAGAGGGGCTGTCCTAATGTTAGGCCTTATGGAAAATGTCACTGAAAATGGCACTTTAAAGAAATCTGGATTTGAAATTTCAAAAGTTGGCCTGCTCCTATATGCTTTTATTGATTGTTATACTTAATGCTTTTTTGGAGCTATACTGGGTCCTTCTTATCTAGAAAAAAATTAAGTTACCAAGTTTTAATTCTTGCATGACCTAATTTCATTCATGAATGAATGTCTGTAATCTTAAATTCCCAATTTTAATAGATTCTGTTTTTCTCCTCCCTTCCCCTTTCTCCCTTTGTCCCGTTGCCCTTTCTTCTAGGAATACGCTTACGTGTGCGAGCAGAGTACTGCCAACATGACTCAGTCTTGAGTCAAAACGTGCTGTCTGTCAAGCAGAACCTGTTGGAGAAGCAGTTTGATCTGTTCAGCCAGTCAAACACGGTTCTGAAATCCCGGGACCTTGGCTCAATTATTTGTGACATCAAGTTCTCTGAGATTTCCTACCTGGATGCATTCTGGACTGATTATATGAATGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAATGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAACAAAAAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTTATGCCATCCGTGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTC
                                                  Xt7.1-CHK-1008273896                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACTAGCTGCTCTGACAGTCTCTGGCACTGCAAGTCAATGGTAAACTTGGGAGCAAAACACAGGCTTGTTTGTTTCTGCTTCCGTCTGTGCTCTATATACGACCTGCTCAACATTTTACAATAAGCATCTCAACATGGACAATTATGTTACGAATATTGCAAAACCTAACATGTCTTCAGCTTTCTCCTGGTTGTGGTCCCTTTAATAAAAGGGAAAGAGTTTGTTTTGGATCTGTTACTGTGCTATTAGGAATCAGGCCATGGCTGCCAAATTTTACAGAAAATTGTGTTACTCAGCTGGCTTAGGTGCCATGAATACCATCATCGAAAAGTTTTGGACAGCCAATGATATTCAATTTTTTAACCTGATTTATCTTTTTAAATATTGTATTGTTCTATTATCACCTTATAATGATAAAAGAGTGTTTTGAAGTGTATATTTTGGTTTTATCACACATACTTGCTGTTTATTTATAACCCCTTTGTGTTAGTGACTGCATACTGTGTTTATCTATTTATGTATTTGCAxTxTxTTTAACACAAAGACCACCACAGCATTACTGTCACAATGGGGTTAGTATAGAGGAAAATAAAACACAACCAGAAAAAAGTTTTTGTCCTAAAAAGAAATGTTTAAAAATATTGGTTTATCAATAGTTTTTGTATTTTTATGGTTAATTCTTTTGGATGTTAGACACAAGATATGTAAAGAGAACAAAGCATTTTTACATTACTGTGTGATCACAGACTGGCTAGACTTTCAAGCACTCCTTGAGAAAAAGGTATTCCCAAAATTATATTCTTGAACAAAGCTCTATTTAAGGTGGTCCTGCACTGTAAGATCCACTATTTGGACAAGAAGACATTGGGCTGATCTGATCATCTGATCCCCAGGCCAACAATTTGATCAGAATGGGGGCCTAGGGATATGGTTCTCATATGATTTTGTAACCTGCCCTGATTTTCTGGCACATATCAGTAAAAAAGACATTAGAATGGCACCATACATGGGCCAAAATGTTGACAACTTGGTCTGGAGGGGCTGAGATGGCAGCTTTTATCAATTTGTGTATGTGCACCTTTACTTGAATATTGATGTTGCTGGATTCTGAAAACATGTCTCCCTGTCTATCTGTAATGTAACGTTAGAGGTATTTTTTTTTTTATAAAAAAAAAAAACCTACAAGTACTGATTATTTACTCGGTATGTGGTACAGGTTCCGTGCATGGAATGGTAAACAGAAATGGCTGTGTGAGTTTTATGGTATTGCCTTAACCTGATTCAAATATATAAATGGCACAAGCTAGTTAAGAGACATTTCCTGAAAATTGAAGCCTGCTCTTACACATGGGCTGTGTTAAACAGTGTAATTTTACTTAAAATATAAGCTTCATATGCACAATGGCAGTATCTTTCTTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAGAAAAAGAAAAAATAAAGCGGAAAAAAATCACTAAATAAGCGTATGTAACAAGACAATTTTATTTATAAAGATACCTGTATTAGTTGTTTTGGACATAGGATTTTTTTTTCTATTTTTTTTTTGGTTTAGACCCAAGAAATCGGTATGAAGAAAACAAATCCAGTATAAATGTTCTGACTGAACCATTTATTCAGCTGACCATTTTAAATCTAACTGTTGCTACAGTTCTCTTCAGTGAGCCAAACCAGCAGTATACCATGCTAAGAATTATTGCAGTGTGTTTTCTTTCATCATTTTGTGTAAGAGGGGCTGTCCTAATGTTAGGCCTTATGGAAAATGTCACTGAAAATGGCACTTTAAAGAAATCTGGATTTGAAATTTCAAAAGTTGGCCTGCTCCTATATGCTTTTATTGATTGTTATACTTAATGCTTTTTTGGAGCTATACTGGGTCCTTCTTATCTAGAAAAAAATTAAGTTACCAAGTTTTAATTCTTGCATGACCTAATTTCATTCATGAATGAATGTCTGTAATCTTAAATTCCCAATTTTAATAGATTCTGTTTTTCTCCTCCCTTCCCCTTTCTCCCTTTGTCCCGTTGCCCTTTCTTCTAGGAATACGCTTACGTGTGCGAGCAGAGTACTGCCAACATGACTCAGTCTTGAGTCAAAACGTGCTGTCTGTCAAGCAGAACCTGTTGGAGAAGCAGTTTGATCTGTTCAGCCAGTCAAACACGGTTCTGAAATCCCGGGACCTTGGCTCAATTATTTGTGACATCAAGTTCTCTGAGATTTCCTACCTGGATGCATTCTGGACTGATTATATGAATGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAATGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAACAAAAAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTTATGCCATCCGTGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTCATTTTG
  5   1   2       ext Brn2                                CAAJ13114.5p TGCTTTTCTCTTCAGCCGACCTTTCTCTAAAATTTAAATTCCAGGTGTTCTGAGCAAAGGTTGATGGTTAAGAGAGAAAGTCTCTTAAATAACGAAATGATCATGCGCTCTTCAGTTCTCAAACAAGCGCACCACAAAGGTAAATGTATGCATTCTAATAGCAAGGAACTGCTAAGGGAAGGCATTCCCTCTGAAATAAGTGCCATGCCAATAGTGCCTTTCATCTCTTACTCTCCTTGCATGCAGTTAATGAAACCAATTAGCATGAGCACTACCTAGGCACTGCAAGGATCTGTGTAGGCCCTTTTAGGGAGAGTATTAAATAAATGTGCTTACAGGAACCTATTCTACTCAAAACACTTTTAAGGTGTTTCAGATCCTCCATTGCTTATTTGTATGCTATAGTTTGAATTTTTGGGGGATTGTTAGCTTTTTCTAACCTAAATATATATTTAGTAAATTTTGTAAATTCTTGTGTAATTTAATATCGGGATTTACAAATATTTCTGTTCTGATGCTTAGCGCAGCAGATACCAGAAATATAGGGTTATGTTTAAGCATTTGTCCTAAAATTACTGTAATGATATTGGTATCAATGTTTCTCTTATGGATCCATTAAAAACTCTCATTATTATCAGACTTTTACCACATAGGGCTTGCAGTATTCTTTGTGAATTCTGTAAGCAGCTTCAATAGAATTACAAATCCAGAGCTGGACCCATTAAGCATTTCTGATTGATGACTCCTACTTTAAAATGTTTGGGATCCTTAGTGGTGACTGTTCATAACAGACCTCATACTTTCAGTTATGTGACAGATGAGCAGGCTGTCACTGGCAGACCTTATTTTCTGATATCTGCTGATCCTCAACATATTTAGTTCAT
  5   1   1       add Brn2                                CAAJ17858.5p                                                                                                                                                                                                                                                                      GAACCCATGGCTAAAAGCATAGGTTCCTTATCACAGGCCAAAATTAAACAACTGTGGCCTGTGATAAGGAACCCATGGCTAAAAGCATAGGTAAAGTAAAATGTTTTGGGTCTACTGTGGCTTACAGAAGGGATGAATGTGCCAACATAATGTTACATTTAAAAGGACTAAAACATTATTGATATGCATAGTTTAGCTTCAACAGGCTTAGTGACGAAGCAGATGGCTGATGCAACTGGCATAATTGGCACACCATTTATTTTTCAAGCATAGGAAATAGAATGTGACTTTCTGCTGGATTCTTTAGTAAAATCTGCTGTATCTAAATAAGTTCATGTTACTAGTGTGAAAGTTACTTTGCATCAAAATATATCTAGACAAATTAATAAACCCTCTTTATATAATGACCTTTATATAATTGACACTGACATGAAAAAATGGTTTCTTTTGCACAAATGCCTAATGTTACAACACATTTTTTGCAGTAGTCTCAGTTTTACTGTCCCTTTAAGGAAGTCCAGTCAGTTCCTTTCATTATAGCTTATATATTTTTTTTTTTTTATCTTCAGACTTGTCCTCTGAGCATTTGCTATGTCTTGGTGTAATGTTGCTTTTCTCTTCAGCCGACCTTTCTCTAAAATTTAAATTCCAGGTGTTCTGAGCAAAGGTTGATGGTTAAGAGAGAAAGTCTCTTAAATAACGAAATGATCATGCGCTCTTCAGTTCTCAAACAAGCGCACCACAAAGTTAAGATCGCCCATGGAAAAAAGCCTTAACTAGCTGCTCTGACAGTCTCTGGCACTGCAAGTCAATGGTAAAC
  5   1   0       chi Te3       in                         CAAM5827.5p                                                                                                                                                                                                                                                                                                                                   CCCAACTAACACAAAGTGACATTGATGCCCTATCTTTCCTGCTCCATGAAACACACCCCTTTACACATCCCTTGGATCCCCAGCTATGGACAGCTGAAGACGAGAGTGGTGAAGCAATGCCTAACAGTGCCTTGCTATCAGCTTGGCAAAGGTTGAATCGTGACAGTAGGACACTTAATGAGAATAAGTTGGACTCTCCAGATCTTCAACCCAAGGATGGGACTGAGCTACTGCTTAAACTTGAGAGAATGGGAAAATGTGATGAGAGCAACTTTACACATCTCTTGCAACTGTTACGTGTATTAACACGTCATGACCTGCTCCCATATGTTTCCATGAAAAGACCCCGCACAGTGTCCCCTGAGAGGTATACACATGGCCCATCTATATTGGATTCTGACAAGCAAATGGATAAATGTCTTAACCCAACCCCTTCAGGCACCAGTGAAGAAAACTGGGAAACAGGGTCTAACGCCAGCAAAAGAAAGAGAAGCGGGACTCAAAAAAGGGGTCGCTGCCCCAAACCAAAGAGAAATAAAGCGAGCAACACTCCCTCGCAGAATCCAATTAACCAGAGCAAAGTAACATGTGGTGTTCTGAGCAAAGGTTGATGGTTAAGAGAGAAAGTCTCTTAAATAACGAAATGATCATGCGCTCTTCAGTTCTCAAACAAGCGCACCACAAAGTTAAGATCGCCAATGGAAAAAAGCCTTAACTAGCTGCTCTGACAGTCTCTGGCACTGCAAGTCAATGGTAAACTT
  3  -1   2       ext Int1      in                        CAAP11838.3p                                                                                                                                                                                                                                                                                                                                                                                                          TTGTATGCTATAGTTTGAATTTTTGGGGGATTGTTAGCTTTTTCTAACCTAAATATATATTTAGTAAATTTTGTAAATTCTTGTGTAATTAATATCGGGATTTACAAATATTTCTGTTCTGATGCTTAGCGCAGCAGATACCAGAAATATAGGGTTATGTTTAAGCATTTGTCCTAAAATTACTGTAATGATATTGGTATCAATGTTTCTCTTATGGATCCATTAATAACTCTCATTATTATCAGACATTTACCACATAGGGCTTGCAGTATTCTTTGTGAATTCTGTAAGCAGCTTCAATAGAATTACAAATCCAGAGCTGGACCCATTAAGCATTTCTGATTGATGACTCCTACTTTAAAATGTTTGGGATCCTTAGTGGTGACTGTTCATAACAGACCTCATACTTCAAGTTATGTGACAGATGAGCAGGCTGTCACTGGCAGACCTTATTTTCTGATATCTGCTGATCCTCAACATATTTAGTTCATTTAGCGGGAAATTTCATATTCAAATAAATATGTTCTTACATTGTTAAAAACATTACTTGCTACCTATTAGAAAAGTGCTGTGCTGTAAATGTCAAAAGCTCAATCTGTCTCTCTCGGTTCACAGTTAAGATCGCCAATGGAAAAAAGCCTTAACTAGCTGCTCTGACAGTCTCTGGCACTGCAAGTCAATGGTAAACTTGGGAGCAAAACACAGGCTTGTTTGTTTCTGCTTCCGTCTGTGCTCTATATACGACCTGCTCAACATTTTACAATAAGCATCTCAACATGGACAATTATGTTACGAATATTGCA
  5   1   2       add Tad5                                 XZT57218.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGAAAGTCTCTTAAATAACGAAATGATCATGCGCTCTTCAGTTCTCAAACAAGCGCACCACAAAGTTAAGATCGCCAATGGAAAAAAGCCTTAACTAGCTGCTCTGACAGTCTCTGGCACTGCAAGTCAATGGTAAACTTGGGAGCAAAACACAGGCTTGTTTGTTTCTGCTTCCGTCTGTGCTCTATATACGACCTGCTCAACATTTTACAATAAGCATCTCAACATGGACAATTATGTTACGAATATTGCAAAACCTAACATGTCTTCAGCTTTCTCCTGGTTGTGGTCCCTTTAATAAAAGGGAAAGAGTTTGTTTTGGATCTGTTACTGTGCTATTAGGAATCAGGCCATGGCTGCCAAATTTTACAGAAAATTGTGTTACTCAGCTGGCTTAGGTGCCATGAATACCATCATCGAAAAGTTTTGGACAGCCAATGATATTCAATTTTTTAACCTGATTTATCTTTTTAAATATTGTATTGTTCTATTATCACCTTATAATGATAAAAGAGTGTTTTGAAGTGTATATTTTGGTTTTATCACACATACTTGCTGTTTATTTATAACCCCTTTGTGTTAGTGACTGCATACTGTGTTTATCTATTTATGTATTTGCAGTATGTTTTTAACACAAAGACCACCACAGCATTACTGTCACAATGGGGTTAGTATAGAGGAAAATAAAACACAACCAGAAAAAAGTTTTTGTCCTAAAAAGAAATGTTTAAAAATATTGGTTTATCAATAGTTTTTGTATTTTTATGGTTAATTCTTTTGGATGTTAGACACAAGATATGTAAAGAGAACAAAGCATTTTTACATTACTGTGTGATCACAGACTGGCTAGACTTTCAAGCACTCCT
  5   1   3        nb Spl2      in                        CBSS5831.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAAGTTAAGATCGCCAATGGAAAAAAGCCTTAACTAGCTGCTCTGACAGTCTCTGGCACTGCAAGTCAATGGTAAACTTGGGAGCAAAACACAGGCTTGTTTGTTTCTGCTTCCGTCTGTGCTCTATATACGACCTGCTCAACATTTTACAATAAGCATCTCAACATGGACAATTATGTTACGAATATTGCAAAACCTAACATGTCTTCAGCTTTCTCCTGGTTGTGGTCCCTTTAATAAAAGGGAAAGAGTTTGTTTTGGATCTGTTACTGTGCTATTAGGAATCAGGCCATGGCTGCCAAATTTTACAGAAAATTGTGTTACTCAGCTGGCTTAGGTGCCATGAATACCATCATCGAAAAGTTTTGGACAGCCAATGATATTCAATTTTTTAACCTGATTTATCTTTTTAAATATTGTATTGTTCTATTATCACCTTATAATGATAAGAGTGTTTTGAAGTGTATATTTTGGTTTTATCACACATACTTGCTGTTTATTTATAACCCCTTTGTGTTAGTGACTGCATACTGTGTTTATCTATTTATGTATTTGCAGTATGTTTTTAACACAAAGACCACCACAGCATTACTGTCACAATGGGGTTAGTATAGAGGAAAATAAAACACAACCAGAAAAAAGTTTTTGTCCTAAAAAGAAATGTTTAAAAATATTGGTTTATCAATAGTTTTTGTATTTTTATGGTTAATTCTTTTGGATGTTAGACACAAGATATGTAAAGAGAACAA
  5   1   2       ext Ski1      in                         CABJ8452.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAAAAGCCTTAACTAGCTGCTCTGACAGTCTCTGGCACTGCAAGTCAATGGTAAACTTGGGAGCAAAACACAGGCTTGTTTGTTTCTGCTTCCGTCTGTGCTCTATATACGACCTGCTCAACATTTTACAATAAGCATCTCAACATGGACAATTATGTTACGAATATTGCAAAACCTAACATGTCTTCAGCTTTCTCCTGGTTGTGGTCCCTTTAATAAAAGGGAAAGAGTTTGTTTTGGATCTGTTACTGTGCTATTAGGAATCAGGCCATGGCTGCCAAATTTTACAGAAAATTGTGTTACTCAGCTGGCTTAGGTGCCATGAATACCATCATCGAAAAGTTTTGGACAGCCAATGATATTCAATTTTTTAACCTGATTTATCTTTTTAAATATTGTATTGTTCTATTATCACCTTATAATGATAAAAGAGTGTTTTGAAGTGTATATTTTGGTTTTATCACACATACTTGCTGTTTATTTATAACCCCTTTGTGTTAGTGACTGCATACTGTGTTTATCTATTTATGTATTTGCAGTATGTTTTTAACACAAAGACCACCACAGCATTACTGTCACAATGGGGTTAGTATAGAGGAAAATAAAACACAACCAGAAAAAAGTTTTTGTCCTAAAAAGAAATGTTTAAAAATATTGGTTTATCAATAGTTTTTGTATTTTTATGGTTAATTCTTTTGGATGTTAGACACAAGATATGTAAAGAGAACAAAGCATTTTTACATTACTGTGTGATCACAGACTGGCTAGACTTTCAAGCACTCCTTGAGAAAAAGGTATTCCCAAAATTATATTCTTGAACAAAGCTCTATTTA
  5   1   2       ext Sto1      in                          CABG640.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCAATTCGGCACGAGGTTTTAACACAAAGACCACCACAGCATTACTGTCACAATGGGGTTAGTATAGAGGAAAATAAAACACAACCAGAAAAAAGTTTTTGTCCTAAAAAGAAATGTTTAAAAATATTGGTTTATCAATAGTTTTTGTATTTTTATGGTTAATTCTTTTGGATGTTAGACACAAGATATGTAAAGAGAACAAAGCATTTTTACATTACTGTGTGATCACAGACTGGCTAGACTTTCAAGCACTCCTTGAGAAAAAGGTATTCCCAAAATTATATTCTTGAACAAAGCTCTATTTAAGGTGGTCCTGCACTGTAAGATCCACTATTTGGACAAGAAGACATTGGGCTGATCTGATCATCTGATCCCCAGGCCAACAATTTGATCAGAATGGGGGCCTAGGGATATGGTTCTCATATGATTTTGTAACCTGCCCTGATTTTCTGGCACATATCAGTAAAAAAGACATTAGAATGGCACCATACATGGGCCAAAATGTTGACAACTTGGTCTGGAGGGGCTGAGATGGCAGCTTTTATCAATTTGTGTATGTGCACCTTTACTTGAATATTGATGTTGCTGGATTCTGAAAACATGTCTCCCTGTCTATCTGTAATGTAACGTTAGAGGTATTTTTTTTTTTATAAAAAAAAAAAACCTACAAGTACTGATTATTTACTCGGTATGTGGTACAGGTTCCGTGCATGGAATGGTAAACAGAAATGGCTGTGTGAGTTTTATGGTATTGCCTTAACCTGATTCAAATATATAAATGGCACAAGCTAGTTAAGAGACATTTCCTGAAAATTGAGCCTGCTCTTACACATGGGCTGTGTTAAACAGTGTAATTTTACTTAAATATAAGCTTCATATGC
  5   1   2       ext Ovi1      in                        CABI14458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATAGAGGAAAATAAAACACAACCAGAAAAAAGTTTTTGTCCTAAAAAGAAATGTTTAAAAATATTGGTTTATCAATAGTTTTTGTATTTTTATGGTTAATTCTTTTGGATGTTAGACACAAGATATGTAAAGAGAACAAAGCATTTTTACATTACTGTGTGATCACAGACTGGCTAGACTTTCAAGCACTCCTTGAGAAAAAGGTATTCCCAAAATTATATTCTTGAACAAAGCTCTATTTAAGGTGGTCCTGCACTGTAAGATCCACTATTTGGACAAGAAGACATTGGGCTGATCTGATCATCTGATCCCCAGGCCAACAATTTGATCAGAATGGGGGCCTAGGGATATGGTTCTCATATGATTTTGTAACCTGCCCTGATTTTCTGGCACATATCAGTAAAAAAGACATTAGAATGGCACCATACATGGGCCAAAATGTTGACAACTTGGTCTGGAGGGGCTGAGATGGCAGCTTTTATCAATTTGTGTATGTGCACCTTTACTTGAATATTGATGTTGCTGGATTCTGAAAACATGTCTCCCTGTCTATCTGTAATGTAACGTTAGAGGTATTTTTTTTTTTATAAAAAAAAAAAACCTACAAGTACTGATTATTTACTCGGTATGTGGTACAGGTTCCGTGCATGGAATGGTAAACAGAAATGGCTGTGTGAGTTTTATGGTATTGCCTTAACCTGATTCAAATATATAAATGGCACAAGCTAGTTAAGAGACATTTCCTGAAAATTGAAGCCTGCTCTTACACATGGGCTGTGTTAAACAGTGTAATTTTACTTAAAATATAAGCTTCATATGCACAATGGCAGTATCTTTCTTTCCTTTGC
  5   1   3        nb Fat1      in                         CABC7626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAAGAAATGTTTAAAAATATTGGTTTATCAATAGTTTTTGTATTTTTATGGTTAATTCTTTTGGATGTTAGACACAAGATATGTAAAGAGAACAAAGCATTTTTACATTACTGTGTGATCACAGACTGGCTAGACTTTCAAGCACTCCTTGAGAAAAAGGTATTCCCAAAATTATATTCTTGAACAAAGCTCTATTTAAGGTGGTCCTGCACTGTAAGATCCACTATTTGGACAAGAAGACATTGGGCTGATCTGATCATCTGATCCCCAGGCCAACAATTTGATCAGAATGGGGGCCTAGGGATATGGTTCTCATATGATTTTGTAACCTGCCCTGATTTTCTGGCACATATCAGTAAAAAAGACATTAGAATGGCACCATACATGGGCCAAAATGTTGACAACTTGGTCTGGAGGGGCTGAGATGGCAGCTTTTATCAATTTGTGTATGTGCACCTTTACTTGAATATTGATGTTGCTGGATTCTGAAAACATGTCTCCCTGTCTATCTGTAATGTAACGTTAGAGGTATTTTTTTTTTTATAAAAAAAAAAAACCTACAAGTACTGATTATTTACTCGGTATGTGGTACAGGTTCCGTGCATGGAATGGTAAACAGAAATGGCTGTGTGAGTTTTATGGTATTGCCTTAACCTGATTCAAATATATAAATGGCACAAGCTAGTTAAGAGACATTTCCTGAAAATTGAAGCCTGCTCTTACACATGGGCTGTGTTAAACAGTGTAATTTTACTTAAAATATAAGCTTCATATGCACAATGGCAGTATCTTTCTTTCCTTTGCAAC
  5   1   2       ext Te1       in                         CBWN5979.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCTGATTTTCTGGCACATATCAGTAAAAAAGACATTAGAATGGCACCATACATGGGCCAAAATGTTGACAACTTGGTCTGGAGGGGCTGAGATGGCAGCTTTTATCAATTTGTGTATGTGCACCTTTACTTGAATATTGATGTTGCTGGATTCTGAAAACATGTCTCCCTGTCTATCTGTAATGTAACGTTAGAGGTATTTTTTTTTTTTTATAAAAAAAAAAAAACCTACAAGTACTGATTATTTACTCGGTATGTGGTACAGGTTCCGTGCATGGAATGGTAAACAGAAATGGCTGTGTGAGTTTTATGGTATTGCCTTAACCTGATTCAAATAAATAAATGGCACAAGCTAGTTAAGAGACATTTCCTGAAAATTGAAGCCTGCTCTTACACATGGGCTGTGTTAAACAGTGTAATTTTACTTAAAATATAAGCTTCATATGCACAATGGCAGTATCTTTCTTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGA
  3  -1   2       ext Ovi1      in                         CABI1829.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGAATGGCACCATACATGGGCCAAAATGTTGACAACTTGGTCTGGAGGGGCTGAGATGGCAGCTTTTATCAATTTGTGTATGTGCACCTTTACTTGAATATTGATGTTGCTGGATTCTGAAAACATGTCTCCCTGTCTATCTGTAATGTAACGTTAGAGGTATTTTTTTTTTTATAAAAAAAAAAAACCTACAAGTACTGATTATTTACTCGGTATGTGGTACAGGTTCCGTGCATGGAATGGTAAACAGAAATGGCTGTGTGAGTTTTATGGTATTGCCTTAACCTGATTCAAATATATAAATGGCACAAGCTAGTTAAGAGACATTTCCTGAAAATTGAAGCCTGCTCTTACACATGGGCTGTGTTAAACAGTGTAATTTTACTTAAAATATAAGCTTCATATGCACAATGGCAGTATCTTTCTTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTNGCATGTGTGCTC
  5   1   3        nb Liv1      out                        CAAR7331.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTGAATATTGATGTTGCTGGATTCTGAAAACATGTCTCCCTGTCTATCTGTAATGTAACGTTAGAGGTATTTTTTTTTTTATAAAAAAAAAAAACCTACAAGTACTGATTATTTACTCGGTATGTGGTACAGGTTCCGTGCATGGAATGGTAAACAGAAATGGCTGTGTGAGTTTTATGGTATTGCCTTAACCTGATTCAAATATATAAATGGCACAAGCTAGTTAAGAGACATTTCCTGAAAATTGAAGCCTGCTCTTACACATGGGCTGTGTTAAACAGTGTAATTTTACTTAAAATATAAGCTTCATATGCACAATGGCAGTATCTTTCTTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTG
  5   1   2       ext Spl1      in                         CABK2942.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCGGCACGAGGCACAAGCTAGTTAAGAGACATTTCCTGAAAATTGAAGCCTGCTCTTACACATGGGCTGTGTTAAACAGTGTAATTTTACTTAAAATATAAGCTTCATATGCACAATGGCAGTATCTTTCTTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGATTCCTTTGGCATCTATTGTGTCATGT
  3   1   2       ext Ovi1      in                        CABI14458.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACACATGGGCTGTGTTAAACAGTGTAATTTTACTTAAAATATAAGCTTCATATGCACAATGGCAGTATCTTTCTTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCAAAAAAA
  5  -1   2       ext Ovi1      in                         CABI1829.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACACATGGGCTGTGTTAAACAGTGTAATTTTACTTAAAATATAAGCTTCATATGCACAATGGCAGTATCTTTCTTTCCTTGCAAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATAAAGAAAG
  5  -1   3        nb Brn2                                CAAJ19340.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGTGTAATTTTACTTAAAATATAAGCTTCATATGCACATTGGCAGTATCTTTCTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCAAAAAAAAAAAAAAAGGGCGGC
  3   1   2       ext Ski1      in                         CABJ8452.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGCACAATGGCAGTATCTTTCTTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTC
  3   1   2       add Te3       in                         CAAM5827.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGTATCTTTCTTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTCAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATC
  5   1   2       ext Fat1      in                         CABC6202.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGAGGCTTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCANAAAAAAAAAAAAAAAA
  3   1   2       ext Fat1      in                         CABC6202.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTC
  3   1   3        nb Fat1      in                         CABC7626.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCG
  3   1   2       ext Sto1      in                          CABG640.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCC
  3   1   2       ext Te1       in                         CBWN5979.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATGTGTGTAAATTAAAGAAAGAGAATGCTTCTCCACT
  5   1   3        nb Tbd1      in                        CBXT21743.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTG
  5   1   3        nb Liv1      in                         CAAR3542.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCANAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTNGTATACTTGTTGC
  3   1   3        nb Spl2      in                        CBSS5831.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATC
  3   1   3        nb Tbd1      in                        CBXT21743.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCAAAAAAAAAAAAAAA
  5   1   3        nb Sto1      in                        CABG10261.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCANAAAAAAAAAAAAAAAA
  3   1   3        nb Sto1      in                        CABG10261.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTC
  3   1   3        nb Ovi1      in                        CABI10327.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCAT
  5   1   3        nb Ovi1      in                        CABI10327.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATAAAAAAAAAAAAAAAAAA
  5   1   3        nb Tad5                                 XZT15938.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTC
  3  -1   3        nb Ovi1      in                        CABI11407.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTGCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTTACCACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATC
  5   1   4      seed Fat1      in                         CABC4314.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAAACATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAAT
  5   1   3        nb Fat1      in                         CABC6335.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAG
  5   1   3        nb Mus1      in                         CABH4553.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTAC
  3   1   3        nb Liv1      in                         CAAR3542.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGNTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCAC
  5   1   2       add Brn2      in                        CAAJ12132.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTGCAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAGTATGACTTTACCAACTAGAACAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGANACTGTTGCTGTATGATTGGACTATCANAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAGAAA
  3  -1   2       ext Int1      in                        CAAP14068.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCANAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAGAAAAAGAAAAAATAAAGC
  3   1   3        nb Fat1      in                         CABC6335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAG
  3   1   3        nb Ovi1      in                         CABI6324.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATCTTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCAC
  3   1   3        nb Ovi1                                 CABI6516.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATCAGTTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAAGAAAACT
  5  -1   3        nb Ovi1      in                        CABI11407.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTTCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCAA
  5   1   3        nb Ski1      in                        CABJ10565.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAGAAAAAGAAAAAATAAAGCGG
  3   1   2       add Brn2      in                        CAAJ16617.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAG
  3   1   2       add Tbd1      in                        CBXT18870.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAGAAAAAGAAAAAATAAAGCGGAAAAAAAAAAAAAAA
  5   1   2       add Tbd1      in                        CBXT18870.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAGAAAAAGAAAAAATAAAGCGGAAAAAAAAAAAAAAA
  5   1   3        nb Ovi1      in                         CABI6324.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCAT
  5   1   3        nb Fat1      in                        CABC10436.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGCAATTGTAGGTGTCCTGCATATTGCACTACAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAGAAAAAGAAAAAATAAAGCGGAAAAAAATCACTAAATAAGCGTATGTAACAAGACAATTTTATTTATAAAGATACCTGTATTAGTTGTTTTGGACATAGGATTTTTTTTTCTATTTTTTTTTTGGTTTAGACCCAAGAAATCGGTATGAAGAAAACAAATCCAGTATAAATGTTCTGACTGAACCATTTATTCAGCTGACCATTTTAAATCTAACTGTTGCTACAGTTCTCTTCAGTGAGCCAAACCAGCAGTATACCATGCTAAGAAATATTGCA
  3   1   3        nb BrSp      in                     EC2BBA19DF12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAACGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATG
  5   1   3        nb BrSp      in                     EC2BBA19DF12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTAATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAACGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Ovi1      in                         CABI2562.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAATATGACTTTACCAACTAGAACACTTGAGATAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAGAAAAAGAAAAAATAAAGCGGAAAAAAATCACTAAATAAGCGTATGTAACAAGACAATTTTATTTATAAAGATACCTGTATTAGTTGTTTTGGACATAGGATTTTTTTTTCTATTTTTTTTTTGGTTTAGACCCAAGAAATCGGTATGAAGAAAACAAATCCAGTATAAATGTTCTGACTGAACCATTTATTCAGCTGACCATTTTAAATCTAACTGTTGCTACAGTTCTCTTCAGTGAGCCAAACCAGCAGTATACCATGCTAAGAATTATTGCAGTGTGTTTTCTTTCATCATTTTGTGTAAGAGGGGCTGTCCTAATGTTAGGCCTTATGGAAAATGTCACTGAAAATGGCACTTTAAAGAAATCTGGATTTGAAATTTCAAAAGTTGGCCTGCTCCTATATGCTTTTATTGATTGTTATACTTAATGCTTTTTTGGAGCTATACTGGGGTCT
  5   1   2       ext Ovi1      in                        CABI13495.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAGAAAAAGAAAAAATAAAGCGGAAAAAAATCACTAAATAAGCGTATGTAACAAGACAATTTTATTTATAAAGATACCTGTATTAGTTGTTTTGGACATAGGATTTTTTTTTCTATTTTTTTTTTGGTTTAGACCCAAGAAATCGGTATGAAGAAAACAAATCCAGTATAAATGTTCTGACTGAACCATTTATTCAGCTGACCATTTTAAATCTAACTGTTGCTACAGTTCTCTTCAGTGAGCCAAACCAGCAGTATACCATGCTAAGAATTATTGCAGTGTGTTTTCTTTCATCATTTTGTGTAAGAGGGGCTGTCCTAATGTTAGGCCTTATGGAAAATGTCACTGAAAATGGCACTTTAAAGAAATCTGGATTTGAAATTTCAAAAGTTGGCCTGCTCCTATATGCTTTTATTGATTGTTATACTTAATGCTTTTTTGGAGCTATACTGGGTCCTTCTTATCTAGAAAAAAATTAAGTTACCAAGTTTTAATTCTTGCATGACCTAATTTCATTCATGAATGAATGTCTGTAATCTTAAATTCCCAATTTTAATAGATTCTGTTTTTCTCCTCCCTTCCCCTTTCTCCCTTTGTCCCGTTGCCCTTTCTTCTAGGAATACGCTTACGTGTGCGAGCAGAGTACTGCCAACATGACTCAGTCTTGAGTCAAAACGTGCTGTCTGTCAAGCAGAACCTGTTGGAGAAGCAGTTTGATCTGTTCAGCCAGTCAAACACGGTTCTG
  5   1   3        nb Ovi1      in                        CABI10062.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAGCAGTATACCATGCTAAGAATTATTGCAGTGTGTTTTCTTTCATCATTTTGTGTAAGAGGGGCTGTCCTAATGTTAGGCCTTATGGAAAATGTCACTGAAAATGGCACTTTAAAGAAATCTGGATTTGAAATTTCAAAAGTTGGCCTGCTCCTATATGCTTTTATTGATTGTTATACTTAATGCTTTTTTGGAGCTATACTGGGTCCTTCTTATCTAGAAAAAAATTAAGTTACCAAGTTTTAATTCTTGCATGACCTAATTTCATTCATGAATGAATGTCTGTAATCTTAAATTCCCAATTTTAATAGATTCTGTTTTTCTCCTCCCTTCCCCTTTCTCCCTTTGTCCCGTTGCCCTTTCTTCTAGGAATACGCTTACGTGTGCGAGCAGAGTACTGCCAACATGACTCAGTCTTGAGTCAAAACGTGCTGTCTGTCAAGCAGAACCTGTTGGAGAAGCAGTTTGATCTGTTCAGCCAGTCAAACACGGTTCTGAAATCCCGGGACCTTGGCTCAATTATTTGTGACATCAAGTTCTCTGAGATTTCCTACCTGGATGCATTCTGGACTGATTATATGAATGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTT
  5   1   3        nb Liv1      in                         CAAR7315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGAGGGGCTGTCCTAATGTTAGGCCTTATGGAAAATGTCACTGAAAATGGCACTTTAAAGAAATCTGGATTTGAAATTTCAAAAGTTGGCCTGCTCCTATATGCTTTTATTGATTGTTATACTTAATGCTTTTTTGGAGCTATACTGGGTCCTTCTTATCTAGAAAAAAATTAAGTTACCAAGTTTTAATTCTTGCATGACCTAATTTCATTCATGAATGAATGTCTGTAATCTTAAATTCCCAATTTTAATAGATTCTGTTTTTCTCCTCCCTTCCCCTTTCTCCCTTTGTCCCGTTGCCCTTTCTTCTAGGAATACGCTTACGTGTGCGAGCAGAGTACTGCCAACATGACTCAGTCTTGAGTCAAAACGTGCTGTCTGTCAAGCAGAACCTGTTGGAGAAGCAGTTTGATCTGTTCAGCCAGTCAAACACGGTTCTGAAATCCCGGGACCTTGGCTCAATTATTTGTGACATCAAGTTCTCTGAGATTTCCTACCTGGATGCATTCTGGACTGATTATATGAATGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTA
  5   1   2       ext Mus1      in                         CABH9757.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGGATTTGAAATTTCAAAAGTTGGCCTGCTCCTATATGCTTTTATTGATTGTTATACTTAATGCTTTTTTGGAGCTATACTGGGTCCTTCTTATCTAGAAAAAAATTAAGTTACCAAGTTTTAATTCTTGCATGACCTAATTTCATTCATGAATGAATGTCTGTAATCTTAAATTCCCAATTTTAATAGATTCTGTTTTTCTCCTCCCTTCCCCTTTCTCCCTTTGTCCCGTTGCCCTTTCTTCTAGGAATACGCTTACGTGTGCGAGCAGAGTACTGCCAACATGACTCAGTCTTGAGTCAAAACGTGCTGTCTGTCAAGCAGAACCTGTTGGAGAAGCAGTTTGATCTGTTCAGCCAGTCAAACACGGTTCTGAAATCCCGGGACCTTGGCTCAATTATTTGTGACATCAAGTTCTCTGAGATTTCCTACCTGGATGCATTCTGGACTGATTATATGAATGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGNGAAGGAACTATGTAAGAGCTGGCAGTAAAAACTATATA
  5   1   3        nb Ski1      in                         CABJ3082.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAAAGTTGGCCTGCTCCTATATGCTTTTATTGATTGTTATACTTAATGCTTTTTTGGAGCTATACTGGGTCCTTCTTATCTAGAAAAAAATTAAGTTACCAAGTTTTAATTCTTGCATGACCTAATTTCATTCATGAATGAATGTCTGTAATCTTAAATTCCCAATTTTAATAGATTCTGTTTTTCTCCTCCCTTCCCCTTTCTCCCTTTGTCCCGTTGCCCTTTCTTCTAGGAATACGCTTACGTGTGCGAGCAGAGTACTGCCAACATGACTCAGTCTTGAGTCAAAACGTGCTGTCTGTCAAGCAGAACCTGTTGGAGAAGCAGTTTGATCTGTTCAGCCAGTCAAACACGGTTCTGAAATCCCGGGACCTTGGCTCAATTATTTGTGACATCAAGTTCTCTGAGATTTCCTACCTGGATGCATTCTGGACTGATTATATGAATGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGNGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTTCTGTAGNTGTACTACATATTTGGT
  3  -1   2       ext Ski1      in                         CABJ4115.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGCATGACCTAATTTCATTCATGAATGAATGTCTGTAATCTTAAATTCCCAATTTTAATAGATTCTGTTTTTCTCCTCCCTTCCCCTTTCTCCCTTTGTCCCGTTGCCCTTTCTTCTAGGAATACGCTTACGTGTGCGAGCAGAGTACTGCCAACATGACTCAGTCTTGAGTCAAAACGTGCTGTCTGTCAAGCAGAACCTGTTGGAGAAGCAGTTTGATCTGTTCAGCCAGTCAAACACGGTTCTGAAATCCCGGGACCTTGGCTCAATTATTTGTGACATCAAGTTCTCTGAGATTTCCTACCTGGATGCATTCTGGACTGATTATATGAATGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCACCATAGTTTTT
  5   1   2       add Fat1      in                         CABC6425.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAAAGTTAAGATCGCCAATGGAAAAAAGCCTTAACTAGCTGCTCTGACAGTCTCTGGCACTGCAAGTCAATGGAATACGCTTACGTGTGCGAGCAGAGTACTGCCAACATGACTCAGTCTTGAGTCAAAACGTGCTGTCTGTCAAGCAGAACCTGTTGGAGAAGCAGTTTGATCTGTTCAGCCAGTCAAACACGGTTCTGAAATCCCGGGACCTTGGCTCAATTATTTGTGACATCAAGTTCTCTGAGATTTCCTACCTGGATGCATTCTGGACTGATTATATGAATGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAAT
  5   1   3        nb Brn3      in                         CAAK3186.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCCAACATGACTCAGTCTTGAGTCAAAACGTGCTGTCTGTCAAGCAGAACCTGTTGGAGAAGCAGTTTGATCTGTTCAGCCAGTCAAACACGGTTCTGAAATCCCGGGACCTTGGCTCAATTATTTGTGACATCAAGTTCTCTGAGATTTCCTACCTGGATGCATTCTGGACTGATTATATGAATGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTATCAGGAATACAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACT
  5   1   3        nb Brn1      in                          CABL470.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTCAATTATTTGTGACATCAAGTTCTCTGAGATTTCCTACCTGGATGCATTCTGGACTGATTATATGAATGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAACGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACTACAAANAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGNATCAGATGTAGGAAGCTTAAATTAGTGCTGCTT
  3   1   2       add Brn2      in                        CAAJ12132.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGATTTCCTACCTGGATGCATTCTGGACTGATTATATGAATGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTATCAGGAATACAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAATGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAAC
  5   1   3        nb Liv1      in                         CAAR1604.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATTTCCTACCTGGATGCATTCTGGACTGATTATATGAATGGTTCCCTGCTTGAGGCCCTGAAAGGGGTTTTCATCACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAACGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAACAAAAAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGC
  3  -1   3        nb Hrt1      in                         CAAQ8388.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTCTCCAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAATGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAACAAAAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTAATGCCATCCGTGTGTTTGGTTAAGTTTCAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTTGTGAATCCTGAAAACTTTTAGTTTCTACT
  5   1   3        nb Ovi1      in                        CABI12673.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACAGATTCTCTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAATGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAACAAAAAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTAATGCCATCCGTGTGTTTGGTTAAGTT
  5   1   2       ext Sto1      in                         CABG7480.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTAGAGAGGCTGTAGGACAGGAAACCATACAGCTCCTGGTTAATGTAGATGAAGATGATTATGAAGAAGGTCGAAGACTTCTGCTAGACAATGTATCTCAACCATATGACTAAACATCTTTTGTATACATTCTCCAGAATTTGTGACTGTACTGTACCTGCTATTTTTTCAGGAATATAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAATGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAACAAANAAAAAGCACAAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTTATGCCATCCGTGTGTTTGGTTAAGTTTCAATAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAG
  5   1   3        nb BrSp      in                     EC2BBA16BA11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGAATTTGTGACTGTACTGTACCTGCTATTTATCAGGAATACAGAGACTTTAAAGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGCACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAATGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAACAAAAAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGG
  5   1   3        nb Thy1      in                       CBST12651.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTTTCAACTGGCATTCAGCAGTTATTTCTCATATGCTTCTAAAAGCTAAAGGTGCTGTTAATTCTGAAGAGTACAGTAGTAATTCATAAAAGTTGGTTTATTGGGAAGGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAATGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAAAAAAAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTTATGCCATCCGTGTGTTTGGTTAAGTTTCANATTAACATATTCTATANAACAAATCAGGGATGGTGATTGTGAAATCCTGAAATCTTTTAGTTTCTACTCTGTTTTTCAGGCT
  5   1   3        nb Ovi1      in                         CABI4219.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCGATTCGAAACTATGTAAGAGCTGGCAGTAAAAACTATATATTCCGGTGGTGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTAAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAACGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAACAAAAAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTTATGCCATCCGTGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAG
  5   1   3        nb Ovi1      in                         CABI1192.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCGATTCGGCAATATTATTCTTGTAGTTGTACTACATATTTGGTAAGTTAATTGGGTCTGATTTGCTTAATTACCTCTGAACAAAAGGTATGTTATGATACAAGTGTTTCTGTGGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAATGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAACAAAAAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTTATGCCATCCGTGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCA
  5   1   2       ext Ovi1      in                         CABI5989.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGTCCAACCATAGTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGCTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGTAGGTATTGCGGCAATCACTTAGAACGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAACAAAAAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTTATGCCATCCGTGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTNGATAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGAC
  5   1   3        nb Tad5      in                         XZT32150.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTTTTGTTAACTGCCAGAACAAATTGTGAATCCGTTATGACTGCTACAAAAGGCATGTCTATTGATATTGGTACATCTGGAAGGTATTGCGGCAATCACTTATAATGAAACCTGCTGGAGAATCTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACTACAACAAAGAAAAAAGCACA
  5   1   3        nb Hrt1      in                         CAAQ4039.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTATAATCTTTAATTTTGACTTGTCAGATTCTCCATTTTACTACTATGGGCTATGGACCTTAAGGTATTGAGGAAACAACAACAAAAAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTTATGCCATCCGTGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAANAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCTAGCATCCATG
  5   1   3        nb Sto1      in                         CABG1773.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGACCTTAAGGTATTGAGGAAACAACAACAAAAAAAAAGCACAAAAAGAGAAATTCTAACCTGTTGTGGATCAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTAATGCCATCCGTGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTCGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTA
  3  -1   3        nb Ovi1      in                         CABI5783.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGTTGTGGATAAGATGTAGGAAGCTTAAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTTATGCCATCCGTGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTT
  3  -1   3        nb Mus1      in                          CABH593.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAATTAGTGCTGCTTAGCAAGGGGCATTCATTGTGGAGTTTATGCCATCCGTGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACG
  3   1   2       add Fat1      in                         CABC6425.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTTAATGCCATCCGTGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTCGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCA
  5   1   3        nb Thy1      in                        CBST8807.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTAATGCCATCCGTGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGTCCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTA
  5  -1   3        nb Ovi1      in                         CABI5783.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTGTTTGGTTAAGTTTCAAATTAACATATTCTATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAG
  3   1   3        nb Ski1      in                         CABJ3082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGGTTAAGTTTTCAAATTAACATATTCTATAAAACAATCAGGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATT
  3   1   2       ext Mus1      in                         CABH9757.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTAAGTTTCAAAATAACATATTCTATAAAACAATCAGGGGATGGTGATTGTGAAATCCTGAAAACTNTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAA
  3   1   3        nb Fat1      in                        CABC10436.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATT
  3   1   2       ext Ovi1      in                        CABI13495.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAA
  3   1   2       ext Ovi1      in                         CABI5989.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATT
  3   1   3        nb Liv1      in                         CAAR1604.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTCAGGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTT
  3   1   3        nb Ovi1      in                         CABI1192.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTNTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTATTAAAAAAAA
  3   1   3        nb Sto1      in                         CABG1773.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTCGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATT
  3   1   3        nb Ovi1      in                         CABI2562.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATT
  3   1   2       ext Spl1      in                         CABK2942.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACAAATCAGGGATGGTGATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTCGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTT
  3   1   3        nb Hrt1      in                         CAAQ4039.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTGTGAAATCCTGAAAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATT
  3   1   2       ext Sto1      in                         CABG7480.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTT
  3   1   3        nb Ovi1      in                        CABI10062.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACTTTTAGTTTCTACTCTGTTTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTT
  3   1   3        nb Ski1      out                         CABJ431.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTAGTTTCTACTCTGTTTNTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTT
  3   1   4      seed Fat1      in                         CABC4314.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTTAGTTTCTACTCTGTTTTCAGGCTAATTTGAAATGACTAAATTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTCATTTTAAAAAAA
  3   1   3        nb Ovi1      in                         CABI4219.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTCAGGCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTC
  5  -1   2       ext Int1      in                        CAAP11838.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTATTTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAA
  3   1   3        nb Brn3      in                         CAAK3186.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTAATTTTGAAATGACTAAATTTAAAAAGAAAATTGCATTTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGTGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTGAATTTATGCTTTATAATAAATCCTAATTTAAGCAAGGATTTATTT
  5  -1   3        nb Mus1      in                          CABH593.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATTTTGAAATGACTAAATTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATNTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATT
  5  -1   2       ext Int1      in                        CAAP14068.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATGACTAAATTTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTT
  5  -1   3        nb Hrt1      in                         CAAQ8388.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAATGACTAAATTAAAAAGAAAATTGCATTGTGTTATTTTATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTCGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACT
  3   1   3        nb Mus1      in                         CABH4553.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTCATTTG
  3   1   3        nb Liv1      in                         CAAR7315.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGTAGTAGCTAAATAGTAATTTGCATTTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTCATTTTGA
  3   1   3        nb Ovi1      in                        CABI12673.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGTAGTAGCTAAATAGTAATTTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTCGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTCATTTGAAAAAAAAA
  5  -1   2       ext Ski1      in                         CABJ4115.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTGCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTCATTTGAAAAAAAAACCTCGTGCCGA
  3   1   3        nb Sto1      out                        CABG6334.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCATTCACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACNAAATTTATTTGTGTGTCCTGTAAATAAAACTCTCATTTTAAAAAAAA
  3   1   3        nb Sto1      in                         CABG1430.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATT
  5   1   3        nb Sto1      in                         CABG1430.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACTTGAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAAAAA
  3   1   3        nb Ski1      in                        CABJ10565.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTCATTTTG
  3   1   2       ext Ovi1      in                        CABI13532.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTCATTTTG
  5   1   2       ext Ovi1      in                        CABI13532.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAGCCCACAAAAGAATCATATTTTAGAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTCATTTTGAAAAAAAAAAAAAAAAA
  3   1   3        nb Brn1      in                          CABL470.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAATATAGTTATGATCAATCATATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTCATTTG
  3   1   3        nb Tad5      in                         XZT32150.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGTCGTATTACATTCTTTCTGTAGTTATGTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGTCCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAAGTGATCAGCGGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATCTAATAGAACTAAAATGACTTCATTTAACCATTGAATATACAATGTGTACCCAAAAGTCTTGGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTAGTTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATCACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCGTGAATGTTCATACATACAGTTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTGAATTTATGCTTTATAATAAATCCTAATTTAAGCAAGGATTTATTAAAAAAAAAAAAAAAGG
  3   1   3        nb Bone                               CBTC10211.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTGAATTTATGCTTTATAATAAATCCTAATTTAAGCAAGGATTTATTTAAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTCATTTT
  3   1   3        nb BrSp      in                     EC2BBA16BA11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGCAATAGGGGTGCACCAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTTTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTGAATTTATGCTTTATAATAAATCCTAATTTAAGCAAGGATTTATTTAAAAAAAAAAAAAAAA
  3   1   3        nb Thy1      in                       CBST12651.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGACCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGTGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATTCTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTTTTATTAAGAAATTGCGAGGCCCCGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTGAATTTATGCTTTATAATAAATCCTAATTTAAGCAAGGATTTTTTTAAAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTCCTTTTG
  3   1   3        nb Thy1      in                        CBST8807.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAATCCATCATTTTCAGTTTTGCCAAAAGCCAAATTGAAAGATTCAGTCCATACAAATAAGATAGCTGATATGCATATTCCAGGTTGAGCGTAATGCTTCAAAATTGGCTTAACTGGGACAAAAACAGTTGTCCTCAACTGATCAGCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATTCAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCCCGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCCGTATTTAAGTGGAAACTTGAATTTATGCTTTATAATAAATCCTAATTTAAGCAAGGATTTATTTAAAAAAAAAAAAAAAGTTAAAAATTAGGCTTTCAAAGAAAGCTTTATAAATGTTTTTGTAAAACAAATTTATTTGTGTGTCCTGTAAATAAAACTCTCATTTTG
  3  -1   3        nb Fat1      in                         CABC9350.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAA
  5  -1   3        nb Fat1      in                         CABC9350.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGAATGCTATAATTCAGCTGGATCCCAAACTGAATCCTGGATTTGTTGCATCCCTGATTAGCAAGAGAAGTGATAGCAATATATCCATATACTATATAATAGAACTAAAATGACTTCATTTAACCATTGAAAATACAATGTGTACCCAAAAGTATTCGGCTTAGGTCTAGAAAACCTAAAAAGTTGGTTAGAAGTGTGTTAAAGTTAAGCCTAGCATTCCATGTCCTTTTCTTATTAAGAAATTGCGAGGCCACGAAAAAGGAACAAATAACCTTAATGTCACTAGCGCTAAACGTGTGGACTGCGGATATGTTTTTGGTCTTAAATTACAGATTTTCATTCAAAAAAGTTCCTTCCTGAATGTTCATACATACAGTTGTGTTATTTTTGCCAGTCATCCCTGTATTTAAGTGGAAACTTAAATTAGGATTTATTATAAAGCATAAATTCAAGCAAGGATTTATTTAAAAAAAA
  5   1   2  SIG                                     Xt7.1-CAAJ14334.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTGCAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAGTATGACTTTACCAACTAGAACAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTCCACAAGTTTTGGTGGAAGGTACCAGAATCGTTGACGAGTTCGTTTCGGTGAGTTGTTGGGCGACAGCGCAGTGGCAGGTTTTGGTGGAAGGTACCAGAATCGTTGACGAGTTCGTTTCGGTGAGTTGTTGGGCGACACGGCTGCACTTCGATATTGGCAGTTAAGGAGTTGTTTTCCCTTGTTGCCGTGGACTGATTTTGTGACAGCAAGTACTTTATTTGAGATAATCTGTCCAAAATGCCTGGCAGGAAAAGGCCTGTCCTGTGTCAGCCATGGGAAGAGGATGAGTGCCTGGACTACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCCCAACTAACACAAAGTGACATTGATGCCCTATCTTTCCTGCTCCATGAAACACACCCCTTTACACATCCCTTGGATCCCCAGCTATGGACAGCTGAAGACGAGAGTGGTGAAGCAATGCCTAACAGTGCCTTGCTATCAGCTTGGCAAAGGTTGAATCGTGACAGTAGGACACTTAATGAGAATAAGTTGGACTCTCCAGATCTTCAACCCAAGGATGGGACTGAGCTACTGCTTAAACTTGAGAGAATGGGAAAATGTGATGAGAGCAACTTTACACATCTCTTGCAACTGTTACGTGTATTAACACGTCATGACCTGCTCCCATATGTTTCCATGAAAAGACCCCGCACAGTGTCCCCTGAGAGGTATACACATGGCCCATCTATATTGGATTCTGACAAGCAAATGGATAAATGTCTTAACCCAACCCCTTCAGGCACCAGTGAAGAAAACTGGGAAACAGGGTCTAACGCCAGCAAAAGAAAGAGAAGCGGGACTCAAAAAAGGGGTCGCTGCCCCAAACCAAAGAGAAATAAAGCGAGCAACACTCCCTCGCAGAATCCAATTAACCAGAGCAAAGTAACATGTGGTAAGTTGTATTCAGGCTATGTCTTTGGCCATAATCTAATGGAAGTAAATATCTTACTGTAAAAGGTGGGAAACCTATGCATATAGTTTTTTCCCACTTAAAGAAAATATTATTACAACAGCTATAAACTATAAGACAAGCTGGCATTTAAAGGGGTTTATATAAAGATAGGCACATCAAGAGCAAAAATTATGTAAGAATTAGTTAAACTTTACTAGTTGCTCTTGTCAAATATCCCTAACTGTGGAAACTCAATGGCTCAGTTGCTTTATGTGGTTTAGTACTAAGGTTCTGTAGTTTAAACACTTATGTACTTCTTGTGTGTCTACAGCATTGTTGCCTTTACCTTCTGAAGGCAGAATCTGTATCTCTTTTGTGTCATTTCACTAACAAATTTTTACCACTGGCCTTCAACACATTGTAAAGATTTTTTGTCTTTATATGGTTGAATTAACTTGCTCTTCCATATCGCTTTTGAAGAAAGCTCTAACTATCTGAGAATTTCCACCACTGCCTCACTGCATTGTTTATTGCCCACAGAGAGCAAAATGAAGATCAAGTCAAATAATATAGTGATTTTGCAAACAACTGATGTTTCTGGCACTTAAAAACTTTTATT
                                                  Xt7.1-CHK-1008273886                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAGCTCTTTTGTTGTCAGTCACTTCATTAAGCAAAAGGGTAAGATGTTTGTTTGCTCTGTCAGATTTTAGAATTCATCTGTTATACTTGTTGCTTGGGTGTGAGCTTGAGATACTCGTTTCTCCCATCTTCTAGTAACTATAAAATCTCATGACTATACAAAACAAATCTTTATTATTTTAGCACTATTTATACAAAGTAGTTTATTCTCCCCACAAACAAATCAATCCTTACTAAATCAGCAATTGTAGGTGTCCTGCATATTGCACTGCAGCATTAATCATCCATTAGCATTCTTATCTGATGGAGGCATGCAGGCAGTTGTCTATTCTGTGATATTTTATGGGTAGATGGCACCTGTCCCTGGATTAGCTAGTCTTTATATGGTCATAAAATCAAATGTTGCTGCATCCATCTTTTTACTTGGCATTGGCTGTTGCTCTGTAAGTATGACTTTACCAACTAGAACAAAATCAGTCATGCCATGTGGTAATCAATATTCAGCTATATTTTAGTGTATTGATATTGAACTTTTACTTTTTTTCTTCTAACAATAATATTTTAAATGCTAATCATCATGTGTGCCACACCATAAATAGATTTGGTTTAGAGATAAAAGGCCAAAACCTATTGACATAATTGCCCATTTTTATACTTTATTTCTTTGAATGGCAATTTACTTGGGAGAAACTGTTGCTGTATGATTGGACTATCAAAATGTGATATTATGCGCTCTCAGTTAAACACTTCTGCAGGTTGACCTTxxxCAxGTTTTGGTGGAAGGTACCAGAATCGTTGACGAGTTCGTTTCGGTGAGTTGTTGGGCGACAxxGCxGTGGCAGGTTTTGGTGGAAGGTACCAGAATCGTTGACGAGTTCGTTTCGGTGAGTTGTTGGGCGACACGGCTGCACTTCGATATTGGCAGTTAAGGAGTTGTTTTCCCTTGTTGCCGTGGACTGATTTTGTGACAGCAAGTACTTTATTTGAGATAATCTGTCCAAAATGCCTGGCAGGAAAAGGCCTGTCCTGTGTCAGCCATGGGAAGAGGATGAGTGCCTGGACTACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCCCAACTAACACAAAGTGACATTGATGCCCTATCTTTCCTGCTCCATGAAACACACCCCTTTACACATCCCTTGGATCCCCAGCTATGGACAGCTGAAGACGAGAGTGGTGAAGCAATGCCTAACAGTGCCTTGCTATCAGCTTGGCAAAGGTTGAATCGTGACAGTAGGACACTTAATGAGAATAAGTTGGACTCTCCAGATCTTCAACCCAAGGATGGGACTGAGCTACTGCTTAAACTTGAGAGAATGGGAAAATGTGATGAGAGCAACTTTACACATCTCTTGCAACTGTTACGTGTATTAACACGTCATGACCTGCTCCCATATGTTTCCATGAAAAGACCCCGCACAGTGTCCCCTGAGAGGTATACACATGGCCCATCTATATTGGATTCTGACAAGCAAATGGATAAATGTCTTAACCCAACCCCTTCAGGCACCAGTGAAGAAAACTGGGAAACAGGGTCTAACGCCAGCAAAAGAAAGAGAAGCGGGACTCAAAAAAGGGGTCGCTGCCCCAAACCAAAGAGAAATAAAGCGAGCAACACTCCCTCGCAGAATCCAATTAACCAGAGCAAAGTAACATGTGGTAAGTTGTATTCAGGCTATGTCTTTGGCCATAATCTAATGGAAGTAAATATCTTACTGTAAAAGGTGGGAAACCTATGCATATAGTTTTTTCCCACTTAAAGAAAATATTATTACAACAGCTATAAACTATAAGACAAGCTGGCATTTAAAGGGGTTTATATAAAGATAGGCACATCAAGAGCAAAAATTATGTAAGAATTAGTTAAACTTTACTAGTTGCTCTTGTCAAATATCCCTAACTGTGGAAACTCAATGGCTCAGTTGCTTTATGTGGTTTAGTACTAAGGTTCTGTAGTTTAAACACTTATGTACTTCTTGTGTGTCTACAGCATTGTTGCCTTTACCTTCTGAAGGCAGAATCTGTATCTCTTTTGTGTCATTTCACTAACAAATTTTTACCACTGGCCTTCAACACATTGTAAAGATTTTTTGTCTTTATATGGTTGAATTAACTTGCTCTTCCATATCGCTTTTGAAGAAAGCTCTAACTATCTGAGAATTTCCACCACTGCCTCACTGCATTGTTTATTGCCCACAGAGAGCAAAATGAAGATCAAGTCAAATAATATAGTGATTTTGCAAACAACTGATGTTTCTGGCACTTAAAAACTTTTATTGTATCC
  0   1   1           Brn3 FL                          CAAK5664.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAACATGTTTTGGCTGAAAGGGGCGTAGGTTTTGTTGCTGTTTTGCGGGCAAGCGCAGTGGCAGGTTTTGGTGGAAGGTACCAGAATCGTTGACGAGTTCGTTTCGGTGAGTTGTTGGGCGACACGGCTGCACTTCGATATTGGCAGTTAAGGAGTTGTTTTCCCTTGTTGCCGTGGACTGATTTTGTGACAGCAAGTACTTTATTTGAGATAATCTGTCCAAAATGCCTGGCAGGAAAAGGCCTGTCCTGTGTCAGCCATGGGAAGAGGATGAGTGCCTGGACTACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCCCAACTAACACAAAGTGACATTGATGCCCTATCTTTCCTGCTCCATGAAACACACCCCTTTACACATCCCTTGGATCCCCAGCTATGGACAGCTGAAGACGAGAGTGGTGAAGCAATGCCTAACAGTGCCTTGCTATCAGCTTGGCAAAGGTTGAATCGTGACAGTAGGACACTTAATGAGAATAAGTTGGACTCTCCAGATCTTCAACCCAAGGATGGGACTGAGCTACTGCTTAAACTTGAGAGAATGGGAAAATGTGATGAGAGCAACTTTACACATCTCTTGCAACTGTTACGTGTATTAACACGTCATGACCTGCTCCCATATGTTTCCATGAAAAGACCCCGCACAGTGTCCCCTGAGAGGTATACACATGGCCCATCTATATTGGATTCTGACAAGCAAATGGATAAATGTCTTAACCCAACCCCTTCAGGCACCAGTGAAGAAAACTGGGAAACAGGGTCTAACGCCAGCAAAAGAAAGAGAAGCGGGACTCAAAAAAGGGGTCGCTGCCCCAAACCAAAGAGAAATAAAGCGAGCAACACTCCCTCGCAGAATCCAATTAACCAGAGCAAAGTAACATGTGGTGTTCTGAGCAAAGGTTGATGGTTAAGAGAGAAAGTCTCTTAAATAACGAAATGATCATGCGCTCTTCAGTTCTCAAACAAGCGCACCACAAAGTTAAGATCGCCAATGGAAAAAAGCCTTAACTAGCTGCTCTGACAGTCTCTGGCACTGCAAGTCAATGGTAAACTTGGGAGCAAAACACAGGCTTGTTTGTTTCTGCTTCCGTCTGTGCTCTATATACGACCTGCTCAACATTTTACAATAAGCATCTCAACATGGACAATTATGTTACGAATATTGCAAAACCTAACATGTCTTCAGCTTTCTCCTGGTTGTGGTCCCTTTAATAAAAGGGAAAGAGTTTGTTTTGGATCTGTTACTGTGCTATTAGGAATCAGGCCATGGCTGCCAAATTTTACAGAAAATTGTGTTACTCAGCTGGCTTAGGTGCCATGAATACCATCATCGAAAAGTTTTGGACAGCCAATGATATTCAATTTTTTAACCTGATTTATCTTTTTAAATATTGTATTGTTCTATTATCACCTTATAATGATAAAAGAGTGTTTTGAAGTGTATATTTTGGTTTTATCACACATACTTGCTGTTTATTTATAACCCCTTTGTGTTAGTGACTGCATACTGTGTTTATCTATTTATGTATTTGCAGTATGTTTTTAACACAAAGACCACCACAGCATTACTGTCACAATGGGGTTAGTATAGAGGAAAATAAAACACAACCAGAAAAAAGTTTTTGTCCTAAAAAGAAATGTTTAAAAATATTGGTTTATCAATAGTTTTTGTATTTTTATGGTTAATTCTTTTGGATGTTAGACACAAGATATGTAAAGAGAACAAAGCATTTTTACATTACTGTGTGATCACAGACTGGCTAGACTTTCAAGCACTCCTTGAGAAAAAGGTATTCCCAAAATTATATTCTTGAACAAAGCTCTATTTAAGGTGGTCCTGCACTGTAAGATCCACTATTTGGACAAGAAGACATTGGGCTGATCTGATCATCTGATCCCCAGGCCAACAATTTGATCAGAATGGGGGCCTAGGGATATGGTTCTCATATGATTTTGTAACCTGCCCTGATTTTCTGGCACATATCAGTAAAAAAGACATTAGAATGGCACCATACATGGGCCAAAATGTTGACAACTTGGTCTGGAGGGGCTGAGATGGCAGCTTTTATCAATTTGTGTATGTGCACCTTTACTTGAATATTGATGTTGCTGGATTCTGAAAACATGTCTCCCTGTCTATCTGTAATGTAACGTTAGAGGTATTTTTTTTTTTATAAAAAAAAAAAACCTACAAGTACTGATTATTTACTCGGTATGTGGTACAGGTTCCGTGCATGGAATGGTAAACAGAAATGGCTGTGTGAGTTTTATGGTATTGCCTTAACCTGATTCAAATATATAAATGGCACAAGCTAGTTAAGAGACATTTCCTGAAAATTGAAGCCTGCTCTTACACATGGGCTGTGTTAAACAGTGTAATTTTACTTAAAATATAAGCTTCATATGCACAATGGCAGTATCTTTCTTTCCTTTGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   4      seed Brn2      in                        CAAJ14334.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCAACAGAAAATCATTTGCTTTAATATTACTGCAGTTGAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCCATGCCTTTACAAATTGTTCTGCAAACTCTGCATTCTGTAAACCGAATTCCTTTGCAATCTATTGTGTCATGTAAGAAAGATTGTGTAAATTAAAGAAAGAGAATGCTTTCTCCACTTCATTACTCATC
  3   1   2       ext Thy1      in                        CBST9517.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATCATTTGCTTTAATATTACTGCAGTTCAATAATGCTGAAAGCAAGCATTGTTACAACCAGTGAGCAGCAATACATCTTATACAACTGCATTAAACAATTTACATTTGGTACAACTGGGTTTCTAGCAGCTTTCTTTGTCCAGAATTTTGTATTGCAGTCTATGTATACTGGCTATTTAGTGTATAGCACCCAATGCTGCAATGGGTTTCTGGTATTAAAAGATAGGAATACACTGCCAAGTAAAATACTAAATACATTGCTTTAGGATTTGGCCAAATACTGTATATCATTTAGAATATTAAAACTAGCAGCAACCTTTATATGGTCACTATGTATCACTTACGCAAGAGCATCCCAAGTGTTGTCAATTCTAATAAAGATTTCACTGAAAGGATGCTAAGGACTGTGCTGCTGATTTCTGATAAATACTGTCATTTCTGTTGAATCCTGCATGTTGTGCTTCCTTGGTGCAAATTGCAACATACAGCAAGTATTACTCAAAGAAAATGGCTTTAAAAAAACCCAATTGAACATAGCAGCATTACAGTGGCTGCCATACTTTCCAGTGCTATGTCTCTTTTCATTGTGCAGAAGCACGCCTGTTAATCATGTACTTGAAATCCAGCAACTGTTACTAGATGTGCAATATTGAATACAATTCC