Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZG23870.3                            8 END     1           1       12                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012071815 Xt7.1-THdA029e22.5 - 82 ESTs
                                                                       .......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-THdA029e22.5                            AGCCTCCTCCTCCTCTCTCTCTTCCTCCTCCTCCTGCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGACCAGGAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008223853                                  CTCCTCCTCTCTCTCTTCCTCCTCCTCCTGCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGACCAGGAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                10    12    13    14    13    14    14    14    15    16    15    16    16    17    23    23    32    33    33    38    36    40    36    41    41    44    42    46    42    46    42    46    43    47    43    47    43    47    43    47    43    47    40    47    44    47    44    47    43    48    45    48    46    49    46    49    46    49    46    49    46    49    45    48    45    49    45    49    45    49    45    49    46    49    47    49    47    50    46    49    47    49    47    50    46    49    46    50    46    48    46    48    46    49    47    50    50    52    50    53    51    52    50    54    51    54    52    56    49    55    53    56    53    57    53    58    51    59    50    59    49    58    46    58    48    57    47    57    43    53    42    52    40    50    39    50    39    50    34    48    33    48    32    46    32    44    35    43    36    41    34    41    35    40    32    38    31    38    34    38    32    35    32    33    32    33    32    33    31    34    28    33    31    32    31    32    29    32    26    32    28    32    28    32    28    32    27    32    26    32    26    32    26    32    26    31    26    31    26    31    25    31    26    31    23    30    22    30    23    30    22    28    20    26    21    26    19    26    17    23    15    20    14    20    13    19     3     8     4     5
                                                                   SNP                                                                                                                                                                                                                                                                                        -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----------AC
                                               BLH ATG     162     953                            
                                               BLH MIN     135     123                            
                                               BLH OVR     135    1173                            
                                               ORF LNG     135      74                            
                                                                       PROTEIN --- Cs ---- 1e-015     BAB68343.1 Cs-TTF1 [Ciona savignyi] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                    PREDICTED - Sp ---- 6e-025     XP_782745.1 PREDICTED: similar to distal-less homeobox gene 4a [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 4e-025     NP_497904.1 C.Elegans Homeobox (30.2 kD) (ceh-43) [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ci ---- 6e-032     BAE06378.1 transcription factor protein [Ciona intestinalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 2e-031     NP_523857.1 Distal-less CG3629-PA [Drosophila melanogaster] --------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                PROTEIN --- Bf ---- 2e-033     AAB36860.1 homeodomain protein [Branchiostoma floridae]  ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PROTEIN === Dr ==== 1e-106     NP_571381.1 distal-less homeobox gene 5a; distal-less homeobox gene 4 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PROTEIN === Gg ==== 1e-124     NP_989490.1 distal-less homeo box 5 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 2e-127     NP_005212.1 distal-less homeo box 5 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 5e-130     NP_034186.2 distal-less homeobox 5 isoform 1 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    
                                                                                                                                                                                                                                         PROTEIN === Xl ==== 4e-172     AAA02622.1 X-DLL3 [Xenopus laevis]  ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 1e-173     AAT72001.1 DLL3 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-THdA029e22.5                                                                                                                         TAG---------------------------------------ATG------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------ATG------TGA---------------------------------------------------------------------TAG------TAA---------------TAA
                                                                   ORF                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   1           Tbd0 FL                     IMAGE:5335570.FL-MGC                          CCAGCCTCCTCCTCCTCTCTCTCTTCCTCCTCCTCCTGCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGACCAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Neu  FL                     TNeu071c08.FL-Sanger                                                                                                                 CCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGACCAGGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5g3  in                   TGas088f24.p1kSP6              AGCAGTGTGCGCCCAGCCTCCTCCTCCTCTCTCTCTTCCTCCTCCTCCTGCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAG
  5   1   2       bld 1030 5g                         IMAGE:7029662.5p                GAGTGTGCGCCCAGCGTCCTCCTCCTCTCTCTCTTCCTCCTCCTCCTGCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGGTAAAAATATGGTTCCAGGAAATAAAGATCCNAGGATTAAGAAAATCNTGGAAAAAAGGGAAAGCTGCCTTCCC
  5   1   2       bld Gas1 5g3  in                       IMAGE:6989808                  CCGGGATCCCAGCCTCCTCCTCCTCTCTCTCTTCCTCCTCCTCTTTCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCTGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATANAAGATCCTAGATTNAGAGAATCATGAAGAACGGAGAGCTGCCATCAGAACACAGTCCCAGCT
  5   1   2       bld Tbd0 FL   ?                     IMAGE:5335570.y1                   CCGGGATCCAGCCTCCTCCTCCTCTCTCTCTTCCTCCTCCTCCTGCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTT
  5   1   2       bld Neu  5g3  in                   TNeu058e24.p1cSP6                    GTGCGCCCAGCCTCCTCCTCCTCTCTCTCTTCCTCCTCCTCCTGCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCG
  5   1   2       bld Gas  5g                        TGas007b22.p1kSP6                     TGCGCCCAGCCTCCTCCTCCTCTCTCTCTTCCTCCTCCTCCTGCTCAGAACACTAAGNAACCTTCCCAANCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCNAGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGGTAAATGGGACCCCTGGGTGGCAGAGATGATTTGACGGGGGGAGTTTACATGTGACGGGAGAACTGATGTATGTANGCAACTGGGGTTG
  5   1   2       bld HdA  5g                        THdA012p02.p1kSP6                     TGCGCCCAGCCTCCTCCTCCTCTCTCTCTTCCTCCTCCTCCTGCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAAACACAGCC
  5   1   2   22  bld Gas7 5g                              XZG31057.5p .......................GCCCAGCCTCCTCCTCCTCTCTCTCTTCCTCCTCCTCCTGCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAA
  5   1   2   12 seed Gas7 5g3  in                         XZG32190.5p ........................CGGACGCGTGGGCGGACGCGTGGGTTCCTCCTCCTCCTGCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAG
  5   1   2       bld Gas  5g                        TGas019h07.p1kSP6                           CAGCCTCCTCCTCCTCTCTCTCTTCCTCCTCCTCCTGCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGAC
  5   1   2       chi TbA  5x   in                   TTbA009m20.p1kSP6                           CAGCCTCCTCCTCCTCTCTCTCTTCCTCCTTCTCCTGCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAGGATCCTTGTATGTGAAAGAGAGGCCCCATGGCCCTCAGGCCTGTTCCACTCCCAGTATTCAGTGCTAATCTACTAAATTGTAGCACTACGCTACGTACGCATGTGTATTTGGGTATATGAACAAGCGATTGCGCTCGTTTTACAGCTACA
  5   1   2   14  bld Gas6 5g3  in                         ANBT1510.5p ...........................CGCCTCCTCCTCCTCTCTCTCTTCCTCCTCCTCCTGCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCANACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCNCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGT
  5   1   2       bld HdA  5g3  in                  THdA029e22.p1kaSP6                                     CTCCTCTCTCTCTTCCTCCTCCTCCTGCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTTCAGGTCACTCAGCCACCACCCCCATGTACATTCNCCACCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCT
  5   1   2       bld Neu0 5g                            IMAGE:6995041                                       CCTCTCTCTCTTCCTCCTCCTCCTGCTCAGATCACTAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGAACGCATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCANACACAGGTAAAAAATATGGTTCCCAGAATAAAAGATCCCAGGATTAAGAAAAATCATGAAAGAACGGGAGAAGCTGTCCTTCCAGAACAACAGGCCCCAGCCTCCCGGTGGACCCCCATGGGGCTGGGTAAATTTCTTCCCCCCAGGTCCTTCCCAGTTAAATGTGGGGGGAAAACCCC
  5   1   0       add Neu       in                   TNeu088i10.p1cSP6                                                     TGTCTGCACTGACCATAGTAACCGCAGAGCGAGCAAATGACAGGGCAGCCTTCCTGCGGGGCTTTCAACTCCTTCTTGTGCCACTTTGGGCTCTGTCTGGGCTGGGTCGCCCACACCCCATATACACTGAGCTCCGTCTGGTGCCAGGGTGCCCACTTCCTGTCTGTACAAGCACTGAGCACACTGACCGCAGTGCCTGGGAATCTGCTCTGATCGCGCAAGATTGCGCCCTAGCGCAGAGTAGAGATCCAGCCCCATAACACACCGATATTACTAACCGCAGGGGGCAGGGTGGGCAATCTCTTGTAAGGATAGTAATATTATATATGTAGCCACTAAATTATATGTATAGCCACTACAAATAGATGTGCACATTGGTACATGCGTGTTTGTGCGATTTAAAGTCGTAGAGGTTAGATTATTAGATACAAAAATAATGAAAATCCAGTCCAATGTTCCTGACATTAAGAGGTGGTGTTTTCCTTCCCTAGAAAAAGAAGTATCAAGCCCAGGTGAGAATGGTGAATGGGAAACCAAAAAAATCCGAAAGCCGCGCACCATCTACT
  5   1   2       bld Gas1 5g                            IMAGE:6986988                                                                   AAAGCACGGGGCNTGAGTACCGGGGTCCGGGAATTCCCTGGGATGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGGAACCNCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCAGGTACTTTCCAAC
  5   1   2       bld Gas  5g                        TGas083h08.p1kSP6                                                                          TAAGGAACCTTCCCAAGCTCTCACTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGC
  5   1   2   22  bld Gas7 5g                              XZG60514.5p ................................................................................................CTATTTCAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGGACCCCAAGGATCTTCAGGTCACTCAGCCACCACCCCCATGTACATT
  3   1   2       bld HeRe      in                     EC2CAA10CD07.b1                                                                                                      GGAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTACCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCTGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACA
  3   1   2       bld HeRe      in                     EC2CAA10CF11.b1                                                                                                      GGAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCTGAATCCACAGCCACTGGCTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCTGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTA
  5   1   2       bld HeRe      in                     EC2CAA10CD07.g1                                                                                                       GAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTACCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCTGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld HeRe      in                     EC2CAA10CF11.g1                                                                                                       GAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCTGAATCCACAGCCACTGGCTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCTGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAAA
  5   1   2       bld HeRe 5g3  in                     EC2CAA37BD08.g1                                                                                                       GAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCAGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCA
  5   1   2       bld 1030 5g                         IMAGE:7028689.5p                                                                                                       GAGTGCCAGTCCCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCCAGTAGTGTGGGGAACCCCCAGGAATCCTTCAAGGTCAACTCACC
  5   1   2       bld Neu  FL   in                   TNeu071c08.p1cSP6                                                                                                                  CCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAG
  5   1   2       bld Gas  5g                        TGas002c02.p1kSP6                                                                                                                  CCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAACGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATA
  5   1   2       bld HeRe 5g3  in                     EC2CAA25BF01.g1                                                                                                                  GCAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCTGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCTGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAG
  5   1   2       bld Gas8 5g3  in                          st44j06.5p                                                                                                                   CAGCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGT
  5   1   2       bld HdA  5g3  in                   THdA041f06.p1kSP6                                                                                                                     CGTAGCAGCAGCGTGGCCGCCTGAGCAGCTTCCCAGCGCCCCCGATGCACGCAGATCGCATTCCCCATAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCGCGAATCCACAGCCGCTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAGAGCCTATAGCGAGTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACGGCAGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCCGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAGACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCGAGATTAAGAAAATCATGAGGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCTCACCCCCAAGCCTCCGGCAGCTCCCCTGCATC
  5   1   2       bld Gas8 5g3  in                          st46c19.5p                                                                                                                     GCAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGT
  5   1   2       bld Gas8 5g3  in                          st27l06.5p                                                                                                                      CAGTAGCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAG
  5   1   2       bld HeRe      in                     EC2CAA43AG04.g1                                                                                                                           GCAGCAGCGTGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCTGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAGTGCTTATCGAGTA
  5   1   2       bld Gas8 5g3  in                         st104e07.5p                                                                                                                           GCAGCAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCNAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAA
  5   1   2       bld TpA  5g3  in                   TTpA052a01.p1kSP6                                                                                                                            CAGCAGCATGGCCGCCTGAGCAGCTTCCCATCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCATCCCCCCAGCAGTCAGCCAGAAAGAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCGAAGAAAATCCGAAAGCCTCGCGCCATCTACTCCAGTTTCCAGC
  5   1   2       bld Ski1                                 CABJ1774.5p                                                                                                                             TTCTTGTGCCACTTTGGGCTCTGTCTGGGCTGGGTCGCCCACACCCCATATACACTGAGCTCCGTCTGGTGCCAGGGTGCCCACTTCCTGTCTGTACAAGCACTGAGCACACTGACCGCAGTGCCTGGGAATCTGCTCTGATCGCGCAAGATTGCGCCCTAGCGCAGAGTAGAGATCCAGCCCCATAACACACCGATATTACTAACCGCAGGGGGCAGGGTGGGCAATCTCTTGTAAGGATAGTAATATTATATATGTAGCCACTAAATTATATGTATAGCCACTACAAATAGATGTGCACATTGGTACATGCGTGTTTGTGCGATTTAGAAGTCGTAGAGGTTAGATTATTAGATACAAAAATAATGAAAATCCAGTCCAATGTTCCTGACATTAAGAGGTGGTGTTTTCCTTCCCTAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCNTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGNGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGC
  5   1   2       bld Gas                            TGas004e07.p1kSP6                                                                                                                                CAGCATGGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAA
  5   1   2       bld Gas1 5g                            IMAGE:6987986                                                                                                                                     GGCCGCCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGATCCNCCAAGATCTTTCAGGTCACTCAGCAACCACCCCCATGTACATTCCCACCC
  5   1   2   10  bld Ovi1 5g3  in                         CABI5566.5p .......................................................................................................................................CATCGATTCGGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGC
  5   1   2       bld TbA  5g                        TTbA013d06.p1kSP6                                                                                                                                          CCTGAGCAGCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGC
  5   1   2       bld Tbd0 5g                            IMAGE:6980898                                                                                                                                                  GCTTCCCAGCGCCCCCAATGCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAGNGATCTCAGGTCACTCAGCACCACCCCATGTACATCCACC
  5   1   2       bld Gas1 5g3  in                       IMAGE:6990441                                                                                                                                                                CGGGATCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAGGATCTTCAGGTCACTCAGCCACACCCCATGTACATTCCACCCCCCAGCTCGGCAGCTCCCTGCATCCTCTATCTGGAGACTCAGCGTCTGTACCTACAGCACCACTGCAGACTGCGAACATGC
  5   1   2       bld Gas1 5x3  out                      IMAGE:6989649                                                                                                                                                                  GGATCAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGACCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCATGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCATGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCTGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGATCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGACGCGCTTCCAGAAGACACAATACTTAGCGCTGCCTGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACTCAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCTGGCGTGTATTCTCCCAGTCTCCAGTAGGTGGGACCCCATGATCTCTAGTACTCGCCACACCCAAGTATTCCCCCCAGCCTCGCACTCCGCTCTCTATTGAACCCTCTTGTACTCAGCCCCTGCGACTCAAAAGCTC
  5   1   2       bld HdA                            THdA051j02.p1kSP6                                                                                                                                                                      CAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGGCCTTGGCATCAGGGACTCTCTAC
  5   1   2       bld Gas7      in                         XZG21431.5p                                                                                                                                                                      CAGGCAGATCGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCGGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCACTACCCGTACCGTGGCATGAGTGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATCGCGATTATGGCTGTGGGAGCCCTTACCACCCTCCCCACGAGTAGAGCGG
  5   1   2       bld Neu0                               IMAGE:6993493                                                                                                                                                                               CGCAGTCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCCGGCAGCTCCCCCTGCATCCCTCCTAATCTGGGAGAAACTCCCAGGCGTCTGGGGTACCCC
  5   1   2       bld TbA                            TTbA029h16.p1kSP6                                                                                                                                                                                CAGTCCCCAGAGCATGACAGGAGTCTATTAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGATCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCGCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCATCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGAAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCT
  5   1   2       bld Tad5      in                         XZT36978.5p                                                                                                                                                                                                                        CGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAA
  3   1   2       bld HeRe      in                     EC2CAA43AG04.b1                                                                                                                                                                                                                                                                                                                            GGCTCAGGAGGGGCAGCTGGCCACCCACACCATGGTTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCTGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTA
  5   1   2       bld Ski1      in                        CABJ10815.5p                                                                                                                                                                                                                                                                                                                                                CCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAAGCTGTTGCATGTAACTTATTGCATTT
  5   1   2       chi Gas7      in                         XZG60375.5p                                                                                                                                                                                                                                                                                                                                                                                                                        CAAGCACTGAGCACACTGACCGCAGTGCCTGGGAATCTGCTCTGATCGCGCAAGATTGCGCCCTAGCGCAGAGTAGAGATCCAGCCCCATAACACACCGATATTACTAACCACAGGGGGCAGGGTGGGCAATCTCTTAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAA
  5   1   2       bld Neu                            TNeu139d17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGGCAAAGCCTATATCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTATCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTGAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTGATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTGACTCAGCCACCACCCCCATGTACATTCCCACCCCC
  3   1   2       bld Neu0                               IMAGE:6991393                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTACCCACCCTTCACCAACCAGTACAGGGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTGACATCTATGACATCATTTTTTTCCACGAGCTTCTTTTCCAACGTCTATTTTCACCACGTAAATACAATTCGATAGAGGCATTGTACTGTATACTCCTTAACAATAAAAAAAGAT
  3   1   2       bld Neu  FL   in                    TNeu071c08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCNAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGACCAGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas1 5g3  in                       IMAGE:6990441                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAGATGGTGAATGGAACCAAAAGAAAATCTGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCCATGTAAATACATGTAGATAGAGGAATTAAACTGTATTTCTGAAAANAGCCCTCCC
  3   1   2       bld Gas8 5g3  in                          st27l06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCAANGAAATCCGAAAGCCGCGCACCATNTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAAT
  3   1   2       bld Tad5      in                         XZT36978.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGACCAGG
  3   1   2       bld Ovi1 5g3  in                         CABI5566.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGACCAGG
  3   1   2       bld Gas1 5g3  in                       IMAGE:6989808                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCGCACCATATACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCCATGTAAATACCATGTAGATAGAGGAATTAAACTGTATATTCTGGAAAAACNGCCACATGTTNNN
  3   1   2       bld Gas  5g3  in                    TGas088f24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCATTCAGCCACCACCCNCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATTTGGAGAACTCCAGCGTTTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTTTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATTTCAATGGTGCCTTGAATTTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAAGAAAATTATTTCGACCAGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA  5g3  in                    TTpA052a01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATANCTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCCACCCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATTTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAAGACTTTTTTTTAAATGTTTATTTTAACCACTGTAAATACCATGTAGATAGAGGAGATTAAACTGTATATTTTCTGGATAAATAAAAAATTATTTCGACCCAGGAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA  5g3  in                   THdA029e22.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCNCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATTTGGAGAACTCCAGCGTTTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGACCAGGAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Gas8 5g3  in                         st104e07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTNTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATAAACG
  3   1   2       bld Gas8 5g3  in                          st44j06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATG
  3   1   2       bld Gas7 5g3  in                         XZG32190.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGGCCGGG
  3   1   2       bld Gas6 5g3  in                         ANBT1510.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGACCAGG
  3   1   2       bld Neu       in                    TNeu088i10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATTTGGAGAACTCCAGCGTTTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGGCCCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe 5g3  in                     EC2CAA25BF01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGA
  3   1   2       bld Ski1      in                        CABJ10815.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGGGATTTTTGGGGCTTACGCAAACCCAGGGAAAAAAAAGGTTCCCGGATAAAAGATCCCAGGTTTAGAAAATCCTGAAGAACGGGGGGGGGGCTCCAGAAAACAACCCCAGCTCCAGGGGCCCCAAGGGGGGGAATTTTCCCCCGTCCCCCGTAGGGGGGGGACCCCAAGGATTTTTAAGGTTAATTAGCCCCCCCCCCCCTGGAAATTTCCCCCCCCAGGCCTTCGGGAGGTTCCCTGCATCCTCCTTTTTGGGGAAATCCAGGGTTTGGGTCCCTACAGGCCCCCCCCCGCAGAACCTGGAGAACCAAGCCTTTTTTAAGCACCCCTTGGCCTTGGGATCAGGGGCTTTTTTTTAAAAAAAACCCGGGCCGCCCTTTTGTTTTTTTTTTGGGGTATCATTTTTTTCATTGGTAAGGGGGGATACAAAACAAAGCATAACAAGGGTTTTTTTAGGCAAAGAAAATTGGGTAAAACCTGTTGCAAGGAAATTATTGCCTTTCAAAGGGGGCCGGGGGTTTTTTTCAAAATGGCTTTGGGCAACCGGGGGCCCTATTTCAAAGGGGCCCTGAAATTAAGACCCCCTTTTTTTCCCGAGACTTTTTTTCAAAGTTTTTTTTTACCCAGGAAAAACA
  5   1   2       bld HeRe      in                     EC2CAA39CA04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGACCGAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG21431.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGACCAGG
  3   1   2       bld Gas7      in                         XZG60375.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATTTGGAGAACTCCAGCGTTTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTTTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGCCCAGG
  3   1   2       bld Neu  5g3  in                    TNeu058e24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGGGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATTTTCAAGGTCATTCAGCCACCACCCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGGTCCCCTGCATCCTCCTATTTGGAGAAATCCAGGGTTTGGTACCCTACAGGCACCCCCCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTTTTTATTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGAATATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGGGCAACTGGGGACACTATCTCAATGGTGCCTTGAATTTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAAAAAGGGTAGATAGAGGAATTAAACTGTATATTCTGGACTAGGGTAGGATTTCGNCCCGGGAAAAAAAAAAAAAGAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8 5g3  in                          st46c19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGAT
  3   1   0       add TbA  5x   in                   TTbA009m20.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGGTAGGATCCTTGTATGTGAAAGAGAGGCCCCATGGCCCTCAGGCCTGTTCCACTCCCAGTATTCAGTGCTAATCTACTAAATTGTAGCACTACGCTACGTACGCATGTGTATTTGGGTATATGAACAAGCGATTGCGCTCGTTTTACCAGCTACACGGTATAATGCGTATTCTTTGTCCCTGTCTGGGGAAGGCAATGGCGTGTAACCGAAATGTATTTATAAAAAATTAATACATATTTTTTTTAACTGATAAGTCGTTCTTTGTGCGGTCCCTTGTTCCTATGCCAAGTTATTATGCTAAATTGGAGGTGTGATTCAATGGTATGTGTGCATTATATTTATACGCACATAGATATTTATATTTTGTTGATAGGTAAAAATGCCTCTAAGATTTTATGAGATGGCTTAATGTGCGTCTTTTGCTCAATTTATGAAATGTATGTTATATATTTTTTATATATATATATATGGGGAATGCATAATAATATGGACGTTCTAAAAAAAAAGGGGCCGCGGAACCCGAAATCTTGGCCTTTATACAAACAATTTCAGAATTCCCTGTAATGGAGGTGCGTAAAAGGACGATGTGTGGCACAGTTTAATTCTCTATGCTTGAGACATAGGGGCGCATTGTGAACTAGTATTGCGGAATGTAGATAAGGGACTGGGAATTCTCAGTAACCCAAGTGCTGCAAAACTGCAAACCCTGGAGATTGTCTGGGTTTGCAGAGGTCTCTATATGTTCTGGGTTTAGGGAGAAAACGAAACGAAAATAAATTCGAGTAGATACGAAAATGACATTAGGAAATGTGCACAGAGAGGGGCCCCAGTGCTGTGCAGCCTTTGCTCTCAGTCAGTCCTAC
  3   1   2       bld Gas8      in                          st48f07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACTTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATAAA
  5   1   2       bld Gas8      in                          st48f07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACTTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGACCAGGAGA
  3   1   2       bld HdA  5g3  in                    THdA041f06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAATCAAAGGCCCCATACGCACATCTACCTAAAAGTTCTTTTGTAATGGATGCGTTTATGAGAAAATACTCTAATTAAGATACGTCAGTCGTCCATCACCCCCATGTCATTCCCACCCCCAGGCCTCCGGCAGGTCCCCTGCATCCTCCTATTTGGAGAACTCCAGGGTGTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAAATTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGGGCAACTGGGGACACTATTTCAATGGTGCCTTGAATGTATGACCTCATTTTTTTCCGGAGACTTTTTTTCAACGTTTATTTTAACCACGTAAATACATGTTGATAGCGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGAACCCGGAAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld HeRe 5g3  in                     EC2CAA37BD08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGA
  3   1   2       bld HeRe      in                     EC2CAA39CA04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGA
  5   1   2       bld Gas7      out                        XZG23870.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGACCAGGAGAAACAGATTTTTTTTTTTAACTGCAAAGATCAAGCCCAAATTAACTGCAATGCAGGTTTTGCTGTCTTTCTCCCTACAATAGAATTTGGGGTATATTGCTTCTCATCATATCTAATACAGATAACTGATGACATGACTAGGAACCTATATTAATCTAAGAATCTATATGGTGATAATCTTCATCATATTTAGGAAATGTAT
  3   1   2       bld Gas8      out                        st115g16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTNGGCATCAGGGACTCTGTANTAAAAGACACCCGGGCCGCCTTTTTGTNTTNTNTTTGGANTATCATNTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATANTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACANTATNTCAATGGTGCCTNGAATCCTATGACCTCATTTNTNTCCAGAGACTTTTTTT
  5   1   2       bld Neu                            TNeu032h16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTGGCATCAGGGACTCTCTACTAAAAGACACCCGGGCCGCCTTTTTGTCTTTTTTTTGGACTATCATTTTTTTCATTGTTAAGGAGTCATACAAAACAATGCATAACATGGATTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTCAATGTTTATTTTAACCATGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGACCAGGAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)