Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 81%

 1012071757 Xt7.1-CAAL5742.3.5 - 104 ESTs
                                                                       ....-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAL5742.3.5                                                                                                                                                                                                   CAACTATGGCGGCGCTCAGACACTTCCTGCGCTCTAGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATATACTGTACATGTAGAAGAGTGTTTACATTGGAATCCACCAATAAATATTACAAGAAAGGGCAGAACACACACTTTGGCTGCACCAATTCTGTGGTTCTGTTTCTGACCTGGTCCATCTGACTACACCTTGCTCTGTCCTTACCAGCTCTTTAATATGAATAGCAATACGTTGGGGCAGA
                                                  Xt7.1-CHK-1008223127                                                                                                                                                                                                         TGGCGGCGCTCAGACACTTCCTGCxCxxxxGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTxTGxGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATxTxxxxTACATGTAGAAGAGTGTTTACATTGGAATCCACCAATAAATATTACAAGAAAGGGCAGAACACACACTTTGGCTGCACCAATTCTGTGGTTCTGTTTCTGACCTGGTCCATCTGACTACACCTTGCTCTGTCCTTACCAGCTCTTTAATATGAATAGCAATACGTTGGGGCAGATTCTAA
                                                      consensus depths                                                                                                                                                                                                        3     9    10    16    13    25    14    32    34    37    36    39    37    40    38    41    39    41    40    42    40    42    40    42    41    43    41    44    41    44    41    44    42    45    43    45    43    44    43    44    43    44    43    44    43    44    43    44    43    44    43    44    44    44    44    44    45    45    45    45    45    45    45    45    44    44    45    45    45    45    46    46    46    46    46    46    46    46    45    45    45    45    46    46    46    46    49    49    48    49    49    51    48    52    50    52    51    53    52    57    54    58    58    64    61    67    63    69    63    68    64    69    65    70    64    69    64    69    65    70    66    72    66    71    67    71    67    71    66    70    64    70    60    68    59    66    56    63    55    63    48    56    49    55    45    52    46    53    45    52    42    48    43    49    43    48    43    49    43    49    42    49    42    49    42    48    42    48    43    49    42    49    43    49    43    49    40    48    36    48    45    48    36    49    37    49    37    49    37    50    38    49    38    49    36    49    38    49    36    49    37    48    37    48    37    48    38    49    38    49    38    49    37    49    37    50    37    48    37    47    35    45    31    45    35    46    33    45    31    45    14    27    13    22    13    19    13    18    14    19    14    19    14    19    14    19    14    19    14    19    15    19    15    19    15    19    15    19    15    19    15    19    12    19    13    18    10    16     9    13     9    13     4     7     4     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     4     5     4     5     4     5     4     5     3     4
  5   1   2  SIG                                      Xt7.1-CAAL5742.3                                                                                                                                                                                          TTTCAAAGGCAAAGGCAACTATGGTCAGACACTTCCACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCACTGGTCTGGGTGTAGTTTGTACTAGAGAGTAATATTAGTGAAAGAGCGCCCCCTAATTGCACCACTATATATAATTACTGCTGGTACTGATATGGGATGTGACCATGTTCTGGTATCTTTGTGCATCTGAAGCAGAGGAATAAACCGGACTGGACATGTGGCTCTGAAACCCACAGGGATCCAAATCTCAGTTCCAAGAGACCCAATAATAATAATCTGGGATCTGGAAGGTTTTATACTGTACATGTAGAAGAGTGTTTACATTGGAATCCACCAATAAATATTACAAGAAAGGGCAGAACACACACTTTGGCTGCACCAATTCTGTGGTTCTGTTTCTGACCTGGTCCATCTGACTACACCTTGCTCTGTCCTTACCAGCTCTTTAATATGAATAGCAATACGTTGGGGCAGATTCTAATCAATGGGAAAATGTTATTTTATGGTTTATCACGTCTGTATACAGGGACTTTACATTATTGCAGTAGACACAAAATTGCCCAACTATACTATATAATACAATGCC
  5   1   2  SIG                                       Xt7.1-XZT5386.5                                                                                                                                                                                                              GCGCTCAGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTCATTAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                               TGGCGGCGCTCAGACACTTCCTGC
                                                                   VAR                                                                                                                                                                                                                                       CTCAGACACAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAAGAGGAAAATCATTTGTGATTGATCCAGGGATCAATTTGGGGGCCAATGGTCCGTGCATTAGGTGCCCCTCTTCAGTTTGGGCAGCAGTATACAAAACTAGACGCAGTACGTGTGGGAGCCACACATACCCCAAAGGCTGGCCGTGGGTGGGAGTTGTTCCAAACGTAACCTTCTGTTCCCTGTGTGCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCGAGATATGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGTGTAGTTTGTACTAGAGAGTAATATTAGTGAAAGAGCGCCCCCTAATTGCACCACTATATATAATTACTGCTGGTACTGATATGGGATGTGACCATGTTCTGGTATCTTTGTGCATCTGAAGCAGAGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGACATGTGGCTCTGAAACCCACAGGGATCCAAATCTCAGTTCCAAGAGACCCAATAATAATAATCTGGGATCTGGAAGGTTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                       ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------T--C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------T--
                                               BLH ATG       5     249                                                                                                                                                                                                   
                                               EST CLI      14      33                                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                           PROTEIN --- Sc ==== 3e-093     NP_014361.1 alpha-4-beta-4 subunit of mitochondrial isocitrate dehydrogenase 1; Idh1p[Saccharomyces cerevisiae] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 1e-096     NP_001025597.1 MGC107965 protein [Xenopus tropicalis] -----------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---- 7e-101     XP_001175786.1 PREDICTED: similar to NAD (H)-specific isocitrate dehydrogenase gamma subunit precursor isoform 1 [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                 PROTEIN --- Ce ---- 6e-116     NP_510362.1 isocitrate dehydrogenase (41.6 kD) (XO790) [Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                PROTEIN --- Dm ---- 5e-122     NP_651000.1 CG6439-PA [Drosophila melanogaster] -----------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 2e-171     NP_570954.1 isocitrate dehydrogenase 3, beta subunit; isocitrate dehydrogenase 3 beta; N14Atumor-related protein [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 5e-172     NP_777280.1 isocitrate dehydrogenase 3, beta subunit isoform b precursor; isocitricdehydrogenase; NAD+-specific isocitrate dehydrogenase beta precursor;NAD+-specific isocitrate dehydrogenase b subunit; NAD+-specific ICDH; isocitratedehydrogenase, NAD(+)-specific, mito [Homo sapiens]  ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                    PROTEIN --- Dr ---- 8e-173     NP_001002157.1 zgc:86647 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                 PROTEIN --- Gg ---- 2e-173     NP_001026558.1 isocitrate dehydrogenase 3, beta subunit [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 0          AAH72104.1 MGC79028 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PROTEIN === ?? ==== 0          NP_001085395.1 MGC79028 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAL5742.3.5                                                                                                                                                                                                        ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2  SIG                                      Xt7.1-CAAL5742.3                                                                                                                                                                                          TTTCAAAGGCAAAGGCAACTATGGTCAGACACTTCCACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCACTGGTCTGGGTGTAGTTTGTACTAGAGAGTAATATTAGTGAAAGAGCGCCCCCTAATTGCACCACTATATATAATTACTGCTGGTACTGATATGGGATGTGACCATGTTCTGGTATCTTTGTGCATCTGAAGCAGAGGAATAAACCGGACTGGACATGTGGCTCTGAAACCCACAGGGATCCAAATCTCAGTTCCAAGAGACCCAATAATAATAATCTGGGATCTGGAAGGTTTTATACTGTACATGTAGAAGAGTGTTTACATTGGAATCCACCAATAAATATTACAAGAAAGGGCAGAACACACACTTTGGCTGCACCAATTCTGTGGTTCTGTTTCTGACCTGGTCCATCTGACTACACCTTGCTCTGTCCTTACCAGCTCTTTAATATGAATAGCAATACGTTGGGGCAGATTCTAATCAATGGGAAAATGTTATTTTATGGTTTATCACGTCTGTATACAGGGACTTTACATTATTGCAGTAGACACAAAATTGCCCAACTATACTATATAATACAATGCC
                                                  Xt7.1-CHK-1008278816                                                                                                                                                                                                AGGCAAxxxxxxCxxxGxTCAGACACTTCCxxxxCxTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAxxxAxxxxTCTGGGTGTAGTTTGTACTAGAGAGTAATATTAGTGAAAGAGCGCCCCCTAATTGCACCACTATATATAATTACTGCTGGTACTGATATGGGATGTGACCATGTTCTGGTATCTTTGTGCATCTGAAGCAGAGGAATAAACCGGACTGGACATGTGGCTCTGAAACCCACAGGGATCCAAATCTCAGTTCCAAGAGACCCAATAATAATAATCTGGGATCTGGAAGGTTTTATACTGTACATGTAGAAGAGTGTTTACATTGGAATCCACCAATAAATATTACAAGAAAGGGCAGAACACACACTTTGGCTGCACCAATTCTGTGGTTCTGTTTCTGACCTGGTCCATCTGACTACACCTTGCTCTGTCCTTACCAGCTCTTTAATATGAATAGCAATACGTTGGGGCAGATTCTAATCAATGGGAAAATGTTATTTTATGGTTTATCACGTCTGTATACAGGGACTTTACATTATTGCAGTAGACACAAAATTGCCCAACTATACTATATAATACAATGCCAATAAA
  5   1   2   15  ext Brn4 5g3  in                        CAAL18941.5p TCTCCTCCCCCCGCTGCTCAGGCACTGTGTCTGTAAGGTGCTAATTTCCCATAAGCCACTGTGAGTCATTGTGCTCCCCGCTTCGTCCATCGCCCCGTAACAGGCCGGAGTGGGCGGGGTTATACAGCGGGGCTGGCGCTAGCGGAACTGAAGGAACGGCGTGTTTAACGTCACTTCCTGTCTCCTTTCAAAGGCAACTATGGCGGCGCTCAGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGA
  5   1   0       chi In66                            IMAGE:8964130.5p                                                                                                                                                   ACACTTTTATTGGAGGGATTAAATTCAGAAAACAAAATCGTCCCCCTTTCAAGGCAACTATGGCGGCGCTCAGACACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGTGATTTTCGGAGCAAAGGAGGAGATACAGTCCTTGGAGCACAAACGTCACGGATCTCGATGCTTAATCTACCGAAGAATCACGATGCCAGTGGTTGATAGCCCAAAGGCAACCGGCTGTGGCCAGCATCTGACTGGAAGGCGTCTGGGGG
  5   1   2       add In66 5g                         IMAGE:8964819.5p                                                                                                                                                                  CATCAAAATTCTTAACATTAATAATTTTAAAAAAAGAAACGGCGGCGCTCAGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTTGATTATGCCACCAAGAAGGGCAGATCCAACGTCACTGCTGTGCACAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGAATCAATGATTATTGACAACTGCTGCATGCAGCTGATGCAAAACCCATACAGGTTTGATGTGGCTGATCATCCATCTGTTATGCAAATTCATCGATACTTGCGGCTGGCTGTCCGGGGGCGCTGGGATGAGCGGCAG
  5   1   2       add In66 5g                         IMAGE:8966312.5p                                                                                                                                                                         ATTTTTTTGAGGTTTCCTTCAATTTTTAAATCGTCCCATGGCGGCGCTCAGACACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCACCTGTATGCATATCATCGATACTGCGCTGGACTGGTCGGGCGCTGGGTTGTGCAAGGGAGAGTACAGTGCGAATAACGCGTGTTGGAGAACGGGTGCAACGCCACCTACG
  5   1   3        nb BrSp 5g3  in                     EC2BBA20DF12.g1                                                                                                                                                                              GGGCCTGTCTCCTTTCAAAGGCAACTATGGCGGCGCTCAGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTCCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTTCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAGGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAG
  5   1   2   14  ext Te5  PIPE in                         CAAO1389.5p ..........................................................................................................................................................................................TCTCCTTTCAAAGGCAACTATGGCGGCGCTCAGACACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCCACCTGTATGGGCATATCATCGATAACCTGGCGGCTGGGCTGGTC
  5   1   3   24   nb Brn4 5g                             CAAL11140.5p .............................................................................................................................................................................................CCTTTCAAAGGCAACTATGGCGGCGCTCAGACACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTAT
  5   1   3   14   nb Brn4 5g3  in                         CAAL8239.5p ................................................................................................................................................................................................TTCAAAGGCAACTATGGCGGCGCTCAGACACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCG
  5   1   2   14  add Brn4 5g3  in                         CAAL8997.5p ..................................................................................................................................................................................................TCGGTCGGATTCCGGGATTCGTCGACCCCGCGTCCGTCAGACACANGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGT
  5   1   2       add In60 5g                         IMAGE:8948484.5p                                                                                                                                                                                                   CAACTATGGCGGCGCTCAGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAAGGGCAGATCCAAAGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACATGATTATTGACACTGCTGCATGCAGCTGGTGCAGACCCATACCAGTTTGATGTGCTGTCATGCCCACTGTATGCATATCATCGATACCTGCGCTGGGCTGTCGGGGCGCTTGGTGGTGCAGGAAGTTACAGTGCGATACGCCTGATGGAAACCGGGTGCAGCCAACCCTTCGCACACAAGG
  5   1   2   10  ext Tail 5g3  in                         CBSW1404.b1 .........................................................................................................................................................................................................GGCGGCGCTCAGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTAGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCG
  5   1   3   22   nb Gas7 5g                              XZG42268.5p ............................................................................................................................................................................................................GGCGCTCAGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCCACCTGTATGGNCATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCCCTGGGGT
  5   1   3   10   nb Bone 5g3  in                        CBTC9651.fwd ............................................................................................................................................................................................................GGCGCTCAGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTNGACACATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGACCCCATACCAG
  5   1   3        nb Gas8 5g                               st10h24.5p                                                                                                                                                                                                                GGCGGCGCTCAGACACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAA
  5   1   2   14  ext Brn4 5g3  in                        CAAL18947.5p ................................................................................................................................................................................................................CTCAGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGNGCTGGTCGGGGGCGCTGGGG
  5   1   3   11   nb Te1  5g3  in                        CBWN10250.b1 .....................................................................................................................................................................................................................GACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCATCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTAGTCATGCCCAACCT
  5   1   3        nb Te5       in                        CAAO12742.5p                                                                                                                                                                                                                          AGACACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGTTCGGGGCGCTGGGGTGGTGCCAGGGG
  5   1   3   24   nb Te5  5g                             CAAO11422.5p ..........................................................................................................................................................................................................................GACACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGC
  5   1   3   20   nb Tbd1 5g                              CBXT6071.b1 ..........................................................................................................................................................................................................................GACACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCT
  5   1   2   10  ext Ski1 5g3  in                         CABJ1338.5p ...........................................................................................................................................................................................................................ACACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGAT
  5   1   3   14   nb Brn4 5g3  in                        CAAL19728.5p ............................................................................................................................................................................................................................CACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGNCATATCATCGATAACCTGGCGGCTGGGCTGGT
  5   1   2   14  ext Brn4 5g3  in                         CAAL5742.5p ............................................................................................................................................................................................................................CACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTC
  5   1   2       add AbdN 5x                            IMAGE:7021681                                                                                                                                                                                                                              CTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCCCCATGCAGGCAAATTAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGGCAGATCCAAAGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAAGGAAGTGGCACAACTGTACCCCCAAGAAACAATTTTGACCCAATGATTTATTGACAACTGCCGGCTTGCACCTGGGTGCAAAAACCCCTACCAGTTTGGATGTTGCTGGTCCAGGCCCCAACCCTGTTTGGCAATTATCATTCGAATAACCCTGGCGGCCTGGGGCCTGGGTCCGGGGGGCCCCTGGGGGTGGGGTGCCCCGG
  5   1   3   14   nb Brn4 5g3  in                        CAAL20504.5p .............................................................................................................................................................................................................................ACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCCAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCCACCTGTATGGCAATATCATCGAT
  5   1   4   10 seed Ova1 5g3  in                         CABE5178.5p .....................................................................................................................................................................................................................................CTCAGAACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTC
  5   1   3   24   nb Brn4 5g                             CAAL23332.5p ............................................................................................................................................................................................................................................CTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCCGTGTTTGAGACGG
  5   1   2   10  ext Mus1 5g3  in                         CABH9535.5p ............................................................................................................................................................................................................................................CTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGG
  5   1   3   10   nb Spl1 5g3  in                         CABK9635.5p ............................................................................................................................................................................................................................................CTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCA
  3  -1   2       ext Lun1      in                        CABD12614.3p                                                                                                                                                                                                                                                GAGAGGACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCA
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ4868.5p .................................................................................................................................................................................................................................................CTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGAC
  5   1   3        nb Gas8 5g                               st32k13.5p                                                                                                                                                                                                                                                            AGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTG
  3  -1   3        nb Hrt1      in                         CAAQ1247.3p                                                                                                                                                                                                                                                                          CGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCC
  5   1   3   20   nb Te1  5g                             CBWN18034.b1 ...................................................................................................................................................................................................................................................................................TATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTAGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGC
  5   1   2   12  add Gas7 5g3  in                          XZG4387.5p .............................................................................................................................................................................................................................................................................................................GCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTAGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAACATGCTG
  5   1   3   10   nb Tbd1 5g3  in                         CBXT3275.b1 ..............................................................................................................................................................................................................................................................................................................................................GTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCCTTTCG
  5   1   3        nb Brn4      in                         CAAL5866.5p                                                                                                                                                                                                                                                                                                                                                        ATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCA
  5   1   3        nb Spl2      in                        CBSS6121.fwd                                                                                                                                                                                                                                                                                                                                                                                             CGACCCCGCGTCCGGTTCAGGCGGCTGATGTTCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCCTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCA
  5   1   3        nb Mus1      in                         CABH8155.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCC
  3   1   2       ext Ski1 5g3  in                         CABJ1338.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGA
  5  -1   3        nb Hrt1      in                         CAAQ1247.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCCTCGG
  3   1   2       ext Brn4 5g3  in                         CAAL5742.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATACCCAGAGAGAAGTCCACCCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  3   1   3        nb Brn4 5g3  in                        CAAL19728.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  3   1   3        nb Spl1 5g3  in                         CABK9635.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTGCCTTAAAATCATACNCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGGCAATAAACATGTATGG
  3   1   4      seed Ova1 5g3  in                         CABE5178.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAATCATANCCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTGTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  5  -1   2       ext Lun1      in                        CABD12614.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCATAACCAGAGAGAAGTCCACCCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAAAAAAAAACCTCGTGCCGAATTGA
  5  -1   3        nb AbdN                               IMAGE:7021950                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTGCCCAAGTTTGCGTTGAATTATGCCACCCAGAAAGGGGCAGATCCAAGGTCCACTGCTGTGCACAAAGCCAAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTGTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAAAAAAAAAAAAAAAAAAAAAAAAAGGGCGGCCG
  3   1   2       add Ovi1      out                        CABI6065.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGGAAAGGGGCAGAAAGATTGGAAATGATGGAGGAGAAGGAGGAAAGAGCAGAAAGTGGAAATGATGGAGAGGCTGAATGGGTAGAAACAGTGAAGATGATGGAGGATTACATTACATTAACATTTATTTATAAAGCGCCAACATATTCCGCAGCAAGGATAGGACCAGTGGAGATGATGGAGGAGGAGAGAAGGGTAGGTAGAAGAATAGAAATTGGAGGAAAGGGTAGGAACTATCAAGTTGATGGTGAAGGTGGAACGGTTAGAAAGAATGGAGATGATGAAGAGGAAAATCATTTGTGATTGATCCAGGGATCAATTTGGGGGCCAATGGTCCGTGCATTAGGTGCCCCTCTTCAGTTTGGGCAGCAGTATACAAAACTAGACGCAGTACGTGTGGGAGCCACACATACCCCAAAGGCTGGCCGTGGGTGGGAGTTGTTCCAAACGTAACCTTCTGTTCCCTGTGTGCCCTCAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTGTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGG
  3   1   2       ext Te5  PIPE in                         CAAO1389.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTTTGCGTTTGATTATGCCACCAGAAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGG
  3   1   3        nb Hrt1 5g3  in                         CAAQ4868.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTGTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTGTGT
  3   1   3        nb Mus1      in                         CABH8155.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTGCGTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGG
  3   1   2       add Brn4 5g3  in                         CAAL8997.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  3   1   2       ext Brn4 5g3  in                        CAAL18947.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  3   1   2       ext Tail 5g3  in                         CBSW1404.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTAGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAAAAAAAAAAAAAA
  3   1   3        nb Brn4      in                         CAAL5866.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAAGGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  3   1   2       ext Mus1 5g3  in                         CABH9535.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCAAAAAAG
  3   1   2       ext Brn4 5g3  in                        CAAL18941.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  3   1   2       add Gas7 5g3  in                          XZG4387.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGGGCAGATCCAAGGTCACTGCTGTGCCCAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTAGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTTTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTTTTAGGGGCATCTGTGCCAACAACGGGTTCCTTTGCCCCAGGATTGGGGGCAAAAGTGTTTTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGGG
  3   1   3        nb BrSp 5g3  in                     EC2BBA20DF12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTACTGGTCATGCCCAACTTGTATGGCAATATCATCGATAACCTGGCGGCCGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATATGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCCGCCCCCTTCTAGCGCCTACCTACTTGC
  3   1   3        nb Bone 5g3  in                        CBTC9651.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTAGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGTGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATG
  3   1   3        nb Tbd1 5g3  in                         CBXT3275.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTTTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTTTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAAAAAAAAAAAAAA
  3  -1   3        nb Hrt1      in                         CAAQ6919.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTTTCTGGGAAATGAGGGTCTAGCGTGTGATTGG
  5  -1   3        nb Hrt1      in                         CAAQ6919.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTTTCTGGGAAATGAGGGTCTAGCGTGTGATTGG
  3   1   3        nb Te5       in                        CAAO12742.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  3   1   3        nb Spl2      in                        CBSS6121.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCCGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACCATGTATGT
  3   1   3        nb Brn4 5g3  in                         CAAL8239.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTTTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTTTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTTTTTGGATTACACACAGGCCGTCATTTCCAACCTGAGCTTTTAGGGGCATTTGTGCCAACAACGGGTTCCTTTGCACCAGGATTGGGGGCAAAAGTGTTTTTTTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGGGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTTTGAATTTACCCGCTGCCCCCTTCTAGGGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  5   1   3        nb Brn4                                 CAAL8301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGA
  3   1   3        nb Brn4 5g3  in                        CAAL20504.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTG
  3   1   3        nb Te1  5g3  in                        CBWN10250.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTAGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGTGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTCCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGCGAAAAAAAAAAAAAAA
  5   1   3        nb BrSp                            EC0CBA005CB03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATATGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCCGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCC
  3   1   2       add Ovi1      in                        CABI14092.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATGATGAAGAGGAAAATCATTTGTGATTGATCCAGGGATCAATTTGGGGGCCAATGGTCCGTGCATTAGGTGCCCCTCTTCAGTTTGGGCAGCAGTATACAAAACTAGACGCAGTACGTGTGGGAGCCACACATACCCCAAAGGCTGGCCGTGGGTGGGAGTTGTTCCAAACGTAACCTTCTGTTCCCTGTGTGCCCTCAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCAAAAAAA
  5   1   2       add Ovi1      in                        CABI14092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATGATGAAGAGGAAAATCATTTGTGATTGATCCAGGGATCAATTTGGGGGCCAATGGTCCGTGCATTAGGTGCCCCTCTTCAGTTTGGGCAGCAGTATACAAAACTAGACGCAGTACGTGTGGGAGCCACACATACCCCAAAGGCTGGCCGTGGGTGGGAGTTGTTCCAAACGTAACCTTCTGTTCCCTGTGTGCCCTCAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCAAAAAAA
  5   1   3        nb Thy1      in                        CBST5319.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGGGTGCACGCCACCTCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGC
  3   1   3        nb Thy1      in                        CBST5319.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGTACGACTGACATGGGAGGTTACGCTACTTCTCTGGATTACACACAGGCCGTCATCTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCC
  5   1   2       ext Thy1      in                       CBST13239.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTACGCTACTTCTCTGGATTAACACAGGCCGTCATCTCCAACCTGAGCTCTTAAGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAAGATTGGGGGCAAAAGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCACTGGTCTGGGTGTAGTTTGTACTAGAGAGTAATATTAGTGAAAGAGCGCCCCCTAATTGCACCACTATATATAATTACTGCTGGTACTGATATGGGATGTGACCATGTTCTGGTATCTTTGTGCATCTGAAGCAGAGGAATAAACCGGACTGGACATGTGGCTCTGAAACCCACAGGGATCCAAATCTCAGTTCCAAGAGACCCAATAATAATAATCTGGGATCTGGAAGGTTTTATACTGTACATGTAGAAGAGTGTTTACATTGGAATCCACCAATAAATATTACAAGAAAGGGCAGAACACACACTTTGGCTGCACCAATTCTGTGGTTCTGTTTCTGACCTGGTCCATCTGACTACACCTTGCTCTGTCCTTACCAGCTCTTTAATATGAATAGCAATACGTTGGGGC
  5   1   2       ext Tbd1      in                        CBXT11901.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCAACCTGAGCTCTTAGGGGCATCTGTGCCAACAACGGGTTCCTCTGCACCAGGATTGGGGGCAAATGTGTTCTTCTGTGTGTCCCAGCAAAGCACAATCCCTGCTCTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCCGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCACTGGTCTGGGTGTAGTTTGTACTAGAGAGTAATATTAGTGAAAGAGCGCCCCCTAATTGCACCACTATATATAATTACTGCTGGTACTGATATGGGATGTGACCATGTTCTGGTATCTTTGTGCATCTGAAGCAGAGGAAAAAACCGGACTGGACATGTGGCTCTGAAACCCACAGGGATCCAAATCTCAGTTCCAAGAGACCCAATAATAATAATCTGGGATCTGGAAGGTTTTATACTGTACATGTAGAAGAGTGTTTACATTGGAATCCACCAATAAATATTACAAGAAAGGGCAGAACACACACTTTGGCTGCACCAATTCTGTGGTTCTGTTTCTGACCTGGTCCATCTGACTACACCTTGCTCTGTCCTTACCAGCTCTTTAATATGAATAGCAATACGTTGGGGCAGATTCTAATCAATGGGA
  3   1   2       ext Thy1      in                       CBST13239.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGCCTGTTTTCCAAGCGTCTACTTGCACTATTTATTTATTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCTGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCACTGGTCTGGGTGTAGTTTGTACTAGAGAGTAATATTAGTGAAAGAGCGCCCCCTAATTGCACCACTATATATAATTACTGCTGGTACTGATATGGGATGTGACCATGTTCTGGTATCTTTGTGCATCTGAAGCAGAGGAATAAACCGGACTGGACATGTGGCTCTGAAACCCACAGGGATCCAAATCTCAGTTCCAAGAGACCCAATAATAATAATCTGGGATCTGGAAGGTTTTATACTGTACATGTAGAAGAGTGTTTACATTGGAATCCACCAATAAATATTACAAGAAAGGGCAGAACACACACTTTGGCTGCACCAATTCTGTGGTTCTGTTTCTGACTTGGTCCATCTGACTACACCTTGCTCTGTCCTTACCAGCTCTTTAATATGAATAGCAATACGTTGGGGCAGATTCTAATCAATGGGAAAATTTTATTTTATGGTTTATCACGTCTGTATACAGGGACTTTACATTATTGCAGTAGACACAAAATTGCCCAACTATACTATATAATACAATGCCAATAAACTTTCTTTCTCC
  3   1   2       ext Tbd1      in                        CBXT11901.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGTCTTCTGGGAAATGAGGGTCTAGCGTGTGATTGGCCAGTGAGCTTCACTCTGAATCTACCCGCCGCCCCCTTCTAGCGCCTACCTACTTGCCCCTCTGTGTGTGCAATAAACATGTATGTGAAGCCACTGGTCTGGGTGTAGTTTGTACTAGAGAGTAATATTAGTGAAAGAGCGCCCCCTAATTGCACCACTATATATAATTACTGCTGGTACTGATATGGGATGTGACCATGTTTTGGTATTTTTGTGCATTTGAAGCAGAGGAAAAAACCGGACTGGACATGTGGCTTTGAAACCCACAGGGATCCAAATTTCAGTTCCAAGAGACCCAATAATAATAATTTGGGATTTGGAAGGTTTTATACTGTACATGTAGAAGAGTGTTTACATTGGAATCCACCAATAAATATTACAAGAAAGGGCAGAACACACACTTTGGCTGCACCAATTTTGTGGTTTTGTTTTTGACCTGGTCCATTTGACTACACCTTGTTTTGTCCTTACCAGCTTTTTAATATGAATAGCAATACGTTGGGGCAGATTTTAATCAATGGGAAAATGTTATTTTATGGTTTATCACGTCTGTATACAGGGACTTTACATTATTGCAGTAGACACAAAATTGCCCAACTATACTATATAATACAATGCCAATAAACTTTCCTTTTCCATTAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAA
  5   1   2  SIG                                       Xt7.1-XZT5386.5                                                                                                                                                                                                              GCGCTCAGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTCATTAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008278818                                                                                                                                                                                                                    AGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTCATTAAAAAAAAA
  5   1   0       chi Gas7 5x3  in                         XZG36419.5p                                                                                                                                                                                                      CTATGGCGGCGCTCAGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGTACGGGATAACAGACAGTTCCGCGTTCTAATGGATCCAATTATCTGTCGCCCTTACTGGCTTATGGTTGGCTGCCCTTACCCTTGCTGGCTTATGGTTGGCTGCCCTTACCCTTGCTGGCTTATGGTTGGCTGCCCTTACCCTTGCTGGCTTATGGTTGGCTGCCCTTTCCCTTGCTGGTTTATGGTTGGCTGCCCTTTCCCTTGCTGGCTTATGGTTGGCTGCCCTTTCCCTGTTTGGCTGCCCTTTCTCTTGCTGGCTTATGGTTGGTTGCCCTTTCCCTTGCTGGCTTATGGGTGGCTGCCCTTTCCCTTGCTGGCTTATGGGTGGCTGCCCTTTCCCTGTTTGGCTGCCCTTTCTCTTGTGGTGGCTGCCCTTACCCTTCTGGGGAAAGAGCACTATAGGACTGGTGCTAATGCTGATATGTACATGT
  5   1   2       ext Brn4      in                        CAAL22394.5p                                                                                                                                                                                                            CGGCGCTCAGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGC
  5   1   2       ext Neu       in                   TNeu099o03.p1cSP6                                                                                                                                                                                                              GCGCTCAGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCAT
  5   1   3        nb Tbd1      in                        CBXT15819.b1                                                                                                                                                                                                                 CTCAGACACTTCCTGCGCTCTACTCAGACACAGCTGTACCCACAGATCAGCCTGGCATGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTCCATGTCACCATGATCCCTGGGGGATGGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCGGCTGATGTGC
  5   1   2       add Eye       in                         CCAX1381.b1                                                                                                                                                                                                                     CGCTCAGACACTTCCTGCGCTCTACTCAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATC
  5   1   4      seed Tad5      in                          XZT5386.5p                                                                                                                                                                                                                           TCCTGCGCTCTACTCAGAACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTCAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGAC
  5   1   3        nb Gas7      in                         XZG25378.5p                                                                                                                                                                                                                                       CTCAGACACAGCTGTACCCACAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTCCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGAC
  5   1   3        nb Gas8      in                          st61a18.5p                                                                                                                                                                                                                                                           CAGATCAGCCTGGCACGGCGCCCCCTATGCACCTCCCCCTTGGTACAGCAGGCTGAACCGGGCAAGTCAGATGGGGCTTTTCATGTCACCATGATCCCTGGGGATGGAGTGGGACCGGAGCTGATGCACTCGGTGAGAGAGGTGTTCAAGGCAGCTGATGTGCCGGTGGAGTTTGATGAGCACCATCTGAGCGAGGTGCAGAACATGGCCTCCAAGGAGAAGCTGGACGAGGTCCTGGCCTCCATGCAGGCAAATAAGGTGGCGATTAAAGGGAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACANTTTGACAC
  5   1   3        nb Hrt1      in                         CAAQ3473.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAGATCCACACCCCCATGGAGTATAAAGGGGAACTGGCGTCGTATGAAATGAGACTCCGGCGCAAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCANATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTA
  5   1   2       add Gas8      in                          st86e23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCAGCTGGACCTCTTTGCTAACGTGGTGCATGTGAACAGCCTCCCCGGCTACAAGACCCGGCACAACAATCTGGACCTGGTGATTATTCGGGAGCAGACGGAGGGAGAGTACAGCTCTCTGGAGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGG
  5   1   2       ext Tad5      in                         XZT47654.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCACGAGAGCGTCAGCGGAGTCATCGAGTGCCTTAAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGGTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTA
  5   1   3        nb Te3       in                         CAAM5265.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGTGCCTTCAAATCATAACCAGAGAGAAGTCCAACCGCATTGCCAAGTTTGCGTTTGATTATGCCACCAAGAAGGGCAGATCCAAGGTCACTGCTGTGCACAAAGCCAATATCATGAAGCTGGGAGATGGGCTGTTCCTGCAGTGCTGTAAGGAAGTGGCACAACTGTACCCCAAGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGTCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGGTTA
  3   1   3        nb Hrt1      in                         CAAQ3473.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATACAATTTGACACAATGATTATTGACAACTGCTGCATGCAGCTGGTGCAGAACCCATACCAGTTTGATGTGCTGGTCATGCCCAACCTGTATGGCAATATCATCGATAACCTGGCGGCTGGGCTGGTCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCG
  3   1   2       add Gas7 5x3  in                         XZG36419.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAATATCATCGATAACCTGCGGCTGGGCTGTCGGGGGCGCTGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTCATT
  3   1   3        nb Gas8      in                          st61a18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCGGGGGCGCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCTTTGGAGCATT
  3   1   4      seed Tad5      in                          XZT5386.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTGGGGTGGTGCCAGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTAT
  3   1   2       ext Tad5      in                         XZT47654.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGGGAGAGTTACAGTGCGGAATACGCCGTGTTTGAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTCATT
  3   1   3        nb Te3       in                         CAAM5265.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGACGGGTGCACGCCACCCTTTCGCACAAGCCGTGGGCAGGAATATCGCCAACCCGACTGCAATGTTACTTTCTGCAACAAACATGCTGCGCCACCTGAACCTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTC
  3   1   2       add Gas8      in                          st86e23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTACATACATTATCATTCAGTGTAACCGCTGCCCCGGCACATTGCTCCCCATTTTTCTTTTGCTGCTTCCCATCTCACTTTTCTTTTGGTTCATTTGGCTGTTTGTGTTCTCTCCTGTGCGGCTGCCCCTCAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCC
  3   1   2       ext Neu       in                    TNeu099o03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGACTGCAAATGTTACTTTCTGCAACAAACATGCTGCGCCCCACCTGAACCTNCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTCATTAAAAAAAAAAAAAAAAA
  3   1   2       add Eye       in                         CCAX1381.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTCGAGTATCACTCAAATCTCATCTCTGATGCTGTGAAAAAAGTCATTAAACAGGGAAAGGTGCGGACCCGAGATATGGGAGGTTATTCCACGACAACGGACTTCATCAAGGCTGTGATTGACGGCTTACACTATCGCCATTCCTACTAGTGCCCCCCTTGTGGCTGTTGTGCACTTTGCTTTGTGTCCCTTGTGGGGTCGTCGTCTCCCTGCCTTTCCCTGCGCGGTTTCTGTCTCAGCCTCCGTCTTACAGTGGGTTAGCCAGGCATATAAAGGGTTAATGGATACAGACCATCCTTGTGCCACCCCTGGGCCTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTTTACCCTGTAATACAGATTTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCTTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTCATTA
  3   1   3        nb HeRe                              EC2CAA4CA07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGATACAGACCATCCTTGTGCCACCCCTGGGCTTAGGGTAACCCATAAATTGGGTGGGTGCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTTAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCATTGGAGCATTTACACACACACTGCCCACCCCC
  3   1   2       ext Brn4      in                        CAAL22394.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCAGGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGGAGAGAACCTTCAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTCATTAAAGCTCTTTTGTTTATTTGTTTTTGTTGAGTTTTGCATTTTAGAAGCGCTGCCCCCTTTACATTCTATAATTCTTCTGCCAAACTCTAAACATTAATCCCCTCATCATAGGGCTGTTAGCCCGGAGTAACTCCCCTCAATTCTACCTTTCATCTGTCGGCCCAAGAGAAAGTGACAGATATGGGCTCACACCACCCCTAGGGCCCTTGTTTTGTGGAGGATACTGGGAGATGTACCAGTGAAATGGCAACCAGCACCTCCTCCACATCCCTCTCTACTCCTCTCTTGGTCATTTACTATGGGTATAAGTTGGCCAAGTAGAGCAGCAGCTCATTCCATGTAGTTGGCCAGTGCATTGACAAACTACCGGTTTGTGGGTCAAGTTATATCAAAATGCTTATGGCATACATAGCAATCTATATCGCTCCTTTAAAGAAACAATAACAACT
  3   1   3        nb HeRe                             EC2CAA19AF08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGATTCAGCAAGTTCTACCCTGTAATACAGATCTAAGAACTGGAAGAGAACCTTTAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTATACACACACACACACACACACACTGCCCACC
  3   1   3        nb HeRe                              EC2CAA3AG11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGATCTAAGAACTGGAAGAGAACCTTTAGCCGCTGCTCATTTCCTGTTACTGGGCGCCCTTGCCAGTCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGAACAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCAAAGGAGCATTTATCACACACACACACACACACACTGCCCACCCC
  3   1   3        nb Tbd1      in                        CBXT15819.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCATTTCCCTGTTACTGGGCCGCCCCTTGCCAGTCCGGCCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCATTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTCATTAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG25378.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTTACTGGGCGCCCTTGCCAGTCGGGCAATAAAACTGCTCTATAAGGGGCTCATTGCTCCACAAGCAGTCAGTCTGGGCCCAAGTGGTTCCGACTGTGGGAGCTCTAGCCTGGGCAAAGTATTGGGGCAGGTTGTGCCAGGCTGATGCCCAGCGTTGGAGCATTTACACACACACTGCCCACCCCCAGTGCCGCACAAATAAAAACCTTTATTTTTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)