Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 86%

 1012071712 Xt7.1-XZT3947.5.5 - 102 ESTs
                                                                       .......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-XZT3947.5.5                                                                                                                                                                                                                                                        CTCTCCAGCGCTGACATACCCTCCCTGCCTCCATCCAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAATGAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008223200                                                                                                                                                                                                                                                              AGCGCTGACATACCCTCCCTGCCTxxxxxCAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAAxxAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                             3    11     6    13     7    19    12    25    14    30    22    37    26    41    28    43    38    45    45    46    46    46    46    47    47    47    48    48    48    49    47    49    50    50    51    51    51    51    51    51    51    52    51    52    49    52    50    52    49    51    50    51    50    51    50    51    51    52    52    53    53    54    52    53    52    53    52    53    52    53    51    52    51    52    51    52    51    52    51    52    51    52    52    53    52    53    51    53    52    53    52    54    51    54    50    53    48    52    47    51    47    52    46    51    42    50    42    49    44    52    46    53    49    56    46    55    49    60    49    58    46    58    47    57    45    57    45    55    44    55    43    55    44    59    42    57    41    56    42    57    42    57    37    55    39    56    48    56    42    55    46    54    46    54    44    56    47    54    44    50    43    47    46    48    45    48    45    47    42    47    42    46    44    46    42    46    44    46    43    44    41    44    43    44    42    44    39    43    40    42    42    42    42    42    39    41    39    41    42    42    42    42    42    43    42    44    38    44    41    44    43    44    40    44    39    43    41    43    42    43    41    43    40    43    40    43    38    43    34    43    33    43    32    43    32    43    30    42    27    40    27    38    26    37    23    36     9    22     7     9
  5   1   2  SIG                                     Xt7.1-CABI10378.5                                                                                                                                                                                                                                   CTCCCTCACTCTTGCACTCTACTCTCCAGCGCTGACATACCCTCCCTGCCTCCATCCGACTGTGCTGGGGCAATTGGTATGTGCCAGGCTTCCCCTCTGCCTTCTATCAGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCACAGTCGGAATGAGCGGCGCAAAAA
  5   1   2  SIG                                       Xt7.1-XZT3947.5                                                                                                                                                                                                                                          CGGGAGGCGGGGCAAAGTCGGTCACTTAGCGTGAAGCGGTCTGAGGTGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                    TAGCGTGAAGCGGTCTGAGGTGAC
                                                                   VAR                                                                                                                                                                                                                                                                                            GACTGTGCTGGGGCAATTGGTATGTGCCAGGCTTCCCCTCTGCCTTCTATCAGGTGAGTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                        C----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                            -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----T-----T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----------AA
                                               BLH ATG     117     310                                                                                                                                                                                                                                                        
                                               BLH MIN     117      77                                                                                                                                                                                                                                                        
                                               BLH OVR     117      32                                                                                                                                                                                                                                                        
                                               CDS MIN     117      18                                                                                                                                                                                                                                                        
                                               EST CLI      41      18                                                                                                                                                                                                                                                        
                                               ORF LNG     117       1                                                                                                                                                                                                                                                        
                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sc ---- 7e-010     NP_012045.1 Putative low-affinity copper transport protein; Ctr2p [Saccharomyces cerevisiae] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 1e-016     NP_001021418.1 F27C1.2a [Caenorhabditis elegans] -------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 3e-038     NP_572336.2 CG3977-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 3e-050     XP_785308.1 PREDICTED: similar to solute carrier family 31 (copper transporters), member 1 [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dr ==== 3e-076     NP_991280.1 solute carrier family 31 (copper transporters), member 1 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Gg ==== 3e-077     XP_001232515.1 PREDICTED: similar to Solute carrier family 31, member 1 isoform 1 [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 7e-079     NP_780299.1 solute carrier family 31, member 1 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 4e-083     NP_001850.1 solute carrier family 31 (copper transporters), member 1; hCTR1; coppertransporter 1 [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Xl ==== 9e-096     AAH53785.1 Unknown (protein for MGC:64360) [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = ?? ==== 9e-096     NP_001079733.1 hypothetical protein LOC379422 [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Xt ==== 1e-104     AAH67952.1 Hypothetical protein MGC69410 [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-XZT3947.5.5                                                                                                                                                                                                                                                                                                                                                  TGA---TGA------------------ATG---------------------------------------------------------------------------------------------ATG---ATGATG---ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------ATG------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------TGA------------------------ATG------ATG---ATGTAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------TAA------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------TAG---------------------------------------------------------------------TAA------------------------------------------------------------ATG------------------------------------------------TAGTGA---------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2  SIG                                     Xt7.1-CABI10378.5                                                                                                                                                                                                                                   CTCCCTCACTCTTGCACTCTACTCTCCAGCGCTGACATACCCTCCCTGCCTCCATCCGACTGTGCTGGGGCAATTGGTATGTGCCAGGCTTCCCCTCTGCCTTCTATCAGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCACAGTCGGAATGAGCGGCGCAAAAA
                                                  Xt7.1-CHK-1008279028                                                                                                                                                                                                                                         CACTCTTGCACTCTACTCTCCAGCGCTGACATACCCTCCCTGCCTCCATCCGACTGTGCTGGGGCAATTGGTATGTGCCAGGCTTCCCCTCTGCCTTCTATCAGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAAxxTxxxCAGTCGGAATGAGCGGCG
  5   1   2       ext Egg                            TEgg045e01.p1kSP6                                                                                                                                                                                                                                   CTCCCTCACTCTTGCACTCTACTCTCCAGCGCTGACATACCCTCCCTGCCTCCATCCGACTGTGCTGGGGCAATTGGTATGTGCCACGCTTCCCCTCTGCC
  5   1   2       ext Gas  5g3  in                   TGas126j18.p1cSP6                                                                                                                                                                                                                                             CCCGGGCTCTACTCTCCAGCGCTGACATACCCTCCCTGCCTCCATCCGACTGTGCTGGGGCAATTGGTATGTGCCAGGCTTCCCCTCTGCCTTCTATCAGGTGAGTCCGACTGTCGCTCCGGCCCAACATGGATCACTCCCACCACACGGTAACCACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATGCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAAGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCAT
  5   1   3        nb TbA  5g                        TTbA066c22.p1kSP6                                                                                                                                                                                                                                                    CTCTACTCTCCGCGCTGACATACCCTCCCTGCCTCCATCCGACTGTGCTGGGGCAATTGGTATGTGCCAGGCTTCCCCTCTGCCTTCTATCAGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGNGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAAAAGGCNGGTGGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGC
  5   1   3   10   nb Ovi1 5g3  in                        CABI10378.5p .........................................................................................................................................................................................................................................................CTCCAGCGCTGACATACCCTCCCTGCCTCCATCCGACTGTGCTGGGGCAATTGGTATGTGCCAGGCTTCCCCTCTGCCTTCTATCAGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTTCTCTGCGCCAATCATACNGTGGCT
  5   1   4      seed Lun1      in                        CABD13773.5p                                                                                                                                                                                                                                                                                CTGCCTCCATCCGACTGTGCTGGGGCAATTGGTATGTGCCAGGCTTCCCCTCTGCCTTCTATCAGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTTCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCT
  3   1   3        nb Ovi1 5g3  in                        CABI10378.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACNGAGAATCTGCAGTCGGAATGAGCGGCGCAAAAAAA
  3   1   4      seed Lun1      in                        CABD13773.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTTTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAATGAGAAAAAAA
  3   1   2       ext Gas  5g3  in                    TGas126j18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTTTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGGAATCTGCAGTCGGAAAAAAAGAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                       Xt7.1-XZT3947.5                                                                                                                                                                                                                                          CGGGAGGCGGGGCAAAGTCGGTCACTTAGCGTGAAGCGGTCTGAGGTGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008279030                                                                                                                                                                                                                                                GCGGGGCAAAGTCGGTCACTTAGCGTGAAGCGGTCTGAGGTGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAAAAAAAAAAAAAAAAAAAA
  5   1   1           Tbd0 FL                     IMAGE:5335501.FL-MGC                                                                                                                                                                                                                                                                          GAAGCGGTCTGAGGTGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg008d18.FL-Sanger                                                                                                                                                                                                                                                                                                TGGGCTGCTCTCTTTCCCATGGTCAGGCAGGAACACCCCCCCCCCCCGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAAAAAAAAAAAAAAAAAA
  5   1   0       chi In54                            IMAGE:8944270.5p CCCCACACACAATTTCATATCACCCCGCCACGAATTCGTCCCGGATCAGTGACAGTGGGGGGGCTAATGGCTGGGACACGCTTGCATGTGATTGGCTATTAGTGTCACTGCGCTGATGCTGTTCTGTTCCCTAATCCCTTTATCTCGGGGCCCTGCGGCCCTTCCCCTGTATAATCAGATTCCCCGGCTCTGTGATTGCCAATTACCCCATTATCTGCCCCAGACACGACTAAACAAGGTTTAATGGCAGCAGCATGACGGCTGAGAGGGGCCGAGTGTTAGAGCCGGGGGCAGGAATAATGTCCCCTAATGTCATTTGTTCCTCTGTCCTCCCAGGTGAGTCCGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCGGAAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCCGGGCCCAATGGGACCATTACTGATGGAGACCCACAAAACAGTAGGGCAGCGATGCTTGAGTGTGCCCCACCTGGCTGCAGACCTACCTGCACATATCATGTAGGGGTGAGCTACTTTCTGATGCTGAATCCTTCATGACCGTACAACGCTACCTGTTCATTGCGGTGACGCCGGGCCGGAACGGGGCCTACTTTCCTGTTTCAACCGTGAAGAAAGTC
  5   1   2       add In66 5x3                        IMAGE:8965930.5p                                                                                                                                                                                                        TTTATTTTTTTAGGTTATTTCTTTTTTCTTTAAAAAACGTCCCCTCTACTCTCCAGCGCTGACATACCCTCCCTGCCTCCATCCGACTGTGCTGGGGCAATTGGTATGTGCCAGGCTTCCCCTCTGCCTTCTATCAGGTGAGTCCGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTGCTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCTTTGAGATAAGTGATGATCACATGACCATGTAGCTCACTCCCTCTCTCTTCTCTGCGCATCATACGGTGCTCCTGGTAGACACGCCCCCTCACAGGTGTTCACTGTGACA
  5   1   3        nb Egg  5g                        TEgg141l07.p1kSP6                                                                                                                                                                                                                                          CGGGAGGCGGGGCAAAGTCGGTCACTTAGCGTGAAGCGGTCTGAGGTGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCCGACTGTCGCTCCGGCCCAACATGGATCACTCCCACCACACGGTAACCACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACGTACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTT
  5   1   2       ext HdA  5g                       THdA036o13.p1kbSP6                                                                                                                                                                                                                                          CGGGAGGCGGGGCAAAGTCGGTCACTTAGCGTGAAGCGGTCTGAGGTGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCCGACTGTCGCTCCGGCCCAACATGGATCACTCCCACCACACGGTAACCACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGCTACCGGGGGGTATTGGGGGTAACCCTACGTACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGA
  5   1   2       add In62 5x3                        IMAGE:8952949.5p                                                                                                                                                                                                                                            CCCCACCGTTTCTCTACACTTCCAGAACCCCCCAACTAATTCGTCCCCGACTGTGCTGGGGCAATTGGTATGTGCCAGGCTTCCCCTCTGCCTTCTATCAGGTGAGTCCGACTGTCGCTCCGGCCCAACATGGATCACTCCCACCACACGGTAACCACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGCGGGTGGTGGTGGACATCACGGATCATTGCCATTAACGAGCGCTCGTTTAGGGAAGGAGCTCTGTGCCCGCCTCCATCGGCATTCCTAGATGTTGCTCCCGGGGGTATTGGGGTACCCCTACGTACAGAGTGCCTTTATTTGCCTCTAGCGGGGGGTCAGTGACACTTTCCTTTTGAAGATAAGTGAATGAACCACATGAACAATGATAGCCTCCGCCCCCTTCCCTCCTTCCTTCCTCTGACGC
  5   1   2       add In54 5x3                        IMAGE:8944514.5p                                                                                                                                                                                                                                              CCTCTTGCTGCTACATATGATCAGACCGATTCGAATTCGTCCCTGGGTTTGCACCTTGGGAAGGTTCTAGAACATATCTTTAAGGGAAAGTCCACCTGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCGTTTGAGATAAAGTGATGACACATGACATGTAGCCTCACCCCTTCCCTCCTCTTCCTCTGCTCCAATCATACGGTGGCTTCTT
  5   1   2       add In63 5g                         IMAGE:8961692.5p                                                                                                                                                                                                                                                   AAATTAAAAATTAATTAAATATATAAATAATTTAAAATTCGTCCCCGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCCTGTGCATCGCGGTGGCCGCCGGGGCCGGGGAC
  5   1   2       ext TbA  5g3  in                   TTbA002e07.p1kSP6                                                                                                                                                                                                                                                     GCAAAGTCGGTCACTTAGCGTGAAGCGGTCTGAGGTGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATAC
  5   1   2       add In60 5x3                        IMAGE:8948407.5p                                                                                                                                                                                                                                                     GTGGTTGTTAATTAAGGATCTCATCGATTCGATTCGTCCCACTGTGCTGGGGCAATTGGTATGTGCCAGGCTTCCCCTCTGCCTTCTATCAGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGATAAAGTGGATGACCAACATGACCATGTAGCCTCACCCCCTCCTCCTCTCTCTGGCGCATTCATACCGTGGCTCTGAAGACCCGCCTACATGTCACTGCAGCATTCAGTCTTGGTTCTATTGGAGCCTGGGCTTAAGACACAACTAT
  5   1   2       add In66 5x3                        IMAGE:8965668.5p                                                                                                                                                                                                                                                               TAGCTGACATACCCTCCCTGCCTCCATCCGACTGTGCTGGGGCAATTGGTATGTGCCAGGCTTCCCCTCTGCCTTCTATCAGGTGAGTCCGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCTCGCCTCCATCGGCATTCCTAGATGTTGCTACCGGGGGTATGGGGTAACTCTACATACGAGTGCCTTTATTTGCTCTAGCGGGTCAGTGACCCTTTCTTTGAGATAAGTGGATGACCACATGACATGAAGCCTCACCCCATCTCTCTCTCTGCCATCATACGTGCTCTGAGACCGCCTACGGTTCATGCAGCATCAGCTTTGTCTCATCGAGCCTGACTAGCACTCAACTCAATGGCGCTGAACGTCATGAACTTCAGCAGCCTAGCACT
  5   1   2       add In60 5x3                        IMAGE:8947416.5p                                                                                                                                                                                                                                                                     TTTATTTTTATTTACCGATAACATCGTATTCGTATTCGTCCCGTATGTGCCAGGCTTCCCCTCTGCCTTCTATCAGGTGAGTCCGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAAGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGCTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCCTTTGAGATAAAGTAGATGACACATGACCATGTAGCCTCACCCCTTCCCTCTCTCTCTGCGCATCATACGGTGGCTCTGAGACCGCCCTACAGTGTCACTGCAGCAATCAGTCTTGGTCTCATCTGAGCCTGCTAGCACACCATTTTATTTGGCCCGGACTGTA
  5   1   3        nb Tbd0 FL   in                    IMAGE:5335501.y1                                                                                                                                                                                                                                                                          GAAGCGGTCTGAGGTGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGA
  5   1   3   12   nb Gas7 5g3  in                         XZG24802.5p ...........................................................................................................................................................................................................................................................................AGCGGTCTGAGGTGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGG
  5   1   2   12  ext Tad5 5g3  in                         XZT58145.5p ...........................................................................................................................................................................................................................................................................AGCGGTCTGAGGTGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACG
  5   1   3        nb Neu  5g                        TNeu030p14.p1kSP6                                                                                                                                                                                                                                                                              CGGTCTGAGGTGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAAGATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTC
  5   1   3   12   nb Tad5 5g3  in                         XZT16639.5p .................................................................................................................................................................................................................................................................................CTGAGGTGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTG
  5   1   2       add In54 5x3                        IMAGE:8943385.5p                                                                                                                                                                                                                                                                                  CTGAGGTGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAAGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCCTTTATTTGCCTCTAGCGGGGGGTCAGTGACACTTTCCTTTGAGATAAGTGATGACAATGACCATGTAGCCTCACCCCCTTCCCTCCTTCTTCCTCTTTGCGCCAATCATA
  5   1   3   10   nb Tbd1 5g3  in                        CBXT17897.b1 .....................................................................................................................................................................................................................................................................................GGTGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGTTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGG
  5   1   0       chi AbdN 5x                            IMAGE:7004421                                                                                                                                                                                                                                                                                        TGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAAGCGGTGGTGTTGGACATCACGGAACATTTGCATTAACGAGCGCTCGTTAGGGAAGGAAGCTCTGTGCCCCGCCTCCATCGGCATTTCCAAAATGTTGGTACCCGGGGGTATTGGGGTAAACCCTACATACAAAGGGCCCTTTATTTGCCCCCTAGCGGGGGGTCAATGACAATTTTCCTTTTGGAGGGATAAAAATGGGATGAAACCACCTGAACCCTTTTTACCCTCAACCCCCTTTTCCTTCCTCTTTCCCTTGGGGGCCCAATATATAACGGGGGGGGCTCCCGGGAAAAA
  5   1   2       add In60 5x3                        IMAGE:8951125.5p                                                                                                                                                                                                                                                                                        AGGGCTTGGGGGGGGCAATTTGGTATGTGCCATGGCTTCCCCTCTGCCTTCTATCAGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACATGTAGCCTCACCCCCTTCTCTCTTCTCTGCGCATCATACGTGCTCTGAAGACCGCCCTACAGTGTCACTGCAGCCATTCAGGCCTTGATCCAACG
  5   1   3   10   nb Tail 5g3  in                         CBSW6606.b1 .......................................................................................................................................................................................................................................................................................TGACAGTACGCGGAGTGACCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGAGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACAC
  5   1   2       ext Brn1 5g3  in                          CABL699.5p                                                                                                                                                                                                                                                                                                 GATTCGAATTGGCCGAGGCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTTCCTCCTCTTNCTCTGCGCCAATCATACGGTGGCTCCTGG
  5   1   2       add Egg  5g3  in                   TEgg061c13.p1kSP6                                                                                                                                                                                                                                                                                                  GGCTGCTCTCTTTCCCATGGTCAGGCAGGAACACCCCCCCCCCCCGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAAGCGGTGGTGGTGGACATCACGGAACATTGCCATTAA
  5   1   2       add Egg  FL   in                   TEgg008d18.p1kSP6                                                                                                                                                                                                                                                                                                   GGCTGCTCTCTTTCCCTGGTCAGGCAGGAACACCCCCCCCACCCGGGTGAGTCTGACTGACACTTCGGCCCAACATGGATCACTCCCACCACAGGGGAACTACCACCTACCCCCACGGGGGCCACCAACACCCAACCACATCCTGGAACCACCGCGACCACGGGGGCATCTTGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGATCACCGGGTTGGTCATTAACT
  5   1   3        nb Egg  5g                        TEgg127j13.p1kSP6                                                                                                                                                                                                                                                                                                     CCCGGGCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTG
  5   1   3   10   nb Tbd1 5g3  in                        CBXT17801.b1 .......................................................................................................................................................................................................................................................................................................TTTCTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGTTGTTCACCGGGTTGGTCATTAACTCTGCAAGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAG
  5   1   3   32   nb Tad5 5g                              XZT27119.5p ..........................................................................................................................................................................................................................................................................................................CTCTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCCGACTGTCGCTCCGGCCCAACATGGATCACTCCCACCACACGGTAACCACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGCTACCGGGGGTATTGGGGTAACCCTACGTACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCGCCCCCTTCCCTCCT
  5   1   3        nb Gas  5g                        TGas002h06.p1kSP6                                                                                                                                                                                                                                                                                                             CTGGTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCT
  5   1   3        nb Neu0 5g3  in                       IMAGE:6991826                                                                                                                                                                                                                                                                                                                GTTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAATAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAAATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGGCTCCTGGGAAGACACGCCCCTACAATGTCACTGCAGCCCATCAAAGTCTTGGTCTCATCTGAAAGCCTGGCCTTAA
  5   1   3        nb Tad5                                  XZT3947.5p                                                                                                                                                                                                                                                                                                                 TTCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAG
  5   1   4   10 seed Ski1 5g3  in                         CABJ6576.5p .................................................................................................................................................................................................................................................................................................................TCCGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGNGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTA
  5   1   3        nb Egg  5g3  in                   TEgg046m05.p1kSP6                                                                                                                                                                                                                                                                                                                   CGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCCGACTGTCGCTCCGGCCCAACAGTGGATCACTCCCACCACACGGTAACCACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGAGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGAGACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCACGTAGTGGTGAGCTACTTCCTGATGCTGATCTT
  5   1   3        nb Gas8 5g3  in                          st90i07.5p                                                                                                                                                                                                                                                                                                                    CGGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTACCCTACATACAG
  5   1   3        nb Egg  5g                        TEgg088p24.p1kSP6                                                                                                                                                                                                                                                                                                                     GGGATTGGAACTACGGATCCTGCGGAGGGTGAGTCCGACTGTCGCTCCGGCCCAACATGGATCACTCCCACCACACGGTAACCACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGG
  5   1   2       add In63 5x3                        IMAGE:8959168.5p                                                                                                                                                                                                                                                                                                                      GATTGGAAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACTAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGATAAAGTGATGAACCACATGACATGTAGCTCACCCCTTCCTCTCTCTCTGCGCAATCATACGTGCTCTGAAGACCCGCCTACAGTGTCACTGCAGCATCAGTCTTTGTCTCATCTGAGCTGCTAGACACCACTTCATGCGTCGTACGTCATGTGACTCAGCAGCTACGACTCAATGTCGATCGTACCATCGATTCAGGAACTCATGGAAATAACGAGTCGTGCATAAGGCAGTTCACGTTACATGTGGGCTGT
  5   1   3        nb HdA  5x3                      THdA029f01.p1kaSP6                                                                                                                                                                                                                                                                                                                        ATTGGAACTACGGATCCTGCGGAGGGTGAGTCCGACTGTCGCTCCGGCCCAACATGGATCACTCCCACCACACGGTAACCACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGNGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTNACCGGGGGTATTGNNGGTAACCCTACGTACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAGGTGGATGAACCACATGACCATGTAGCCTCGCCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCCATCAAGTCTTTGTCTCATCT
  5   1   2       add In62 5x3                        IMAGE:8956652.5p                                                                                                                                                                                                                                                                                                                          ACCTTCTTGCCTTTCTTATCAGGTGAGTTCCGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAGATGCGGTGGTGGTGGACATCACGGAACATTGCCATTACGAGCGCTCGTTAGGGAGAGCTCTGTGCCCGCTCATCGGCATTCCTAGATGTGCTACCGGGGTATGGTACCCTACTACGATGCTTTATGCTCTAGCGGGTCATGACCTTCTTGAGATAATGATGACCATGACATGTAGTATCTCTCTTCCCTGCCAATCATACTGTCTGAACGCTAAGGTCTGACATCAGTCTTGTCTCACTGACTG
  5   1   3   10   nb Liv1 5g3  in                         CAAR9439.5p ...........................................................................................................................................................................................................................................................................................................................GAACTACGGATCCTGCGGAGGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCT
  5   1   3        nb In66 5g                         IMAGE:8966544.5p                                                                                                                                                                                                                                                                                                                                     ATCCCTCGCGGAGGTGATCCGACTGTCGCTCCGGCCCAACATGGATCACTCCCACCACACGGTAACCACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAACTGGAAT
  3  -1   3        nb Int1      in                         CAAP1500.3p                                                                                                                                                                                                                                                                                                                                         TCTATCAGGTGAGTCTGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCT
  3  -1   3        nb Int1      in                         CAAP2931.3p                                                                                                                                                                                                                                                                                                                                                        TGACTGTCGCTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGGAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCT
  5   1   3   10   nb Liv1 5g3  in                         CAAR7806.5p ................................................................................................................................................................................................................................................................................................................................................................CTTCGGCCCAACATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCT
  5   1   3        nb Liv1      in                         CAAR5340.5p                                                                                                                                                                                                                                                                                                                                                                                        CCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTC
  5   1   3        nb Te5                                  CAAO5561.5p                                                                                                                                                                                                                                                                                                                                                                                                           AGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGCTACCGGGGGTATTGGGGTAACCCTACGTACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCGCCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATG
  5   1   3        nb Egg                            TEgg142l07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                             ACCACCAACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATATGAGAATGTAGAGGTGCTGTTCACCGG
  5   1   3        nb Int1      in                         CAAP6425.5p                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGGACACTTTCCTTTGAGGATAAAGTGGATGAACCACCTGACCATGAAGCCTCCCCCCCCTTCCCT
  5   1   2       ext Egg       in                   TEgg032c05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGA
  5   1   2       add Sto1      ?                          CABG3190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  tacagtatgggggtacagcttattgtgtgcccagaacattccctctctgtatgtttATGGACAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCA
  5   1   3        nb Eye       in                         CCAX2789.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGC
  5   1   3        nb Int1      in                        CAAP14111.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGGTTACTTGCCCTTTA
  3   1   3        nb Liv1 5g3  in                         CAAR7806.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGT
  5   1   3        nb Brn4      in                          CAAL718.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGCTACCGGGGGTATTGGGGTAACCCTACGTACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCGCCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCA
  5   1   3        nb Liv1      in                         CAAR2655.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTTATACCCAATATTTAGATGTGCCGCCAAGGNGCGG
  3   1   3        nb Neu0 5g3  in                       IMAGE:6991826                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTACTTCCTGATGGGAATTTTCATGACGTACAACGCCTTACTTTGCAATCGCGGTGGCCGCCGGGGCCGGGACGGGGTACTTCCTTGTCCAGCTGAAGAAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGAAGGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGTACCCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTTTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCAGTGACCTTTTTATAAATTCCTTTATTCCAATAGGAAAAATAA
  5   1   3        nb HdA                            THdA034h10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCTGATCTTCATGACTTTAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACAGAACATTGCCATTAACGAGCGCTCGTTAAGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGCTACCGGGGGTATTGGGGTAACCCTACGTACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAATGACCCTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCGCCCCCTTCCCTCCTCTTCCTCTGCACCAATCATACGGTGGCTCCTGAAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACAGAACTTTCCATGGAAG
  5  -1   3        nb Int1      in                         CAAP1500.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAA
  3   1   3        nb Egg  5g3  in                    TEgg046m05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACGTACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAGGTGGATGAACCACATGACCATGTAGCCTCGCCCCCTTCCCTCCTCTTCCTTNTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTAATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAAAAAAAAAAAAAAAAAAA
  3   1   4      seed Ski1 5g3  in                         CABJ6576.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTTTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAAAAAAAAAACCTCTCGCCCTA
  5   1   3        nb Brn4      in                        CAAL23333.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTA
  3   1   2       add Egg  5g3  in                    TEgg061c13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGTGGTGGTGGACATCACGGAACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTATGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTC
  5  -1   3        nb Int1      in                         CAAP2931.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGTGGTGGACATCACGGACATTTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTG
  3   1   3        nb Gas                            TGas121g22.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTTTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTTTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCA
  3   1   3        nb Liv1      in                         CAAR5340.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACATTGCCATTAACGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAAAAAA
  3   1   3        nb Brn4      in                          CAAL718.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGCTACCGGGGGTATTGGGGTACCCCTACGTACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCGCCCCCTTCCCTCCTCTTCCTTTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAATGAG
  3   1   3        nb Int1      in                         CAAP6425.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCGCTCGTTAGGGAAGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTTGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTC
  3   1   3        nb Liv1      in                         CAAR2655.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGAGCTCTGTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGAA
  5  -1   3        nb AbdN                               IMAGE:7022241                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCGCCTCCCATTGGGCATTCCTAAGATGTTGGTACCCGGGGGTATTGGGGGTAACCCCTACATACAGGAGTGCCTTTATTTGCCTCTAGCCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTTTTCCTTTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTTTTTGTTTCATTTGAAGCCTGGCCTAAGCACCACCACTTTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTAGGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTTTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTTTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTTTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGGGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATTTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCCGTCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Liv1 5g3  in                         CAAR9439.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTTTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGG
  3   1   2       ext Brn1 5g3  in                          CABL699.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGCCCCGCCTCCATCGGCATTCCTAGATGTTGGTACCGGGGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGG
  3   1   3        nb Brn2      ?                         CAAJ23734.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGTATTGGGGTAACCCTACATACAGAGTGCCTTTATTTGCCTCTAGCGGGGGTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGG
  5   1   2       add In60                            IMAGE:8947433.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTCCCTGAGGGTCAGGTTAGGAGGGACGCCAACGTATTCGTCCCCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAACGAGAATCTGCAGTCGGAGAGAAAAAAAAAAAATAAATAAAAACTAAATATTAAAGAAAAAAACAGAGAAATAGAAAAAAAAGGGGGCGGGCCGCAGGGCTTGATTACTCTAGAACGGCGCTCGAGCCTTCGCGTATGGTGGAATCGTATATAGCGTAGATCCGACTGATAGGAACATTGAGGGTTGGAACAACCACACTGATTGCATGACATGCTTATTGGAATCGGAAGCTATGCTTATGTACCCTAGAACCGCATGAC
  3   1   3        nb Tbd1 5g3  in                        CBXT17897.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTTTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGAAAAAAAAAAAAAAA
  3   1   2       ext Egg       in                    TEgg067b02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTTNTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTTTCATTTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTTTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTTTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTTCAATAGGTGAAAAAATAATAATAATTAATAGAAGCCTTTTAATAAANCGAGAATTCTGCAGTCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Egg       in                   TEgg067b02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTGACACTTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAA
  3   1   3        nb Eye       in                         CCAX2789.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTGACACTTCCTTTGAGGATAAAGTGGATGAACCACATGACCATGTAGCCTCACCCCCTTCCCTCCTCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGAAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGG
  5   1   3        nb HeRe                             EC2CAA36DH12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATGAACCACATGACCATGTAGCCTCGCCCCCTTCCCGCCCCTTCCTCTGCGCCAATCATACGGTGGCTCCTGGGAGACTCGCCCTACAGTGTCGCTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCTATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAAGTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCATCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCACCCCTTAGCGACCAATTATAACCCAATATTAAGATGTGCCGCCGAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTCACCGATTTCATTTTTTTTATTTAAGATTTTTTTTATGATTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTG
  3   1   2       ext TbA  5g3  in                    TTbA002e07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCTCCTCTTCCTATGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTTTTTGTTTCATTTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTTTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTTTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Tad5                                 XZT62476.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTCCTTTGCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTTTTTGTTTCATTTGAAGCCTGGCCTAAGCACCACCACTTTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTAAGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTTTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGGGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATTGTCCCTATGATAGTTTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTTTAATCCCATCCCTTAGGGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGGGGAGTCAAGGGGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATTTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAATG
  3   1   3        nb Gas8 5g3  in                          st90i07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTGNGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTNTTTGTTTCATTTGAAGCCTGGCCTAAGCNCCNCCACTNTCATTGGCCGGTNTGTACGTCATGNGACCTTCCAGCCAGCCCTANGACTTCACATGTTNGATTCCCGTTATCCCCNCATCCGATTTTTACGGAACTTTCCANGGAAGTATAACGAGTCCGTGNGGCAGTAAAGCCGATGTTCAACTGTAACNTTGNGNGTCTGTTTCATACNCTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTNNGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTTTAATCCCATCCCTTAGNGACCAATTATAACCCAATATTTAGATGNGCCGCCAAGGGGNGGNGTCAAGGNGATCNCATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATGA
  3   1   3        nb Brn4      in                        CAAL23333.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGG
  3   1   3        nb Tail 5g3  in                         CBSW6606.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGCCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACAGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGAAAAAAAAAAAAAAA
  3   1   3        nb Int1      in                        CAAP14111.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTTTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGG
  3   1   3        nb Tad5 5g3  in                         XZT16639.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAATCATACGGTGGCTCCTGGAAGACACGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTTTCATTTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTTTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTTTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGGGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAATG
  3   1   2       ext Egg       in                    TEgg032c05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGGAAGACACGCCCTACANGTGTCACTGCAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTTTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAATGAGAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7 5g3  in                         XZG24802.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCTGGAAGACTCGCCCTACAGTGTCACTGCAGCCAATCAAGTCTTTGTTTCATTTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTAGGACTTCACATGTTGGATTCCCGTTATCCCCACATCCTATTTTTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGGGGGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCATCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTTTAATCCCATCCCTTAGGGGCCAATTATAACCCAATATTTAGATGTGCCGCCGAGGGGGGGAGTCAAGGGGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTCTTTTTTATTTAAGATTTTTTTTTTTAGGGTTTTATCTGCATCATGGGACCTTTTTATAAATTGCCTTTATTTCCAATAGGGAAAAATAATAATAATTATTGAACCTTTTAATAAACGGGAATCTGCAGTCGGG
  3   1   3        nb TbA                             TTbA015n16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGCCAATCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTTTCATTGGCCGGTCTGTACGTCATTTGACCTTCCAGCCAGCCCTAAGAATTAACAAGTTCGATTCCTGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAAAGAGTCCGAGTGGCAGTATAATCCGATGTTCAAGAGGAACACAGTGGGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATAGTCCCTAAGATAGTCTGGAGATTTAAGCCCCGCCCCCTGGGTTCCCCAAACGGCAGAAGTTATAATCCCATCCATTAGCGACCAATTTTAACCCAATATTTAGATGAGCCGCCAAGGGGTGGAGTCAAGGCGATCACATGTTACATGTTAATTGCAGAACTATTCGCAAAGTTACCGAATTCATTTTTTTTTAATTAAGACATTTTTTTTATATGGTTTTATCTGCATCAAGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTATGAATAAAACGAGAATCTGCTAGTCGGAACGAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Sto1      in                        CABG10936.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGG
  5   1   3        nb Sto1      in                        CABG10936.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCAAGTCTTTGTCTCATCTGAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Tbd0 FL   in                    IMAGE:5335501.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGCCTGGCCTAAGCACCACCACTCTCATTGGCCGGTCTGTACGTCATGTGACCTTCCAGCCAGCCCTACGACTTCACATGTTCGATTCCCGTTATCCCCACATCCGATTTCTACGGAACTTTCCATGGAAGTATAACGAGTCCGTGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAAAAAAAAAAAAAAAAAAG
  3   1   2       add Egg  FL   in                    TEgg008d18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGGCCGGTCTGTATGTCATGTGACCTTCCAGCCAGCCGTACGACTTCACATGTTTGATTCCCGTTATCCCCACATCCGATTTATACGGAACTTTCCATGGAAGTATAAGGAGTCCGTGTGGCAGTAAAGCCGATGTTCACCTGTACCATTGTGTGTCCGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCTGCCAAGGGGCGGAGTCCAGGCGATCACATGTTCATGTTAATTGCAGAATTATTGTGCAATGTTGCCGATTTCATTTTTTTTTATTTAAGGTTTTTTTTTTTATGGTTTTATGTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Tbd1 5g3  in                        CBXT17801.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCCGATTTTTACGGAACTTTCCATGGAAGTATAACGAGTCCGGGTGGCAGTAAAGCCGATGTTCAACTGTAACATTGTGTGTCTGTTTCATACACTCGCCAGGTTAACTTGCCCTTTAATCGTCCCTATGATAGTCTGGAGCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATTTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTTTTGAACCTTTTAATAAACGAGAATAAAA
  3   1   2       ext Tad5 5g3  in                         XZT58145.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTTTAAGCCCCGCCCCCTCGGTACCCCAAACGGCAGAAGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGG
  5  -1   3        nb Egg       out                 TEgg053g20.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCCCAAAGGGCAGAAGTTTTAATCCCATCCCTTAGAGACCAATTATAGCGCAATATTTAGATGTGCCGCCAAGGGGCGGAGTTAAGGTGATCACATGCTCCTGTTAGTGGCAGAATTATTCGCAATGTAGCCGATTTCAATTTTCCTACATTTAAGATATGTTTCAGAAGGGTCGTATAAGCATCACGTGACCTTTTTATAAATTGCCTTTATTTTCACATAGTGAAAGAATAATAATTATTATTGAGCGCATTGATATAATGAGAATTCGCAGTCGGAAAAAAAAAC
  5   1   3        nb Neu                            TNeu003a15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGGGGTTCTAATCCCATCCCTTAGCGACCAATTATAACCCAATATTTAGATGTGCCGCCAAGGGCGGAGTCAAGGCGATCACATGTTCATGTTAATTGCAGAATTATTCGCAATGTTACCGATTTCATTTTTTTTTATTTAAGATTTTTTTTTTTATGGTTTTATCTGCATCATGTGACCTTTTTATAAATTGCCTTTATTTCCAATAGTGAAAAAATAATAATAATTATTGAACCTTTTAATAAACGAGAATCTGCAGTCGGAAAAAAAGAGAAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)