Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     12.5899999999999999    0Xt7.1-CAAN6283.5.5                         33 END     22         32       68                Epidermal growth factor receptor pathway substrate 8 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012071726 Xt7.1-CAAN4373.3.5 - 68 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAN4373.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCATGTTGGGGGTGTTTGCTAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGGTTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGGTTTTCCTAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGGTTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGATTTTGCTGGAGGAATGATTGGGCCGCCTCAGGAGGAGTTTGTCGACTGCTTTCAGAAGTTCAAGCACGGGATCAACCTTCTGGCAAAACTAAAGTCCCACATTCAGAACCCCAGCGCCTCCGAACTGGTTCATTTTCTATTCACTCCACTTCACATGATGGTAGAGGCCACGGGGGGCCCTGATCTGGCACGGACAGTACTAAGCCCCCTTATCACAAAGGACTCGCTGGATTTCCTCAACTTCATTCTCAACAAAGAGGAGAAACAATTATGGACATCGTTGGGCGATTCATGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCGTGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTCCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCGCCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGTAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224476                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGGGGGTGTTTGCTAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGGTTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGGTTTTCCTAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGGTTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGATTTTGCTGGAGGAATGATTGGGCxxxxTCAGGAGGAGTTTGTCGACTGCTTTCAGAAGTTCAAGCACGGGATCAACCTTCTGGCAAAACTAAAGTCCCACATTCAGAACCCCAGCGCCTCCGAACTGGTTCATTTTCTATTCACTCCACTTCACATGATGGTAGAGGCCACGGGGGGCCCTGATCTGGCACGGACAGTACTAAGCCCCCTTATCACAAAGGACTCGCTGGATTTCCTCAACTTCATTCTCAACAAAGAGGAGAAACAATTATGGACATCGTTGGGCGATTCATGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCGTGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTCCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCGCCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     3     2     3     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     3     6     3     7     4     7     5     8     5     9     5     9     5     9     6     9     6     9     6     9     6     9     7    11     7    11     7    11     8    11     9    12    10    13    10    13    10    13    10    13    11    14    10    13    10    13    10    13    10    13    11    14    11    14    11    14    11    15    11    15    11    16    11    16    11    16    11    15    12    16    12    16    12    16    12    16    12    16    12    16    12    16    12    16    12    16    12    16     7    16     7    16     7    16     7    16     7    16     7    16     7    15     7    15     7    15     6    14     6    14     5    14     5    13     5    14     5    14     6    14     6    13     6    12     6    12     6    12     6    12     7    13     7    13     7    13     7    13     7    13     7    13     7    13     7    13     7    13     7    13     7    13     7    14     8    16     7    15     7    14     7    14     6    13     6    13     6    12     7    13     6    14     7    15     8    16     8    15     8    15     7    12     8    13    11    15    12    16    12    15    12    15    13    16    13    17    15    18    17    20    21    25    23    27    24    28    24    28    32    37    32    37    33    37    35    39    36    40    35    40    35    40    35    40    35    40    35    40    39    44    40    45    40    45    40    45    42    46    42    46    42    46    42    46    42    46    42    46    41    46    42    46    42    46    40    44    40    44    40    44    39    44    40    44    40    44    40    44    40    44    40    44    40    44    40    44    40    44    40    44    40    43    39    43    38    42    39    42    39    42    39    42    39    42    40    44    41    44    37    42    40    42    40    42    40    43    41    43    41    41    40    41    38    41    41    41    41    41    40    41    40    40    32    34    10    11     3     3
  5   1   2  SIG                                     Xt7.1-CAAL22163.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCATGTTGGGGGTGTTTGCTAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGGTTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGGTTTTCCTAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGGTTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGATTTTGCTGGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGTTTTGCTAGAGGAATGATTGGGCTTGCTGGGTGGCTCATGTTGGGGGGGTTTGCTAGAGGAATGATTGGGCTTGCTGGGTGGCTCATGTTGGGGGATTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGTTTCTGACAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGTGTCTGGAAGATGATTGAGGAATGGTAGGAAGCCTACAGCATACATCTAGTGCTCTATATAGTGCCCCGGGCCCCCCTGTTTATCTGGGCATTGCCATAAACAAGCAGCTAAGAAATGAGCAGGGCACACAGTGTGATGAACTGTTCTGATCTTTCCTATTGGCTCAGTTAAACCTCTTCTTTTATTGAAGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTCCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCGCCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTTTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATT
  5   1   2  SIG                                      Xt7.1-CAAN4373.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTTACCCTGCGGGCGAGACCGCCGCCTCAGGAGGAGTTTGTCGACTGCTTTCAGAAGTTCAAGCACGGGATCAACCTTCTGGCAAAACTAAAGTCCCACATTCAGAACCCCAGCGCCTCCGAACTGGTTCATTTTCTATTCACTCCACTTCACATGATGGTAGAGGCCACGGGGGGCCCTGATCTGGCACGGACAGTACTAAGCCCCCTTATCACAAAGGACTCGCTGGATTTCCTCAACTTCATTCTCAACAAAGAGGAGAAACAATTATGGACATCGTTGGGCGATTCATGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCGTGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTCCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCGCCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGTAAAAAAAAAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGGCGAGACCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGTTGGGTGGCTCATGTTGGGGGTTTTGCTAGAGGAATGATTGGGCTTGCTGGGTGGCTCATGTTGGGGGGGTTTGCTAGAGGAATGATTGGGCTTGCTGGGTGGCTCATGTTGGGGGATTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGTTTCTGACAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGTGTCTGGAAGATGATTGAGGAATGGTAGGAAGCCTACAGCATACATCTAGTGCTCTATATAGTGCCCCGGGCCCCCCTGTTTATCTGGGCATTGCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAAGAAATGAGCAGGGCACACAGTGTGATGAACTGTTCTGATCTTTCCTATTGGCTCAGTTAAACCTCTTCTTTTATTGAAGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGTCTATAGCTTTAAGCGCTAACTTTGGTTGCGGTGGAATTTGTGCATTTAATGCGCGTTTTCATCTAAAGAAGAACAAAAAAAAAACAGCATTGCCAGGGCACGACTCAATGTGTCTTTTGTTTGTGCCAAATCTTTTCCACTTCTTCTGGGTCCCCTGCCCCACTGCATGCAGCACCCTAATTCTGCATGTCTGATTGGCGCCGGCCCATATGGGCCCAGTGGCACCACAACTTGCAATTAGACACAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------G
                                               BLH MIN     228     171                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Sc ---- 4e-007     NP_011652.1 LAs17 Binding protein; Lsb1p [Saccharomyces cerevisiae] ---------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 2e-022     NP_001041048.1 EPS (human endocytosis) related family member (eps-8) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 1e-030     NP_650585.1 CG8907-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 5e-032     XP_785396.2 PREDICTED: similar to Eps8, partial [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dr ---- 2e-123     NP_956536.1 similar to epidermal growth factor receptor pathway substrate 8 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 2e-169     NP_031971.2 epidermal growth factor receptor pathway substrate 8 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 2e-173     NP_004438.3 epidermal growth factor receptor pathway substrate 8 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 1e-174     XP_416405.2 PREDICTED: similar to Epidermal growth factor receptor pathway substrate 8 [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Xl ---- 0          AAH68768.1 MGC81285 protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - ?? ---- 0          NP_001084577.1 hypothetical protein LOC414529 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Xt ---- 0          AAI21949.1 Epidermal growth factor receptor pathway substrate 8 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAN4373.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATG---------------------ATG---------------------ATG---------------------ATG---------------------ATG---------------------ATG---------------------ATG---------------------ATG---------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------TGA------TGA---------TGA------------------------------------------------------------------------TGA---ATG---------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------TAG---------------------TGA---------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                         ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2  SIG                                     Xt7.1-CAAL22163.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCATGTTGGGGGTGTTTGCTAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGGTTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGGTTTTCCTAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGGTTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGATTTTGCTGGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGTTTTGCTAGAGGAATGATTGGGCTTGCTGGGTGGCTCATGTTGGGGGGGTTTGCTAGAGGAATGATTGGGCTTGCTGGGTGGCTCATGTTGGGGGATTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGTTTCTGACAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGTGTCTGGAAGATGATTGAGGAATGGTAGGAAGCCTACAGCATACATCTAGTGCTCTATATAGTGCCCCGGGCCCCCCTGTTTATCTGGGCATTGCCATAAACAAGCAGCTAAGAAATGAGCAGGGCACACAGTGTGATGAACTGTTCTGATCTTTCCTATTGGCTCAGTTAAACCTCTTCTTTTATTGAAGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTCCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCGCCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTTTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATT
                                                  Xt7.1-CHK-1008284382                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGGGGGTGTTTGCTAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGGTTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGGTTTTCCTAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGGTTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGATTTTGCTGGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGTTTTGCTAGAGGAATGATTGGGCTTGCTGGGTGGCTCATGTTGGGGGGGTTTGCTAGAGGAATGATTGGGCTTGCTGGGTGGCTCATGTTGGGGGATTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGTTTCTGACAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGTGTCTGGAAGATGATTGAGGAATGGTAGGAAGCCTACAGCATACATCTAGTGCTCTATATAGTGCCCCGGGCCCCCCTGTTTATCTGGGCATTGCCATAAACAAGCAGCTAAGAAATGAGCAGGGCACACAGTGTGATGAACTGTTCTGATCTTTCCTATTGGCTCAGTTAAACCTCTTCTTTTATTGAAGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTCCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCGCCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTTTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAAT
  5   1   2       ext Int1      in                          CAAP629.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCATGTTGGGGGTGTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGGTTTTCCTAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGTGTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGTGTTTGCTAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGGTTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGGTTTTCCTAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGGTTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGATTTTGCTGGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGTTTTGCTAGAGGAATGATTGGGCTTGCTGGGTGGCTCATGTTGGGGGGGTTTGCTAGAGGAATGATTGGGCTTGCTGGGTGGCTCATGTTGGGGGATTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGTTTCTGACAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGTGTCTGGAAGATGATTGAGGAATGGTAGGAAGCCTACAGCATACATCTAGTGCTCTATATAGTGCCCCGGGCCCCCCTGTTTATCTGGGCATTGCCATAAAACAGCAGCTAAGAAATGAGCAGGGCACACAGTGTGATGAACTGTTCTGATCTTTCC
  5   1   3        nb Int1      in                         CAAP2860.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCATGTTGGGGGTGTTTGCTAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGGTTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGGTTTTCCTAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGGTTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGATTTTGCTGGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGTTTTGCTAGAGGAATGATTGGGCTTGCTGGGTGGCTCATGTTGGGGGGGTTTGCTAGAGGAATGATTGGGCTTGCTGGGTGGCTCATGTTGGGGGATTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGTTTCTGACAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGTGTCTGGAAGATGATTGAGGAATGGTAGGAAGCCTACAGCATACATCTAGTGCTCTATATAGTGCCCCGGGCCCCCCTGTTTATCTGGGCATTGCCATAAACAAGCAGCTAAGAAATGAGCAGGGCACACAGTGTGATGAACTGTTCTGATCTTTCCTATTGGCTCAGTTAAACCTCTTCTTTTATTGAAGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTCCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAA
  5   1   4   14 seed Brn4 5g3  in                        CAAL22163.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGTTGGGGGATTTTGCTGGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGTTTTGCTAGAGGAATGATTGGGCTTGCTGGGTGGCTCATGTTGGGGGGGTTTGCTAGAGGAATGATTGGGCTTGCTGGGTGGCTCATGTTGGGGGATTTTGCTAGAGGAATGATTGGGCTTGTTGGGTGGCTCATGTTGGGGGTTTCTGACAGAGGAATGATTGGGCTTGTTTGGTGGCTCATGTTGGGGGTGTCTGGAAGATGATTGAGGAATGGTAGGAAGCCTACAGCATACATCTAGTGCTCTATATAGTGCCCCGGGCCCCCCTGTTTATCTGGGCATTGCCATAAACAAGCAGCTAAGAAATGAGCAGGGCACACAGTGTGATGAACTGTTCTGATCTTTCCTATTGGCTCAGTTAAACCTCTTCTTTTATTGAAGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTTCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGC
  5   1   2       ext In54 5g                         IMAGE:8841127.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTTGTTAAGTGATTGACCTTCGTCTATTCAGAATTCGTCCCCACAGTGTCATGAACTGTTCTGATCTTTCCTATTGGCTCAGTTAAACCTCTTCTTTTATTGAAGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTCCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCGCCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAAAGAAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCAGCAGAGGATGTTGAAATTCCCTGATTACAGGCCAA
  3  -1   2       ext Int1      in                         CAAP8963.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATGAGCAGGGCACACAGTGTGATGAACTGTTCTGATCTTTCCTATTGGCTCAGTTAAACCTCTTCTTTTATTGAAGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTCCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCGCCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAG
  5  -1   2       ext Int1      in                         CAAP8963.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAGCTGACCGCAGGAATTCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTTTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTG
  3   1   2       ext Int1      in                          CAAP629.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAGAAGTTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTTTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTAAAGCAAATCTGAAAAAAAG
  3   1   4      seed Brn4 5g3  in                        CAAL22163.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   3        nb Int1      in                         CAAP2860.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAGTTTCAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGATTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTTTACCCAAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTTTAGACTTTATTTTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTAATATTTAAGGAGGGGCTCCTGACATGCCCCCCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGTTACTGGGGGGGCAAAAGGCTCCTGGAGAGGGGGGGGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGC
  5   1   2  SIG                                      Xt7.1-CAAN4373.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTTACCCTGCGGGCGAGACCGCCGCCTCAGGAGGAGTTTGTCGACTGCTTTCAGAAGTTCAAGCACGGGATCAACCTTCTGGCAAAACTAAAGTCCCACATTCAGAACCCCAGCGCCTCCGAACTGGTTCATTTTCTATTCACTCCACTTCACATGATGGTAGAGGCCACGGGGGGCCCTGATCTGGCACGGACAGTACTAAGCCCCCTTATCACAAAGGACTCGCTGGATTTCCTCAACTTCATTCTCAACAAAGAGGAGAAACAATTATGGACATCGTTGGGCGATTCATGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCGTGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTCCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCGCCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGTAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008284384                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGCGGGCGAGACCGCCGCCTCAGGAGGAGTTTGTCGACTGCTTTCAGAAGTTCAAGCACGGGATCAACCTTCTGGCAAAACTAAAGTCCCACATTCAGAACCCCAGCGCCTCCGAACTGGTTCATTTTCTATTCACTCCACTTCACATGATGGTAGAGGCCACGGGGGGCCCTGATCTGGCACGGACAGTACTAAGCCCCCTTATCACAAAGGACTCGCTGGATTTCCTCAACTTCATTCTCAACAAAGAGGAGAAACAATTATGGACATCGTTGGGCGATTCATGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCGTGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTCCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCGCCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGTAAAAAAAAAAAAAAAAAA
  5   1   2       ext Tad5      in                         XZT57909.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAACTAGAGAATTTCCCATTAAGTAGCGTCCAGCATTGCCAAGCAGTCATGAACGCCTGTCGCTACGACTCCATCCTTGCCCTTGTGTGCAAAGAGCCGGCGCAAAGCAAAGCTGATCTCCACCTCTTCCAGTGTGATGAGATCAAGGCTTCCCTGGTGCAACGAGACATTGACAGCGCCATCAGCGACAGCAAAGGAGGGAAGCAGAAAAAGCGCCCAGAGGCCCTCAGGGCAATTACTCGGAATGATGACAAAATCCCCCCACACCCCGGGGCACCGGCCCCCACGCCTCCTGGATCTGTTACACAAGTGGATGTGCGCAGTCGTGTGGCGGCCTGGTCCTCATGGGCATCTGAGTACGGCGACTACGACCCATCCCGGCAGAATCTGGACCAGGACTCGACACCAGAGATGTTGGAAGCCCGAATAGACAGAGATGTCCAAATCCTAAATCACATTTTAGACGACGTGGAGTTCTTCATCATGAAGCTGCAGAAGGCGGCGGAAGCATTTTCCGAGCTCTCCAAGCGGAAGAAAGGGAAGAAGAAGAAGGGGCCGGGGGGTGAGGGTCTCTCTCCTTATACAAATCTCTGTTTCGCATTCGCTCCCTCCATCTATTGATTCCTTCTCCCTTTCTGCTCAGAGGGGGTCCTTACCCTGCGGGCGAGACCGCCGCCTCAGGAGGAGTTTGTCGACTGCTTTCAGAAGTTCAAGCACGGGATCAACCTTCTGGCAAAACTAAAGTCCCACATTCAGAACCCCAGCGCCTCCGAACTGGTTCATTTTCTATTCACTCCACTTCACATGATGGTAGAGGCCACGGGGGGCCCTGATCTGGCACGGACAGTACTAAGCCCCCTTATCACAAAGGACTCGCTGGATTTCCTCAACTTCATTCTCCACAAAGA
  5   1   2       add In60                            IMAGE:8951967.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAACTTTATTATGAAAGATTAAAATAAAAAAAATTCGTCCCGACGAGATGTCCAAATCCTAAATCACATTTTAGACGACGTGGAGTTCTTCATCATGAAGCTGCAGAAGGCGGCGGAAGCATTTTCCGAGCTCTCCAAGCGGAAGAAAGGGAAGAAGAAGAAGGGGCCGGGGGAGGGGGTCCTTACCCTGCGGGCGAGACCGCCGCCTCAGGAGGAGTTTGTCGACTGCTTTCAGAAGTTCAAGCACGGGATCAACCTTCTGGCAAAACTAAAGTCCCACATTCAGAACCCCAGCGCCTCCGAACTGGTTCATTTTCTATTCACTCCACTTCACATGATGGTAGAGGCCACGGGGGGCCCTGATCTGGCACGGACAGTACTAAGCCCCCTTATCACAAAGGACTCGCTGGATTTCCTCAACTTCATTCTCAACAAAGAGGAGAAACAATTATGGACATCGTTGGGCGATTCATGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCATGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATGTCTATAGCTTTAAGCGCTAACTTTGGTTGCGGTGGAATTTGTGCATTTATGCGCGTTTTCATCTAAAGAGACAAAAAAAAAACAGCATTGCAGGGCACGACTCATGTGTCTTTTGTTGTGCAAATCTTTTCACTTCTTCTGGGTCCCTGCCCCACTGCATGCAGCACCCTAATTCTGCATGTTCTGATTTGAGC
  3   1   2       add Fat1                                 CABC7708.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACACGACTTTGCACATCCAGTTGTGTAACAGATTCAGGAGGCGTTTGTCGACTGCTTTCAGAAGTTCAAGCACGGGATCAACCTTCTGGCAAAACTAAAGTCCCACATTCAGAACCCCAGCGCCTCCGAACTGGTTCATTTTCTATTCACTCCACTTCACATGATGGTAGAGGCCACGGGGGGCCCTGATCTGGCACGGACAGTACTAAGCCCCCTTATCACAAAGGACTCGCTGGATTTCCTCAACTTCATTCTCAACAAAGAGGAGAAACAATTATGGACATCGTTGGGCGATTCATGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCGTGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCCAGTGGTGGAAAGTCCGGAG
  5   1   2       ext Te1       in                        CBWN10678.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTTACCCTGCGGGCGAGACCGCCGCCTCAGGAGGAGTTTGTCGACTGCTTTCAGAAGTTCAAGCACGGGATCAACCTTCTGGCAAAACTAAAGTCCCACATTCAGAACCCCAGCGCCTCCGAACTGGTTCATTTTCTATTCACTCCACTTCACATGATGGTAGAGGCCACGGGGGGCCCTGATCTGGCACGGACAGTACTAAGCCCCCTTATCACAAAGGACTCGCTGGATTTCCTCAACTTCATTCTCAACAAAGAGGAGAAACAATTATGGACATCGTTGGGCGACTCATGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCGTGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAG
  5   1   2       add In63                            IMAGE:8959006.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCTCAGGAGGAGTTTGTCGACTGCTTTCAGAAGTTCAAGCACGGGATCAACCTTCTGGCAAAACTAAAGTCCCACATTCAGAACCCCAGCGCCTCCGAACTGGTTCATTTTCTATTCACTCCACTTCACATGATGGTAGAGGCCACGGGGGGCCCTGATCTGGCACGGACAGTACTAAGCCCCCTTATCACAAAGGACTCGCTGGATTTCCTCAACTTCATTCTCAACAAAGAGGAGAAACAATTATGGACATCGTTGGGCGATTCATGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCGTGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATGTCTATAGCTTTAAGCGCTAACTTTGGTTGCGGTGGAATTTGTGCATTTAATGCGCGTTTTCATCTAAAGAAGAACAAAAAAAAAACAGCATTGCCAGGGCACGACTCAATGTGTCTTTTGTTTGTGCCAAATCTTTTCCACTTCTTCTGGGTCCCCTGCCCCACTGCATGCAGCACCCTAATTCTGCATGTCTGATTGGCGCCGGCTCATATGGGCCCAGTGCACCACACTTGCAATTAGACACAAATCCATACCCTATGAGATTCCAGCCCTTCCCTCTTCTTATAAGCTCGTGCTTTCTAGCTGCCCACACTGACATGAATAGCTCATAAATGCAGTCTGTGGCACGTGCCAGCTGCACCTCAGACAGCACACAATGCTATGGTGGGGCATTTATACTGCAATACAAACCTGGCTGTCTGGTTCA
  5   1   2       add In66                            IMAGE:8964360.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTAATTTTAAAGGTGATATTAAAAAATAAAAAAATCCCCTTCTGGCAAACTAAAGTCCCACATTCAGAACCCCAGCGCCTCCGAACTGGTTCATTTTCTATTCACTCCACTTCACATGATGGTAGAGGCCACGGGGGGCCCTGATCTGGCACGGACAGTACTAAGCCCCCTTATCACAAAGGACTCGCTGGATTTCCTCAACTTCATTCTCAACAAAGAGGAGAAACAATTATGGACATCGTTGGGCGATTCATGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCGTGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATGTCTATAGCTTTAAGCGCTAACTTTGGTTGCGGTGGAATTTGTGCATTTAATGCGCGTTTTCATCTAAAGAAGAACAAAAAAAAAACAGCATTGCCAGGGCACGACTCAATGTGTCTTTTGTTTGTGCCAAATCTTTTCCACTTCTTCTGGGTCCCCTGCCCCACTGCATGCAGCACCCTAATTCTGCATGTCTGATTGGCGCCGGCCCATATGGGCCCAGTGGCACCACAACTTGCAATTAGACACAAATCCATAACCCTATGAGATTCCAGCCCTTCCCTCCTTCTTATAAAGCTCCGGTGCCTTTCTAGCTGCCCACACTGACATGAATTAGCTCATAAATGCCAGTCTGTGGGCACCGTGCAGCTGCCACTTCACAGAGCAGCACACAAAGTGCATAATGGTGGGGGGGCATTATACCTGCAGTACGAGCTGCCTGCTGTACAGATGTGTGCCCTCTTATTAA
  5   1   2       add In66                            IMAGE:8965422.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGGTTCATTTTCTATTCACTCCACTTCACATGATGGTAGAGGCCACGGGGGGCCCTGATCTGGCACGGACAGTACTAAGCCCCCTTATCACAAAGGACTCGCTGGATTTCCTCAACTTCATTCTCAACAAAGAGGAGAAACAATTATGGACATCGTTGGGCGATTCATGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCGTGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATGTCTATAGCTTTAAGCGCTAACTTTGGTTGCGGTGGAATTTGTGCATTTAATGCGCGTTTTCATCTAAAGAAGAACAAAAAAAAAACAGCATTGCCAGGGCACGACTCAATGTGTCTTTTGTTTGTGCCAAATCTTTTCCACTTCTTCTGGGTCCCCTGCCCCACTGCATGCAGCACCCTAATTCTGCATGTCTGATTGGCGCCGGCCCATATGGGCCCAGTGGCACCACAACTTGCAATTAGACACAAATCCATAACCCTATGAGATTCCAGCCCTTCCCTCCTTCTTATAAAGCTCCGGTGCCTTTCTAGCTGCCCACACTGACATGAATTAGCTCATAAAATGCAGTCTGTGGGCACGTGCCAGCTGCCACCTCACAGAGCAGCACACAAGTGCATATGGTGGGGGGGCATTTATACCTGCAGTACGAGCTGCTGCTGTACAAATGTGCCTATATCTGCCAGTGATGCCTATACTCAGCTTATGGGCGATTATCAGACGTCAGGCCTGTCATGCTTATTCTGAATGGATCAT
  5   1   2       add In66                            IMAGE:8965838.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCAACTCATTAAAACCCTAATTCTATTCTTAAAATCGTCCCGGGGGGCCCTGATCTGGCACGGACAGTACTAAGCCCCCTTATCACAAAGGACTCGCTGGATTTCCTCAACTTCATTCTCAACAAAGAGGAGAAACAATTATGGACATCGTTGGGCGATTCATGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCGTGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATGTCTATAGCTTTAAGCGCTAACTTTGGTTGCGGTGGAATTTGTGCATTTAATGCGCGTTTTCATCTAAAGAAGAACAAAAAAAAAACAGCATTGCCAGGGCACGACTCAATGTGTCTTTTGTTTGTGCCAAATCTTTTCCACTTCTTCTGGGTCCCCTGCCCCACTGCATGCAGCACCCTAATTCTGCATGTCTGATTGGCGCCGGCCCATATGGGCCCAGTGGCACCACAACTTGCAATTAGACACAAAATCCATAACCCTATGAGATTCCAGCCCTTCCCTCCTTCTTATAAAGCTCCGGTGCCTTTCTAGCTGCCCACACTGACATGAATTAGCTCATAAAATGCCAGTCTGTGGGCACCGTGCCAGCTGCCACCTCACAGAGCAGCACACAAAGTGCCATATGGTGGGGGGGCATTTATAACTGCAGTACGAAGCTGCTGCTGTACAATGTGCCCCTATATTGCACGTGACTTGGCTATTACTCAACTCATGGCGATTATTATTCACGATCGTTCGAAGCGCTCGGTAATGCGTTTTTTCTACTTAG
  5   1   3        nb Gas7      in                         XZG15692.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACGGGGGGCCCTGATCTGGCACGGACAGTACTAAGCCCCCTTATCACAAAGGACTCGCTGGATTTCCTCAACTTCATTCTCAACAAAGAGGAGAAACAATTATGGACATCGTTGGGCGATTCATGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCATGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTCCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATTCCAGCCGCCCCCTCTCCACCGCCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGC
  5   1   4      seed Te4       in                         CAAN4279.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGCACGGACAGTACTAAGCCCCCTTATCACAAAGGACTCGCTGGATTTCCTCAACTTCATTCTCAACAAAGAGGAGAAACAATTATGGACATCGTTGGGCGATTCATGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCGTGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTCCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCGCCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCC
  5   1   3        nb Ski1      in                         CABJ7247.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCAACTTCATTCTCAACAAAGAGGAGAAACAATTATGGACATCGTTGGGCGATTCATGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCGTGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTCCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCGCCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGNGCGCAGTGCGGCGC
  5   1   2       ext Egg       in                   TEgg038d15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGAATAAATACAGGGCAGAATGGCCCAAAGAGCAGTTTATCCCCCCGTATGTCCCGCGCTTCAGGAACGGCTGGGAGCCCCCACTCCTGGGCTGTGCGGCGGCGCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCATGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTCCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCGCCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGAC
  3   1   2       add Te5       out                        CAAO5387.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCGAAGGAACAGGAACTCTCTTACTTGGCTGAGTCTGTGGCCAATGTTGCGGAGCTGCAGCGCAAACAGGAATTCAACAGCGTGCCAAATATGTATTCCCATGTGTCCCGGTACCCGCCGTCGGAGGGGAATTTTGAGGAGCGCGACCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTTCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCACCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGTAAGCCTCCTTGTCTGTACATGGATCTGTCCTGCACTGGCCTTTATGGCTACCTGCCGCCATTTGTATTTCAGCATTAAAACCTCCTTCTCTGC
  5   1   0       chi Brn4      in                        CAAL19315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAAGTGGAGGCCCAGAGATACGCCTTGTGCAAGTACGACTTTGTGGCCCGGAACTCAAACGAACTCTCTGTCCTTAAAGATGATGTCTTGGAGGTCCTCGATGATAAGAAGCAGTGGTGGAAAGTTCGGAGCTCGAGTGGGGCAGTCGGTTTTGTGCCAAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGCGATTACTGGGAGAACTGTCTCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCACCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAG
  3  -1   3        nb Int1      in                         CAAP1817.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGGGCAGTCGGTTTTGTGCCAACAATATTTTGGTAGCAATGAAGCCACAAGATCAGTCAGCAAAGCCAATGGAAGCCGCGTACACGCACACAATCCAGAAACAGAAGTCCGACCTTATACAAAGCCAAGCGGGTCCAATCCCAGCCGCCCCCTCTCCACCGCCAAACCCAGCGCCAACGTATTCCCCACTCGCTAATTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGC
  5   1   2       ext Int1      in                         CAAP7383.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCCAGCAACCAACGCTGCCCGTGGCCAAGCTCTTCACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTTTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACT
  5   1   3        nb Brn4      in                        CAAL22370.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACTGCCGGACCAATCAGTCGACAGAGCAGTTTGTCCAGTGACAGCGGGGGAGGAAGTGTCCGAGAGCAACATGGCCTCCAGCAGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACANAGAGGTGGATTTGGCTACTGTGGGGGGCAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACCATTAGCCACTCCCCCCTGGCAGAGCGAC
  3   1   0       chi Te4       out                       CAAN11548.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATGGCTCCAGCAGGGTTCCAGCTGACCGCAGGAAATCCCAGATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   2       ext Egg       in                    TEgg038d15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGGAGGAGGTGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGGCGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTTTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTTTGCTCCGTGGAACAGTGGTTTTTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Ski1      in                         CABJ7247.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCAGGATGAGCTGATCCACAGACTGACCATTGGGCGCAGTGCGCNGCAGAAGAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTTTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   3        nb Te4  5g3  out                        CAAN4373.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGAGAAAGTTCACCGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   4      seed Te4       in                         CAAN4279.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   3        nb Ovi1      ?                          CABI2633.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTTTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTG
  5  -1   3        nb Int1      in                         CAAP1817.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGCCGCGGCTGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTTTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATT
  3   1   2       ext Int1      in                         CAAP7383.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAACGCGCCGGCTGTCCATATTTCGTACAGTTCGCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTTTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   3        nb Te4  5g3  out                        CAAN2171.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCGGCAGAGGATGTGAAATCCTGGTTACAGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGC
  3   1   2       ext Gas7      in                         XZG42055.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGGGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCGGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGTAAAAAAAAAAAAAAAAGG
  5   1   2       ext Gas7      in                         XZG42055.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCCAAAGGCTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCGGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCANATCTGTAAAAAAAAAAAAAAAGG
  3   1   3        nb Te4       out                       CAAN11519.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGTAAAAACCAAAAAAAA
  3   1   3        nb Te4       out                       CAAN11706.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAATTCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   3        nb Te4  5g3  out                        CAAN2252.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCGTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   3        nb Brn4      out                       CAAL22999.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGTTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGC
  3   1   2       add Brn4      in                        CAAL19315.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGTAAATAAT
  3   1   3        nb Te4  5g3  out                        CAAN8629.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAACCGTCGACAGCCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   3        nb Ski1      in                          CABJ481.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTTTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGC
  5   1   3        nb Ski1      in                          CABJ481.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTCGGGGTGCTCACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTTTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAAAAAAAAAAAAAAAAA
  3   1   3        nb Te4  5g3  out                        CAAN1760.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACAGGGGCCCAGCTTTTCTCTCTCACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGT
  3   1   3        nb Brn3      out                        CAAK8114.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGGATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   3        nb Brn4      in                        CAAL22370.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGC
  3   1   3        nb Te4  5g3  out                        CAAN1204.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   3        nb Te4  5g3  out                        CAAN2063.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   3        nb Te4  5g3  out                        CAAN8113.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   3        nb Te4       out                       CAAN11172.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGGGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   3        nb Te4  FL   out                        CAAN6283.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGC
  3   1   2       ext Tad5      in                         XZT57909.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGGATGAACTGAAGACTGTGTGTCCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGGGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTTTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTTTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGTTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGGGATTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTTTGCTCTGTGGAACAGGGGTTTTTACCAGGACCAACCTCTTTTTCCTTCTTTCGGTAAATAAAATTTAAAGCAAATCGGT
  3   1   3        nb Te5       out                        CAAO6501.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAGGATGAACTGAAGACTGTGTGTCGGAAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCGGT
  3   1   3        nb Te3  5g3  out                       CAAM14147.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGGCCCGAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGTAAAT
  3   1   3        nb Te4  5g3  out                       CAAN10335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGGGTGTACAACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGGGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   2       ext Te1       in                        CBWN10678.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACCAAGTTACAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCGGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGTAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG15692.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTCCAGTGCAGAAGGCCGCCATAGAGGAACAAAGTGGGGGCTCAGAGCTGCTAGAGATCATGAAGAAACGGCAGGAAAGGATAAACATGGCGGCCAGCGACTCCGGGGTGGAGATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGTGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTG
  3   1   3        nb Gas7      in                         XZG57209.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACGCGTCCGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTTTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGTAAAAAAAAAAAAAAAGG
  3   1   3        nb Te4  5g3  out                        CAAN5094.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGAAACGGCAGGAAAGGATAAACATGGCAGCCAGGGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCCCTGACTCCGGGGATTGGGGGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTTTTCCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAAACTTTTTTAGACTCTATTTTGCTTTATACTCTTTGTAGGATTTGCCAGATGTTTTTTAACCCCTTGTGGAACAGATGCCAATTGATTTTTAAGGGGGGGCTCCTGACATGCCCCCCGGTTTGTACAGACGCAACAAAGAGGGGGATTTGGCTACTGGGGGGGCAAAAGGCTACTGGAGAGGGGGGGGTTAGCACTCATGTTTCAGCACAATTAGCCCCTCCCCCCTGGCAGAGGGATTGCGCCCCCTTTGGTGAGAGGGCGCCCCGTTGTGTGGGTAAATAGGAACATTTTCAGTTTTTTCCATGAGTTTTGCTCTGGGGAACAGGGGTTTTTACCAGGACCAACCTCTTTTTCCTTCTTTCGGTAAATAAAATTTAAAGCAAATCTGT
  3   1   2       ext Te4       in                         CAAN7362.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  5   1   2       ext Te4       in                         CAAN7362.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACGGCAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGTAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas7      in                         XZG57209.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGAAAGGATAAACATGGCAGCCAGCGACTCCGGGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTTTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCCGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGTAAAAAAAAAAAAAAAGG
  3   1   3        nb Brn3      out                        CAAK8993.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGTGGAATCCTTCGATGAAGGGAACAGCCACTGACTCCGGTGATTGGGTGGTTGAAGCCCCAATGGAGGGGGGATCGTGGGGCAAGGATTCTACCCGAATGTGCCCGGGGGTCCGACGGGCCCAGTGTGAGTGATGCCGCTGTTTGATAAGACTTTTCTAGACTCTATTCTGCTTTATACTCTTTGTATGATTTGCCAGATGTTATTTAACCCCTTGTGGAACAGATGCCAATTGATATTTAAGGAGGGGCTCCTGACATGCCCACCGGATTGTACAGACGCAACAAAGAGGTGGATTTGGCTACTGTGGGGGCAAAAGGCTACTGGAGAGGGGGGTGCTAGCACTCATGTTACAGCACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  3   1   3        nb Brn3      in                         CAAK3557.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGT
  5   1   3        nb Brn3      in                         CAAK3557.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACAATTAGCCACTCCCCCCTGGCAGAGCGACTGCGCCCCCTATGGTGAGATGGCGCCACGTTGTGTGTGTAAATAGGAACATTATCAGTATTTTCCATGAGTTCTGCTCTGTGGAACAGTGGTTTCTACCAGGACCAACCTCTTTCTCCTTCTTTCTGTAAATAAAATTTAAAGCAAATCTGTAAAAAAAAAAAAAAAAA
  3   1   2       ext Te1  5g3  out                        CBWN1819.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGCCCCGTTGTGGGGGTAAATAGGAACATTATCAGTATTTTCCAGGAGTTTTGCTCCGGGGAACAGGGGTTTTTACCAGGACCAACCTCTTTTTCCTTTTTTTGGTAAATAAAATTTAAAGCAAATCGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)