Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 288.0    0Xt7.1-CAAL9802.5                            2 PI      100       718      868                Unknown (protein for MGC:107818) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012071745 Xt7.1-CABI7018.3.5 - 103 ESTs
                                                                       ..-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABI7018.3.5                                                     GGATTGTCACGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAATA
                                                  Xt7.1-CHK-1008223156                                                           TCACGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAATAAAAAAA
                                                      consensus depths                                                          6    10     9    12    12    15    13    16    18    21    20    23    23    26    23    27    25    29    26    29    25    29    26    29    26    29    26    29    26    29    26    29    26    30    26    30    27    31    27    31    27    31    27    31    27    31    27    31    26    32    23    32    23    32    23    32    24    33    26    35    27    36    26    36    27    36    27    36    28    37    28    37    28    37    28    37    28    37    28    37    29    38    29    38    29    39    30    39    30    38    30    39    30    40    31    40    31    40    31    41    32    42    32    42    32    43    32    42    33    43    33    43    32    42    32    42    32    42    32    42    32    41    30    40    28    40    27    38    31    39    27    38    27    37    27    37    27    37    29    39    24    36    25    36    24    33    20    27    20    26    21    27    22    28    22    28    22    28    22    26    23    26    22    27    22    26    22    26    22    26    22    26    22    26    23    27    23    27    23    27    23    27    23    27    22    26    22    27    21    27    22    28    23    29    23    31    24    33    26    34    29    38    30    39    29    37    29    37    31    39    34    42    35    43    35    42    35    42    36    43    37    44    39    47    38    46    38    46    39    47    39    48    36    45    35    46    34    45    34    44    35    45    34    46    35    46    34    46    33    45    33    45    35    48    35    48    34    48    35    48    35    48    34    51    37    52    38    52    38    52    38    52    40    52    40    52    40    52    39    52    40    52    39    50    37    49    38    49    38    49    38    49    38    49    36    48    36    48    36    47    35    47    35    46    35    46    34    45    34    45    34    45    34    45    34    45    34    45    32    44    32    43    32    43    31    43    28    42    28    38    27    36     3    10
  5   1   2  SIG                                      Xt7.1-CABI7018.3                                              CATTGCCGGATTGTCACGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTC
  5   1   2                                           Xt7.1-CAAQ6029.3                                                              CGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAAGGGTCCTGGCCCAGAATAATGAGAAACTTTGTGAACTTATGAGGTTGCATTTGTCGTTCCCTGAGCAAAAAAAAGTTCTCCTCAAGGCTGCAAAAGATGGGCTGGAACTTAAAAAAACCCCCTTGGGGGAAACTGGAAGGCTTTCCTTTGCCAAAAATGATTCAAGG------------CGTCCGCTTGTAAATACAGAATAATACATTCAAATGTATTGGATGATGTCTCTGGTTGCCTGGAAGTGATTCTTCAGTGGCTGTTCAGCCACTGAACCGATTAGCTGGAGAGCGCACCAACGTGATGCCCATTAGTTTTATGTCGACAGCCATATTTTAAAACAATTTGCATTTAGTCTTATTTTTTTCAAGTTGAGAAAAACCTTTTTAATGGGAAAAAATGTAAAAAAATAAAAAAGGGGGGGAAATGTGAAGGCATGGTATTCCTGTAAAGAAGGTTCATTTGTGTTTTCCCCCTGTTGTATTCAGCTTCTCGACCACTCCAAATCCAAGGCAGTCATTCCGTATACCTCTTGTAACATGCAGCTTCTGTTCTCTGCCCCAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGGCACCTTGCCGCGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAATATGAAAA
  5   1   2  SIG                                      Xt7.1-CAAL7457.3                                                               GCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGTTTGCACAAGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAA
  5   1   2  SIG                                      Xt7.1-XZG35296.5                                                                                                                    CTTCTCTATCTCTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCTTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCTTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACACACAGCAGATGATATCAAACTCTTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCATACAAACCTCATTCCGTATAATACCAAGGAAACAAGAGTTTCTGCAGAACTCTGCACTAAAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACGCAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAATAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                 TGCACAAGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGTACCTGCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGCAGTGTCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACGTCCAGCAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTC
                                                                   SNP                                                                                                                 --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                     ----------TT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------T----A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----G------
                                               BLH ATG     193    1456                                                     
                                               BLH MIN     193     179                                                     
                                               BLH MPR     193     179                                                     
                                               BLH OVR     193     818                                                     
                                               CDS MIN     193     179                                                     
                                               EST CLI     -16       6                                                     
                                               ORF LNG     193      82                                                     
                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 2e-022     NP_498286.1 dynamitin like, DyNactin Complex component DNC-2 (37.2 kD) (dnc-2)[Caenorhabditis elegans] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PROTEIN === Dm ==== 4e-049     NP_524690.1 Dynamitin CG8269-PA [Drosophila melanogaster] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sp ==== 2e-093     XP_001200895.1 PREDICTED: similar to MGC107818 protein [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PROTEIN === Gg ==== 8e-150     NP_990133.1 dynamitin [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PROTEIN === Dr ==== 7e-156     NP_957460.1 similar to dynactin 2 (p50) [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 6e-180     NP_006391.1 dynactin 2; dynactin complex 50 kD subunit; dynamitin; 50 kD dynein-associatedpolypeptide [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PROTEIN === Mm ==== 3e-180     NP_081427.1 dynactin 2 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 0          AAH81081.1 MGC82128 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 0          AAH89637.1 Unknown (protein for MGC:107818) [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PROTEIN === ?? ==== 0          Q5FW42 Dynactin subunit 2 [(unknown)]  ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABI7018.3.5                                                                                                                                                                                                            TGA---------------------------------TAA---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------ATG------------------------------------------ATG---------------------------------------ATG------------ATG---------------------------------------------------------------------TGA---------------------------------TAA---------------------------------------------------------------------------------------ATG------------------------------------------TAG---------------------ATG---------------------TAA---------------------TGA------------------------------------------------------ATG---------------------TGA------------TAG---------------ATG------------------------------------------------------------------------------------------------------------ATG---TGA---------------TAA---------------------TAGTAA------------------TAA------TAG------TAG
                                                                   ORF                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2  SIG                                      Xt7.1-CABI7018.3                                              CATTGCCGGATTGTCACGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTC
                                                  Xt7.1-CHK-1008278912                                                    CGGATTGTCACGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAT
  5   1   1           AbdN FL                     IMAGE:7021499.FL-MGC                                                          GTCACGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FLt3                   TEgg139n15.FL-Sanger                                                                                 TATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAAAAAAAAAAAAAA
  5   1   2       ext Te5       in                         CAAO4151.5p CAAAGTGACGTCAGGTGAAGCGCTCCAATCTCGCGAGGTTTCCATCATTGCCGGATTGTCACGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCCAAACTAGAAAAAATCCTGA
  5   1   2       add HeRe 5g3  in                     EC2CAA33BH01.g1                             CTCGCGAGGTTTCCATCATTGCCCCCATTGTCACGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCTATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAAACTGACCCCGGTTGCATT
  5   1   2       add HeRe                             EC2CAA41BD09.g1                                     GATTGCCGGATTGTCACGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCTATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGTTTGCACAAGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGA
  5   1   2       add Brn3      in                         CAAK8126.5p                                      GTTTCCATCATTGCCGGATTGTCACGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGTTTGCACAAGTAAGACAACTCCTGCTTTGTTTTTTTGCATGAGACTTCCAGATTTAGTATTTGCATGCACTCATGTTCCTAAATTTCCAGATGATTGTCTAGATCTTTTGGTTTTTCCTTCTTTTTGATAAATTAGAAATTACGTTTTCATTCTAATATCAAATGCAGTGATAGTGTACTAACAGTACTATTGATTTACGGCTGATTAGAGAAATCTGTTGCAGTTTGATGAGCCAAAATCTTTGCATGTCTGATCATCGTGAGAAAAACATTTATACTGTACCCTTTTTATACTATTGTATCTCTTGTAATCCAGATCATTCCTATGCATTTATCTCTGTAAGTGTAACACATGTAAACAATGTAAATGTCTTGAAAAATCAGCAAACTATACACACCATAGTCATAATATATGCACCATTAGGTAGCAGTCCCCTTCTACCTTTTACTTAAAGGTATATAGCGGCGGTTGCCCATGCACAGATTTGTTTTAGCCAGTG
  5   1   2       ext Te5       in                         CAAO7890.5p                                              CATTGCCGGATTGTCACGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCT
  5   1   3        nb TpA  5g                        TTpA058f11.p1kSP6                                                  ACCGGGGGTCACGCTCGAGTCCGGCGCTGGTTTATGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCTATCTACTTCTACGCGTCTGAGCTGATAGCAAACCGATTGAGCGTGTGGCTGTCTGGCTCTTTCGGTCCTGCCCGTTGCCGCCTTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCTCGTATAACACATGGCCGACCCCAAATACGCCGACCTGTCAGGCATAGCCAGGAATGAGCCACATGTCTATAAAACACCTGATTTGCCTGAAGACAATCAAGCTGAATTTGATGCGGAGGAGCTTACTAGCTCTAACGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACCAATTTAAGGACAATAAAGTTGGCACCTCAGGTTTACATTTTTCATATCGGATTACCACTTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATACGAATAATCGAAACACCTCGCCATAATTACCACCTGCTGCTGCATGATATCCAGGAACTGACGCAAGAACTACAAAAGGCGCAGACCGTCCTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAACCAAACTAGTAGACTGCTTTAAAACAACAGTTAGTGTCCACTCATTTAGAGAAACTACTGGATCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCATAGCGTTTGCTGACT
  5   1   2       add AbdN FL                            IMAGE:7021499                                                    GTCACGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAAACTAGAAAAAATCCTGAAGGAAAAAAGCCCTGCAAAGGGGTCCTGGGCCCAAATTAATTGAGAACTTTTTGTGACTTTATGAAGTTTGGCATTGGTCGGTCCCTTGAGCAAAAACAAAGTTTCCTCTTCAGGGCA
  5   1   3   20   nb Ski1 5g                              CABJ4921.5p ...................................................CGGATTGTCACGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAANACTAGAAAAAATCCTGAAGGANAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGNCAAGAT
  5   1   2       ext Te5       in                         CAAO3665.5p                                                              CGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAA
  5   1   4   10 seed Ovi1 5g3  in                        CABI10998.5p .................................................................CCATCGATTCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCT
  5   1   2       add Gas1 5g                            IMAGE:6988992                                                                    GTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAANACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAAAGCNGCTGGNGGGAGCTGGGAGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTTGTTTGATGGGACACAGTTGA
  5   1   3   10   nb Ovi1 5g3  in                         CABI5808.5p .......................................................................CGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAA
  5   1   3        nb Egg  FLt3                      TEgg139n15.p1kSP6                                                                                GTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAG
  5   1   3   10   nb Te1  5g3  in                         CBWN7761.b1 ...........................................................................................GCGCTCACTGGCTGCCGTTTGTGCTTCTCTATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTG
  5   1   2       ext Lun1      in                         CABD7712.5p                                                                                                   CTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCCTGAGCAAACAAGTTCTCTCANGCTGNCAAGATGGCTGAGCTAG
  5   1   3   14   nb Te5  5g3  in                         CAAO6742.5p ....................................................................................................GGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAAATCTGAAGGAAAAAGCCCTGCAAAGGGTCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAA
  5   1   3        nb Te5       in                         CAAO8305.5p                                                                                                     GGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAAACAGTTCTCTCAGGCTGNCAAGATGGCTGAGCT
  5   1   3   10   nb Ovi1 5g3  in                          CABI523.5p .............................................................................................................TTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGTCAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGA
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ8824.5p ....................................................................................................................TCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTNTAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCT
  5   1   2       add HdA       in                   THdA047n09.p1kSP6                                                                                                                                   GACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCAGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGTTTGCACAAGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTTGGATGTGGCCAANACTAGAAAAAATCCTGAANGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAAGCTG
  5   1   3        nb Te5       in                         CAAO3995.5p                                                                                                                                               CCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAACAGTTAGTGTCCACTCATTTAGAGAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGAC
  5   1   2       add In63                            IMAGE:8958276.5p                                                                                                                                                                                                                                                    ACTTTTTTTAAGATCCTAAACACTTACTTATTTCGTTTAGATGTCTATGAAAAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGTTTGCACAAGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAACAGTTAGTGTCCACTCATTTAGAGAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCTCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGCTAAAGTCATTTGTGGATGTAGCATCTTCTGGACCAGTGGAGTCAGACTACGAGTGTCTAGGAAATGATGAATCGGCTAGCACAAGCTGCCATTGAGGATGCCGACCTGGAAGCCAGTGCATCAGCTCTATGGAACGGCAAAATGAATTCCATGTCCTAGAAA
  5   1   3        nb Ski1      in                         CABJ3418.5p                                                                                                                                                                                                                                                                                                                                              GAAACTGCAAGGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGANATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGAC
  5   1   3        nb Sto1      in                        CABG11460.5p                                                                                                                                                                                                                                                                                                                                                                                           ACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGANATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCC
  5   1   3        nb AbdN                               IMAGE:7025042                                                                                                                                                                                                                                                                                                                                                                                                          CCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAAGTGCACCATGCTCTATGAGACCGTGCCAGAAGTGGGATTTCCATGTCTTAGCACCTTGCCCGCAAGTTGTCCCAGAAGCTGCTCATGTTTAAAGCAGCTGGCACGA
  5   1   2       add In66                            IMAGE:8964234.5p                                                                                                                                                                                                                                                                                                                                                                                                             CGCCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAACAGTTAGTGTCCACTCATTTAGAGAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGAAAATGAATGAAATCGCTAAGCACAAAGCTGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATCCATGTCTAGCACTTGCGCAGTGTCAGAGCTGCTCATGTTAAAGCAGCTGCACGAGCAGCATGCAGTCCGAACGGCTTCCTCGCTCACTTTGAACCTTACCAGCAGAATGAATATCACACCTCTTTTTGA
  5   1   3        nb Ova1      in                         CABE3063.5p                                                                                                                                                                                                                                                                                                                                                                                                                         ACAAATTTAAGGACAAGAACGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGNTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCA
  5   1   3        nb Ova1      in                         CABE8728.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAANACTAG
  3   1   3        nb Te5       in                         CAAO3995.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCCGTTGCTGCATGAAATCCAGGAACTGACGCAGAAAGTAGAAAAGGCACAGAGCNCAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTGCATTTAGCCAAACAAGTAGCTGCTTTAAAACAACAGTTAGTGTCCACTCATTTAGAGAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGT
  5   1   2       ext Tad5      in                         XZT42787.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTG
  3   1   2       ext Te5       in                         CAAO3665.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGT
  3   1   0       chi Brn3      in                         CAAK8126.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCCCGGTTGCATTAGCCAAACAGGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTAAAAGGATTTGTATTGGAATTCCAACTTCTCCGCAGGTAACTAGTTTATACTTTTGGCTGTATCACTGAAAACTATTCTGTTGCAATTCTCTGCTTGTAAATACAGAATAATACATTCAAATGTATTGGATGATGTCTCTGGTTGCCTGGAAGTGATTCTTCAGTGGCTGTTCAGCCACTGAACCGATTAGCTGGAGAGCGCACCAACGTGATGCCCATTAGTTTTATGTCGACAGCCATATTTTAAAACAATTTGCATTTAGTCTTATTTTTTTCAAGTTGAGAAAAACCTTTTTAATGGGAAAAAATGT
  3   1   3        nb Te5       in                         CAAO8305.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGT
  5   1   3        nb Te5       in                        CAAO12247.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCANACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACTA
  5   1   3        nb Gas                            TGas043c11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGGGGATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGG
  5   1   3        nb Brn4                                CAAL10843.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACC
  3   1   3        nb Te1  5g3  in                         CBWN7761.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGTTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAAAAAAAAAAAAAAA
  5   1   3        nb Te5       in                         CAAO3548.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACTACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCC
  5   1   3        nb Ova1      in                         CABE4569.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATTGTCGTCCTGAGCAAAACCAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTTCAGCTACCATGTTTGCATG
  5   1   3        nb Te1                                  CBWN2863.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGCTGGAGGTTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACTACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTG
  5   1   3        nb Te5       in                         CAAO4871.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCG
  5   1   3        nb Ova1      in                        CABE10183.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTG
  5   1   3        nb Tad5                                 XZT64422.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGACGCGTGGGCGGACGCGTGGGGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAGAGGCT
  3   1   3        nb Ski1      in                         CABJ3418.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACCTCTCGCCCTATAGG
  5   1   3        nb Tad5                                 XZT35373.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACTACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACGCAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGGTAGTTACTTCTTACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCNNAAAAAANAAAAAA
  5  -1   2       add In66                            IMAGE:8965760.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGATTCGTTAGCCCAAGGCCATTGAGATCGAACTGAGGCAGTACCAGCTTATGAACCGGCGAGTGGATTTCATTCTTAGCACCTTGCGCAAGTTGTTCAGAGCTGGTTCATGTTAAGCAGTTGCACGAGCAGGCATGCAGTTCGACAGCTTTTCGTCCACTTGACATTACACAGCAGATGATATTCAAACTTCTTTGAAGGACATTACCAATGCATTAGCTATGTTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACTACAAACCTCATTCCGTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACGCAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAATAAAAAAAAAAAAAAAAAAAAAAAAAGGGGACGAATTTTTTTGAGATAGTTTTTCTTGCATAATTAGTCCT
  3   1   3        nb Ovi1                                 CABI7018.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCA
  3   1   3        nb Sto1      in                        CABG11460.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTTCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAT
  3   1   3        nb Ova1      in                        CABE10183.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAAGTGGGATTCCATGTCTAGCACCTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTC
  3   1   4      seed Ovi1 5g3  in                        CABI10998.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTC
  3   1   3        nb Te5                                  CAAO6622.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGTCTAGCACCTGCCCGCAGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAT
  3   1   3        nb Ovi1 5g3  in                         CABI5808.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGCAGGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTC
  3   1   3        nb Ova1      in                         CABE4569.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCGGCAAAAAT
  3   1   3        nb Te3       out                       CAAM14237.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACTACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACGCAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAT
  3   1   2       ext Lun1      in                         CABD7712.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAATAAAAAAAA
  3   1   3        nb Ova1      in                         CABE3063.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTGATCTTTC
  3   1   2       ext Te5       in                         CAAO7890.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTNTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAT
  5  -1   3        nb Int1      out                        CAAP6025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAT
  3   1   2       ext Tad5      in                         XZT42787.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAT
  5   1   3        nb HeRe      in                      EC2CAA5BC07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACTACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACGCAGCCACCACCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGACCATTACT
  3   1   2       ext Te5       in                         CAAO4151.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACTACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACGCAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAT
  3   1   3        nb Te5       in                         CAAO3548.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACTACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACGCAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAT
  3   1   3        nb Ovi1 5g3  in                          CABI523.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTC
  3   1   3        nb Te5       in                         CAAO4871.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTC
  3   1   3        nb Gas8      in                          st13d20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTATAGCCTCTACTGCTCT
  3   1   3        nb Gas8      in                          st14d20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTATAGCCTCTAC
  5   1   3        nb Gas8      in                          st13d20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAA
  3   1   3        nb Te5  5g3  in                         CAAO6742.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAT
  5   1   3        nb Gas8      in                          st14d20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTATAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCCAA
  3   1   3        nb Te5       in                        CAAO12247.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACTACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACGCAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAT
  3   1   3        nb HeRe      in                      EC2CAA5BC07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACGCAGCCACCACCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGACCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGC
  3   1   2       add HdA       in                    THdA047n09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTGGTTAGTGTTTTTCTTCCCCCGTTTTTCTTGAGAATGCTTAGAGGGTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTTTTAGGGAATATGGTGTATCTTTCAAGTTACCATGTTTCCATGCCCGGTACATGTGGTGACACACCTGCAGTGTTTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTAATTGTCCTCTTGGCTATTGTTAAAACAGCCACCTATCAATCGCATTACATATATCTGCAACGTCCATGCAAAAAAAAAGAGCGCTAAAATGCCACTCTTAAACAGCATTAGATGTCCACTGAGAACAATGCCTTTACTTATAATCTGCCACCCGTGATACACTTACTGTGTGAGTAAAATTTCTGTTAGTGTACTTTCTTAACACTCCCATAGACCTTTATAGCCTTCTTAAATGCTTCTTTATATAAAAACTTATCTTTCAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       ext Sto1      in                         CABG2684.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAAAAAAAAAAAAAA
  3   1   2       ext Sto1      in                         CABG2684.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTC
  3   1   2       add HeRe 5g3  in                     EC2CAA33BH01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGAATGCTTAGAGGAAAAAAAAGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCACGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTATATTGTTACGCAGCCACCATGGGGGCATTACATA
  3   1   2       add Te4       in                         CAAN4915.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTATCTTTCAAGCTACACCATATTCCCTAAGAGATCAGATCTGACACAGCACCTGATATTAAGGGTGGAGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAT
  5   1   2       add Te4       in                         CAAN4915.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTATCTTTCAAGCTACACCATATTCCCTAAGAGATCAGATCTGACACAGCACCTGATATTAAGGGTGGAGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAATAAAAAAAAAAAAAAA
  3   1   3        nb Hrt1 5g3  in                         CAAQ8824.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACN
  3   1   3        nb Ova1      in                         CABE8728.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAT
  5   1   2                                           Xt7.1-CAAQ6029.3                                                              CGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAAGGGTCCTGGCCCAGAATAATGAGAAACTTTGTGAACTTATGAGGTTGCATTTGTCGTTCCCTGAGCAAAAAAAAGTTCTCCTCAAGGCTGCAAAAGATGGGCTGGAACTTAAAAAAACCCCCTTGGGGGAAACTGGAAGGCTTTCCTTTGCCAAAAATGATTCAAGG------------CGTCCGCTTGTAAATACAGAATAATACATTCAAATGTATTGGATGATGTCTCTGGTTGCCTGGAAGTGATTCTTCAGTGGCTGTTCAGCCACTGAACCGATTAGCTGGAGAGCGCACCAACGTGATGCCCATTAGTTTTATGTCGACAGCCATATTTTAAAACAATTTGCATTTAGTCTTATTTTTTTCAAGTTGAGAAAAACCTTTTTAATGGGAAAAAATGTAAAAAAATAAAAAAGGGGGGGAAATGTGAAGGCATGGTATTCCTGTAAAGAAGGTTCATTTGTGTTTTCCCCCTGTTGTATTCAGCTTCTCGACCACTCCAAATCCAAGGCAGTCATTCCGTATACCTCTTGTAACATGCAGCTTCTGTTCTCTGCCCCAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGGCACCTTGCCGCGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAATATGAAAA
                                                  Xt7.1-CHK-1008278910                                                                    GTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAAGGGTCCTGGCCCAGAATAATGAGAAACTTTGTGAACTTATGAGGTTGCATTTGTCGTTCCCTGAGCAAAAAAAAGTTCTCCTCAAGGCTGCAAAAGATGGGCTGGAACTTAAAAAAACCCCCTTGGGGGAAACTGGAAGGCTTTCCTTTGCCAAAAATGAT------------------------CTTGTAAATACAGAATAATACATTCAAATGTATTGGATGATGTCTCTGGTTGCCTGGAAGTGATTCTTCAGTGGCTGTTCAGCCACTGAACCGATTAGCTGGAGAGCGCACCAACGTGATGCCCATTAGTTTTATGTCGACAGCCATATTTTAAAACAATTTGCATTTAGTCTTATTTTTTTCAAGTTGAGAAAAACCTTTTTAATGGGAAAAAATGTAAAAAAATAAAAAAGGGGGGGAAATGTGAAGGCATGGTATTCCTGTAAAGAAGGTTCATTTGTGTTTTCCCCCTGTTGTATTCAGCTTCTCGACCACTCCAAATCCAAGGCAGTCATTCCGTATACCTCTTGTAACATGCAGCTTCTGTTCTCTGCCCCAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATxxxxxxGCACCTTGCCGCxGxTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAATA
  5   1   2       ext AbdN 5g                            IMAGE:7005137                                                              CGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAANACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAAGGGTCCTGGCCCAGAATAATGAGAAACTTTGTGAACTTATGAGGTTGCATTTGTCGTTCCCTGAGCAAAAAAAAGTTCTCCTCAAGGCTGCAAAAGATGGGCTGGAACTTAAAAAAACCCCCTTGGGGGAAACTGGAAGGCTTTCCTTTGCCAAAAATGATTCAAGGA
  5   1   4      seed Hrt1      in                         CAAQ6029.5p                                                                                                           CGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGANAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCT
  5   1   2       ext Brn4      in                        CAAL22113.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            NNCGTCCGCTTGTAAATACAGAATAATACATTCAAATGTATTGGATGATGTCTCTGGTTGCCTGGAAGTGATTCTTCAGTGGCTGTTCAGCCACTGAACCGATTAGCTGGAGAGCGCACCAACGTGATGCCCATTAGTTTTATGTCGACAGCCATATTTTAAAACAATTTGCATTTAGTCTTATTTTTTTCAAGTTGAGAAAAACCTTTTTAATGGGAAAAAATGTAAAAAAATAAAAAAGGGGGGGAAATGTGAAGGCATGGTATTCCTGTAAAGAAGGTTCATTTGTGTTTTCCCCCTGTTGTATTCAGCTTCTCGACCACTCCAAATCCAAGGCAGTCATTCCGTATACCTCTTGTAACATGCAGCTTCTGTTCTCTGCCCCAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACTAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCGTTTCTCCTG
  3   1   2       ext Brn4      in                        CAAL22113.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTGTCCAGAGGCTGCTCATGTAAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAT
  3   1   4      seed Hrt1      in                         CAAQ6029.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTCTAGCACCTTGCCGCAGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCNCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAATATGAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAL7457.3                                                               GCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGTTTGCACAAGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAA
                                                  Xt7.1-CHK-1008278906                                                                     TACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGTTTGCACAAGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATC
  5   1   2       ext BrSp 5g3  in                     EC2BBA17CB07.g1                                        GGGATTCATTGCCGGATTGTCACGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCTATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGTTTGCACAAGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATC
  5   1   2       ext TpA  5g3  in                  TTpA046l03.p1kaSP6                                                   AACTAGTGTCACGCTCGGTACCGGCGCTGGTATCTGTTGTGGCGCTCACTGGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGTTTGCACAAGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTT
  5   1   3   14   nb Brn4 5g3  in                         CAAL9799.5p ....................................................................................................GGCTGCCGTTTGTGCTTCTCCATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGTTTGCACAAGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCT
  5   1   3        nb TpA  5g                        TTpA073b12.p1kSP6                                                                                                                   CTTCTCTATCTACTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCTTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGTTTGCACAAGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAACAGTTAGTGTCCACTCATTTAGAGAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAG
  5   1   3   10   nb Eye  5g3  in                         CCAX8380.b1 ...............................................................................................................................................CTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCCTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCCTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGTTTGCACAAGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGT
  5   1   4      seed Brn4      in                         CAAL7457.5p                                                                                                                                                                                                                                                                       CGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGTTTGCACAAGAGCTGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTNCAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGT
  3   1   2       ext TpA  5g3  in                    TTpA046l03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCATGAATCCAGGAACTGACGCAGAAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTGCATTAGCCAAACAAGTAGCTGCTTAAAACAGCAGTTAGTGTCCACTCATTTAGAAAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAAAAAAAAAAAAAAAAAAA
  3   1   4      seed Brn4      in                         CAAL7457.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAAT
  3   1   3        nb Brn4 5g3  in                         CAAL9799.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATGGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTC
  3   1   3        nb Eye  5g3  in                         CCAX8380.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACCACAAACCTCATTCCCTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACACAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTC
  3   1   2       ext BrSp 5g3  in                     EC2BBA17CB07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCCTCCCCAAACAAGAGAGTGTTTTACCATAGTACATATTATGTCATGTTACTCTCTCTCCTCCCCCGTTTATCCTGAGAATGCTTAGAGGCTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACGCAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTT
  5   1   2  SIG                                      Xt7.1-XZG35296.5                                                                                                                    CTTCTCTATCTCTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCTTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCTTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACACACAGCAGATGATATCAAACTCTTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCATACAAACCTCATTCCGTATAATACCAAGGAAACAAGAGTTTCTGCAGAACTCTGCACTAAAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACGCAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAATAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008278904                                                                                                                          TATCTCTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCTTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCTTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACxxxxxxCAGATGATATCAAACTCTTTxxAxGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTxxTxxxTACAAACCTCATTCCGTATAATACCAAGGAAACAAGAGTTTCxxxxxxACTCTGxxxxAxAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACGCAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAxxAAAAAAAAAA
  5   1   4      seed TpA  5g3  in                   TTpA025h04.p1kSP6                                                                                                                    CTTCTCTATCTCTTCTACAGCGTCTGACCTGATAGAAGCCGTTGAGCGTGTGGCTGTCTGGCTCTTTCCGTCCGGCCCATTGCCGCATTGAGCCGCGCCCAGGCCCCTCTTGTCATCTCACGTATAAGACATGGCCGACCCCAAATACGCCGACCTGCCAGGCATAGCCAGGAATGAGCCAGATGTCTATGAAACAAGTGATTTGCCTGAAGACGATCAAGCTGAGTTTGATGCGGAGGAGCTTACTAGCACTAGCGTAGAACACATCATTGTCAACCCCAATGCAGCTTATGACAAATTTAAGGACAAGAAAGTTGGCACCAGAGGTTTAGATTTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCNGAATGATCAGGACACTCAGAATCCCCTCACT
  5   1   2       ext Gas7      in                         XZG35296.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTCAGATCGGATTACCAAGTCCAAGAGGACAGGCTATGAATCCGGGGAGTACGAAATTCTTGGGGAAGGAATAGGAATAAAAGAAACACCACAGCAGAAGTACCAGCGGTTGCTGCATGAAATCCAGGAACTGACGCAAGAAGTAGAAAAGGCACAGAGCACAGTGAAAGAATCTGCTGCTGAAGAGAAACTGACCCCGGTTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAACAGTTAGTGTCCACTCATTTAGAGAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGANATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCATGTCTAGCACCTTGCCGCANGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGTACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAG
  5   1   3        nb Egg       in                   TEgg055c03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGCATTAGCCAAACAAGTAGCTGCTTTAAAACAGCAGTTAGTGTCCACTCATTTAGAGAAACTACTGGGCCCAGACGCTGCCATCAACTTGACCGACCCAGATGGTGCCCTGGCAAAGCGTTTGCTGACTCAGTTGGATGTGGCCAAAACTAGAAAAAATCCTGAAGGAAAAAGCCCTGCAAAGGGTCCTGGCCCAGATAATGAGAACTTTGTGACTTATGAGTTGCATTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGC
  5   1   3        nb HdA                           THdA002b01.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGTCGTCCTGAGCAAAACAAGTTCTCTCAGGCTGCAAAGATGGCTGAGCTAGAGAAGCGCTTGGGGGAGCTGGAGGCTGCTGTGCGAAATGATCAGGACACTCAGAATCCCCTCACTGTGGGACTTCAAGGATCTTGTTTGATGGACACAGTTGAAATTCTACAGGCTAAAGTCAATTTGTTGGATGTAGCATCTCTGGACCAAGTGGAGGCCAGACTACAGAGTGTCTTAGGGAAAATGAATGAAATCGCTAAGCACAAAGCGGCCATTGAGGATGCAGACACTGAAAGCAAGGTGCACCAGCTCTATGAGACCGTGCAGAAGTGGGATTCCATGTCTAGCACCTTGCCGCAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACTACAAACCTCATTCCGTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAANGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTNAGGAAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCA
  3   1   3        nb Egg       in                    TEgg055c03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGGTTGTCCAGAGGCTGCTCATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACTACAAACCTCATTCCGTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACGCAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTTCAAAAATAAAAAAAAAAAAAAAAAA
  3   1   4      seed TpA  5g3  in                    TTpA025h04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATGTTAAAGCAGCTGCACGAGCAAGCCATGCAGTTCGGACAGCTTCTCGCCCACTTGGACACTACACAGCAGATGATATCAAACTCTTTGAAGGACAATACCAATGCATTAGCTATGGTCCAGAAGGCCATGAAGGAGAACCTGGCCACAGTGGAAGACAATTTTACCAGTATTGATGCGAGAATAAAGAAACTAAGTAAATGAGTTGCACTTCTTCACTACAAACCTCATTCCGTATAATACCAAGGAAACAAGAGTTTCTGCAGACTCTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAGGTGCTGTGTCAGATCTGATCTCTTAGGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACGCAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGAGGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTTCTTTCAAAAATAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas7      in                         XZG35296.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTCACTACAAACCTCATTCCGTATAATACCAAGGAAACAAGAGTTTTTGCAGACTTTGCACTAAGAAATCAACTCCCTCCCCAACCAAGAGAGGTTTTACCATTGGACAAATTAAGTCTTGTTACTCTCTCTCCTCCCCCGTTTTTCCTGTACCTGCCCATGCAGGGACACTCACTCCCCCCTTAATATCAGGGGCTGGGTCAGATTTGATTTTTTAGGGAATATGGGGTTTTTTTCAAGCTACCATGTTTGCATGCCCGGTACATGGGGTGCGCCCCCTGCAGTGTTTGGGGGGAACATCCATAGACCTTTTATTTAGGTATGTATATCGTTCTTGTCCTCTTTTTATTGTTAGGCAGCCCCCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGGGGGTAAATGCCCCCTTAACAGCATTGATGTCATGGGACAATGCCTTACTTTAACTGCCCCCTGATCATTACTGTTAGTAAATTTTGTTAGTTACTTTTTAACCCCCCTAGACTTTATAGCCTCTTACTGCTTTTTATATAAAACTTTTCTTTCAAAAATAAAAAAAGG
  5   1   3        nb Neu                            TNeu070h23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAAACAAGATTTCTGCAGACTCTGCACTAATAATCATCTCCCTCCCCAACCAATAGAGGTTTTACCATTGTACATATTATGTCTTGTTACTCTCTCTCCTCCCCCGTTTCTCCTGTACCTGCCCATGCACGGACACTCACTCCACCCTTAATATCAAGTGCTGTGTCAGATCTGATCTCTTATGGAATATGGTGTATCTTTCAAGCTACCATGTTTGCATGCCCGGTACATGCGGTGCGCCACCTGCAGTGTCTGAGGAGAACATCCATAGACCTTTTATTTATGTATGTATATCGTTCTTGTCCTCTTTCTATTGTTACGCAGCCACCATCAATGCATTACATATACTGCAACGTCCAGCAAAAAAAAGATGCTAAATGCCACCTTAACAGCATTGATGTCATGAGACAATGCCTTACTCTAACTGCCACCTGATCATTACTGTTAGTAAATTCTGTTAGTTACTTCTTAACCTCCCTAGACTTTATAGCCTCTTACTGCTTCTTATATAAAACTTATCTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)