Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 480.0    0Xt7.1-CAAN6211.5.5                        179 PI      72        199     1644                Hypothetical protein mgc107771 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 97%

 1012071918 Xt7.1-XZG5405.3 - 151 ESTs
                                                                       -510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-XZG5405.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCCCTCACCGCAAAGCAAATATTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCAAGAAGCAGCTGGCAAAAGCAATTTGAAGAGAGTGACTCTCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATTGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTGAGGGAATACACAGAAGCAAAAACGGTGACTATAAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAACAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222300                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACCGCAAAGCAAATATTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCAAGAAGCAGCTGGCAAAAGCAATTTGAAGAGAGTGACTCTCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATTGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTGAGGGAATACACAGAAGCAAAAACGGTGACTATAAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAACAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    3     3     6     9    13    15    14    15    15    17    19    20    21    21    21    22    22    22    23    23    23    23    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    25    25    25    25    25    25    25    25    25    25    25    25    25    25    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    23    26    25    26    25    26    25    26    25    26    25    26    25    26    25    27    25    27    24    27    24    27    24    27    24    27    26    29    23    29    23    29    23    29    21    28    22    28    23    26    20    24    20    24    19    23    18    22    17    22    17    23    18    23    19    24    19    23    15    22    17    22    16    22    18    22    17    21    17    20    17    20    17    19    17    20    16    18    14    17    14    17    15    16    13    14    12    14    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    13    14    13    14    14    14    14    14    13    13    14    14    15    15    15    15    15    15    16    16    17    17    17    17    16    16    15    15    15    15    15    15    15    15    14    14    14    14    15    15    15    15    15    15    15    15    15    15    14    14    14    14    13    13    13    13    13    13    13    13    13    13    14    14    14    14    13    14    13    14    13    13    12    12    11    12    11    12    10    11    11    12    10    12    11    13    13    16    15    17    16    19    16    19    18    21    18    21    18    21    18    22    18    22    17    22    17    22    18    22    18    22    18    22    19    22    20    23    20    25    20    27    20    27    20    28    22    29    22    29    25    29    26    31    26    31    31    32    32    33    33    34    33    36    34    36    32    34    33    35    33    35    33    35    33    35    34    35    34    35    34    35    33    35    35    37    34    37    34    36    34    37    33    37    36    39    38    39    36    38    37    39    37    39    37    40    36    39    36    40    35    39    35    39    35    39    35    39    33    38    33    36    32    36    32    36    32    37    29    35    28    36    28    34    27    33    27    33    28    34    28    34    28    34    28    34    28    34    29    35    29    35    29    35    30    35    30    35    30    35    30    37    33    39    33    39    31    37    31    37    32    38    32    38    32    38    34    39    34    39    33    38    31    38    30    37    24    27    18    21    18    20    17    19    17    19    16    18    14    16    14    16    14    17    14    17    14    17    15    16    16    17    17    19    17    20    18    23    21    25    22    25    24    26    27    28    31    32    31    32    33    34    33    35    33    35    33    35    33    34    34    35    35    36    37    38    37    39    38    40    39    42    41    43    43    45    43    45    41    44    43    47    43    47    43    48    44    47    45    47    46    47    46    47    44    47    43    45    44    45    45    45    45    45    44    45    45    45    44    44    42    43    42    43    43    44    43    43    43    44    43    44    43    44    40    44    43    44    41    44    44    45    44    45    44    45    44    45    44    45    41    45    44    45    44    45    41    45    42    44    42    44    42    44    43    44    42    44    42    44    42    44    41    44    42    44    42    44    39    44    42    44    38    43    36    41    30    38    36    38     9    19    16    16
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAAAATACAGTTACATTCTGCTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GA----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -G-G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---------CA-
                                               BLH ATG      84    1940                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH MIN      84     324                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH MPR      63     324                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH OVR      84      36                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               CDS MIN      84      29                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               EST CLI      10      29                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               ORF LNG      84       7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Sc ---- 6e-133     NP_015019.1 Glucose repressed. Utilizes NADP+ or NAD+ as a coenzyme equally well. (sold bySIGMA under the catalogue number A5550, according to A. Blomberg).; Ald4p[Saccharomyces cerevisiae] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN -== Ce ==== 0          NP_498081.2 ALDH1J1, ALdehyde deHydrogenase (55.1 kD) (alh-1) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 0          NP_609285.1 CG3752-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 0          XP_786787.2 PREDICTED: similar to aldehyde dehydrogenase 1A2 isoform 2 [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Dr ==== 0          NP_571925.1 aldehyde dehydrogenase 1 family, member A2; retinaldehyde dehydrogenase 2 [Daniorerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Gg ==== 0          NP_990326.1 aldehyde dehydrogenase 1A2 [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Mm ==== 0          NP_033048.1 aldehyde dehydrogenase family 1, subfamily A2; retinaldehyde dehydrogenase 2;alcohol dehydrogenase family 1, subfamily A7; alcohol dehydrogenase family 1,subfamily A2; retinaldehyde dehydrogenase [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 0          NP_003879.2 aldehyde dehydrogenase 1A2 isoform 1; retinaldehyde dehydrogenase 2;retinaldehyde-specific dehydrogenase type 2 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 0          AAG32057.1 RALDH2 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === ?? ==== 0          NP_001084244.1 RALDH2 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 0          CAJ83838.1 aldehyde dehydrogenase 1 family, member A2 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-XZG5405.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAA---------------------------TAA------------------ATG------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------TAA---------------------------------TAA---------TGA---TAA---------------------------------TGA---ATG------------------------------------------------TAA---------------------------------------TGA---------TGA---------------------TGA---ATG---------------------TAG---------------------------TAA------------------------------------------TAA------------TAG------ATG------------------------------------------------TAG------ATG---------------------TGA------------------TAA---------------------------------------------------------TAA------------TAA---TAA---------------TAA---------TAA------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------TAA------------------------------TAA---------------TAG------------------------------------------------------------ATG---------------------------------ATG------------ATG---------------------TAG------------TAG---TAA------------------------------------------ATG------TGA------------------------TAA---------ATG---ATG------------------------------------------------------------------------TAG---TAA---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------TAA------TAA---------------------TAG------TGA------------TGA---------------ATG---------------------------------------------------------------TAG---------------------------------------------------------------------------TAA------------------------------------------------TAA------------------------------------------------------------------------------------TAATGA---------------TAA---------------------------TAG---------------------ATG------------------------------------TAG---------------------------TAA---------------------TAA---TAA------ATG---------------------------------------------ATGTGA---------------ATG---ATG---------------------------------------------------------------------------ATG------------TAA---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  0   1   1           Gas  FL                     TGas126e01.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCAAGAAGCAGCTGGCAAAAGCAATTTGAAGAGAGTGACTCTCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATTGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTGAGGGAATACACAGAAGCAAAAACGGTGACTATAAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATCTATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAACAAAAAAAAAAAAAAAAAA
  5   1   0       add Neu       in                   TNeu126a04.p1cSP6 GCGAAGTGTCTGTTTTTCTTTTCTAATTCTTTGCCCCGTTAAGAGAATGTATGTAATTAGGTTCTGGGATGCCTGCCTGCCTAATAAGCACAAAGCTTGCCCAACACTTCCCTCTTATTGTTCGGGTCCTTTTGGTTTTCCGCTGTAGTGCACACAACAGCAAGGTGCTAATTCGCCTTTAATTACTGCACGAATGGAAAACTTCTGGGAGGCTCCGACAAACTTTTAGGCAGTTGTGGGAGCTCGCAGCGAGCAGTCAGGGATTGCATTGCGCCCACATGGGGGCTGGCTGCTCGTCTCTAGAAGTTCCAGCCCGTCCCGGGGAATGTTAAAGAGAAATACCAACTCAAATGCCTCTATAGCTCCGCGTTATGTAAATACACGTTTGTAATTATATCATCGTAGGATGAACCGCCCCCCCTCCTCTCTCCCTATGTGCAATGAGAAGAGAGGCAGCTTGACACCTGCCTATATACAGGGAAAGGAGGAGAGGCTGGAGCATACTCATCTGTCCCTCACCGCAAAGCAAATAT
  5   1   2   10  bld Te1  5g3  in                        CBWN16495.b1 ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAGAGGCTGGAGCATACTCATCTGTCCCTCACCGCAAAGCAAATATTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATG
  5   1   2       bld Neu0 5g                            IMAGE:6993654                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGTCCCTCACCGCAAAGCAAATATTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGGGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGGCGTGGGAATACTGTAGGTAATTAAACCCCGCTTAACAGAACTCCGGCTCAATGCTTCTCTAACTTGGGGAGCCCCTTCATTCCAAGAAGGGTTGGCTTTTCCACCCAAGGAGGTTGGTTAAACCATTTGTTACCCAGGGAATATTGGGAACCATTCTTTGCTGGGGGCACAAGCAAATTTACGCCTTCCTTCCCGCAATTGGGAGAAATTTGTAATTAAAACGGTTGTCCCCTTTTGCACCCTGGGGGTAA
  5   1   2       bld Gas1 5g3  in                       IMAGE:6989771                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATCCCGCAAAGCAAATATTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCCTCATCAAGAGGCTGGCTTTNNCACANNGAGTGTNACATTTTNNACAGAATGGACATCTGCTGCACACAN
  5   1   2       bld Gas  5g                        TGas031l18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCACCGCAAACAAATTTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGT
  5   1   2       bld Gas  5g                        TGas043n06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCCGCAAACAAATTTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTANCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCT
  5   1   2       chi Gas  5g3  in                   TGas077g08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGCAAAGCAAATATTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGC
  5   1   2       bld Egg  5g3  in                   TEgg075c10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAAAGCAAATATTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCAGTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCC
  5   1   2   12  bld Gas7 5g3  in                         XZG55254.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAAAGCAAATATTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCA
  5   1   2   12  bld Gas7 5g3  in                          XZG5462.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCAAGCAATATTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTNGTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTTGATAAAGTGCATTCACTGGTTCTACTG
  5   1   2       bld Egg  5g                        TEgg121f16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCAAATATTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCT
  5   1   2       bld Egg  5g                        TEgg124e09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAATATTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTG
  5   1   2       bld Egg  5g                        TEgg132c12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAATATTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGT
  5   1   2       chi Ova1 PIPE out                        CABE7832.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAATATTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGAGGATAAAGAATTTCTTTTGAGCCCCATAAGAGAAGAAATCATCATTGTTATATTACCTATCAATAATTTATTTGTGAAAATATTAAAATGGTGTTTCATTTTACTTTTGACTGAATACTCATTACAACATTGCCAACTATAGAAATTGTTGATGTATGTCAAACTAGTAAACATTACTTCAACAGTATATAAATAGGCCCCTTGGTGGTATTTTCACACATTTTTTTGCTTTTTGGAGGTACTCCTCTGTATCTTTTAACACTTAAATTCTGAACATATAATATGCTTTTTATGGTTACAGGATATATAGCCCTGCCCCGCT
  5   1   2       bld Gas1 5g                            IMAGE:6988759                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATTCCCTGGGATGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGATACTGTAGTAATTAAACCGCTAACAGACTCCCTTACTGCTCCTACATGGGAACCTCATCAAGAAGCTGGCTTTCCCCAGGAGTTGTAACATTTTACCAGGATATGGACCATCTGCTGGACAGCAAAACTTTCTAAATTGGATTGA
  5   1   2   22  bld Gas7 5g                               XZG8238.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAATATTAGGTCAGTTTAAAGAGCCCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTTCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGNGAGCCCTCATCANAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCCAGAAGCAGCTGGCAAAAGCAAATT
  5   1   2   10  bld Fat1 5g3  in                         CABC5689.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCTAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCAAGAAGCAGCTGGCAAAAGCATTTTGAGAGAGTGACTCTCGAACTAGGA
  5   1   2       chi Tbd0                               IMAGE:6980083                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTAAAGGGAGAGAGAAGGGGAAATCCGCAGCGCATCCAGCCCTGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTATAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTATATAAAGCAGTGCCAGCTGCCATACTGGCCTTTTCATTGGGTTCTGCATGGAGGATAATGGATGCCTCTGAGAGGGGACCGCTGCTGGATAAATTATCTGATCTCATGGAAAGGGAGAGGACTACCCTTGTCACACTTGATTCTCTAAACAGCGGAAAACCTTTTCTCCTTACTTACTATGTGGATCTCCAAGGTGCTATCATAACATTCAGGTTCTATGCTGGCTGGGCTGACTAGATTCATGGTATGACTATCCCACAGATGGAGATTTCTTATCGTTCTCATCACTGTACCCTATTGGCGTGTGTGGTCTGTATCTTCCTTTGGAACTTCTCTCTGCAGATGGTTGCCGGAAAAATCCTCCTGCCCTCGGTTGATGTATTCTGTATTAATTAAACCCGTTGATATACTCGCCTCTTGCTCTTTCAGTCGGTACCCTCTCTAAGAGGGCTGCTTTCCCCAGGATTCTTAATTATTCCACGTTATAG
  5   1   2       bld Gas1 5g3  in                       IMAGE:6989970                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGGATGGATATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATNCAAGAGGCTGGCTTTCCACCANGAGGTGTTAACCATTTACCNAGATATGGACCATCTGCTGGCACGCAN
  5   1   2       bld Neu  5x3  in                   TNeu052b14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTACTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTG
  5   1   2   12  bld Gas7 PIPE in                         XZG35846.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGNTCTACTGANGNTGGCATGCTTATTCAAGAAGCAGCTGGCA
  5   1   2       bld TpA  5g3  in                   TTpA009i05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCAAG
  5   1   2       bld Gas  FL   in                   TGas126e01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAACTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCT
  5   1   2       bld Gas                            TGas001n08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGGGAAGTGAAGACANACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGGTAACCATTTTTGTCTGCTATATTCTGATACATGGAAACACAGTTATATTTTATATAGCACTGATCACGC
  5   1   2       bld Neu                            TNeu017g08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAA
  5   1   2       bld Gas       in                  TGas089j14.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGACTTCTGAGAGTGGAAGGACTTTTCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGGCTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATAT
  5   1   2       bld Gas                            TGas021c05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGATGTAGATAAAGCAGTGCAAGCTGCCAGACTGGCCTTTTCATTGGGTTCTGTATGGAGGAGAATGGATGCCTCTGAGAGGGGACGGCTGCTGGATAAATTAGCTGATCTCGTGGAAAGGGAGAGGACTACCCTTGCAACACTTGAATCTCTAAACAGCGGAAAACCTTTTCTCCAATCTTACTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGGTACTATGCTGGCTGGGCTGACAAGATTCATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTGATCAAAGAGGCTGGCTTTNCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTGCTGACATTGGAATTGATAAAGTTGCATTCACTGG
  5   1   2       chi Gas7      in                         XZG41949.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCTTCCGGTCCCTCACCGCAAAGCAAATATTAGGTCAGTTTAAAGAGCTCGCGGGGGAGAGAGAAGGGGATAATCCGCAGCGCATCCAGCCATGACTTCCAGTAAAATCGAGATGCCCGGGGAAGTGAAGACAGACCCAGCTGCCCTGATGGCTTCCCTGCAGCTCTTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACACCAAGATTTTTATAAACAATGAATGACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCAAGAAGCAGCTGGCAAAAGCAATTTGAAGAGAGTGACTCTCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGT
  5   1   2       bld Neu       in                   TNeu131l11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCAAGAAGCAGCTGGCAAAAGCAATTTGAAGAGAGTGACTCTCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACT
  5   1   2       bld Te1       in                         CBWN1137.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACTATCCCAGCAGATGGAGATTACTTAACGTTTACAAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCAAGAAGCAGCTGGCAAAAGCAATTTGAAGAGAGTGACTCTCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCA
  5   1   2       bld Gas7      in                         XZG44602.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCAAGAAGCAGCTGGCAAAAGCAATTTGAAGAGAGTGACTCTCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCANATCTTAAGGTTTAAAACTGTTGAGGAAAGTATTGAAAGAGCCAA
  5   1   2       bld Gas7      in                         XZG48765.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCAAGAAGCAGCTGGCAAAAGCAATTTGAAGAGAGTGACTCTCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCANATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGA
  5   1   2       bld Gas       in                   TGas068o11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCTGCCCTGTGCTGTGGGAATACTGTAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCAAGAAGCAGCTGGCAAAAGCAATTTGAAGAGAGTGACTCTCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGA
  5   1   2       bld Gas       in                   TGas062e01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAGTAATTAAACCCGCTGAACAGACTCCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCAAGAAGCAGCTGGCAAAAGCAATTTGAAGAGAGTGACTCTCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAA
  5   1   2       bld Gas       in                   TGas053o06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGCTCACTGCTCTCTACATGGGAGCCCTCATCAAAGAGGCTGGCTTTCCACCAGGAGTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCAAGAAGCAGCTGGCAAAAGCAATTTGAAGAGAGTGACTCTCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTG
  3   1   2       bld Neu  5x3  in                    TNeu052b14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTGTTAACATTTTACCAGGATATGGACCATCTGCTGGCACAGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCAAGAAGCAGCTGGCAAAAGCAATTTGAAGAGAGTGACTCTCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATTGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAAAAGTGGGAGAGTATGGACTGAGGGAATACACAGAACCCAGTAGGTGACTTAAAGATCCTCGANGAATCCTAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu075b14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCAATAGCTTCTCACATTGGAATTGATAAAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGCTTATTCAAGAAGCAGCTGGCAAAAGCAATTTGAAGAGAGTGACTCTCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCT
  5   1   2       bld Gas7      in                         XZG49144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTGGAATTGATCCAGTTGCATTCACTGGTTCTACTGAGGTTGGCATGGTTATTCAAGAAGCAGCTGGCAAAAGCAATTTGAAGAGAGTGACTCTCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATTGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTACAAAATGGTCTGGCAATGGAAAGAGAAATGGGGAGAGTATGGGACTGAGGG
  5   1   2       bld Gas       in                   TGas138h04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTATTCAAGAAGCAGCTGGCAAAAGCAATTTGAAGAGAGTGACTCTCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATTGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTAC
  5   1   2       bld Egg       in                   TEgg035d13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCGAACTAGGAGGAAAGAGCCCCAACATTATTTTTGCTGATGCAGATTTGGACTATGCAGTTGAGCAAGCCCATCAAGGTGTCTTCTTCAACCAAGGACAGTGCTGTACCGCTGGCTCACGGACATTCGTAGAAGATTCCATTTATGAGGAGTTTGTTCGGAGAAGTGTTGAACGTGCAAAGAGAAGAATAGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATTGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAG
  5   1   2       bld Gas                            TGas012a01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGAGTTTGTTCGGAGAATGTTGAACGTGCAAAGAGAAGAATGTTGGAAGCCCTTTTGATCCCACTACAGAGCAAGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATTGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTGAGGGAATACACAGAAGCAAAAACGGTGACTATAAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATCGAGACATGCATGGGGTTTAACTC
  5   1   2       bld Egg       in                   TEgg027f10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGCCCCCAGACTGATAAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATTGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTGAGGGAATACACAGAAGCAAAAACGGTGACTATACAGATCCCTCACAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGT
  5   1   2       bld Tad5      in                         XZT69062.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGAAGCAATACAACAAGATACTGGAACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATTGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTGAGGGAATACACAGAAGCAAAAACGGTGACTATAAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCANAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGT
  5   1   2       bld Gas7      in                         XZG10830.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACTTATTCAGAGTGGAATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATTGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTGAGGGAATACACAGAAGCAAAAACGGTGACTATAAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAANAAAAATACTGCATATGATTATACATTTGANATGTTTCTGTAGTTGAAAGCTGANATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTT
  5   1   2       bld Gas7                                  XZG9058.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAGCTGAAGGAGCTAAGCTGGAATGTGGTGGAAAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATTGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTGAGGGAATACACAGAAGCAAAAACGGTGACTATAAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGANATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAANGTAGGTATTTCGTTGTATTAATGTAGTTATGTATA
  5   1   2       bld Brn4      in                        CAAL18891.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGGACTGGGCAGAAAAGGGTTTTTCATAGAGCCAACAGTCTTCTCCAATGTAAGAGATGAAATGCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATTGTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTGAGGGAATACACAGAAGCAAAAACGGTGACTATAAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGGNCT
  5   1   2       bld Gas7      in                         XZG27573.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCGGATTGCCAGAGAAGAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATTGTTACAATGCTCTCAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTGAGGGAATACACAGAAGCAAAAACGGTGACTATAAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTAT
  5   1   2       bld Gas7      in                         XZG16761.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGATATTTGGGCCTGTTCAGCAAATCTTAAGGTTTAAAACTGTTGAGGAAGTTATTGAAAGAGCCAACAATTCTGATTATGGCCTTGTAGCAGCTGTTTTTACCAATGATATCAACAAAGCCCTGACTGTTTCTTCAGCAATGCAAGCTGGAACTGTTTGGATAAATTGTTACAATGCTCTCAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTGAGGGAATACACAGAAGCAAAAACGGTGACTATAAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACAT
  3   1   2       bld Neu       in                    TNeu126a04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCAATGCAAGCTGGAACTGTTTGGATAAATGTTTACAATGCTCTGAATGCTCAAAGCCCATTTGGAGGCTACAAAATGTCTGGCAATGGAAGAGAAATGGGAGAGTATGGACTGAGGGAATACACAGAAGCAAAAACGGTGACTATAAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTTGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG59595.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGAGGGAATACACAGAAGCAAAAACGGTGACTATAAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTT
  5   1   2       bld Neu0      in                       IMAGE:6991811                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGAATACACAGAAGCAAAAACGGTGACTATAAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTANTAAAACAGACTAGATAACTGAAGCAGACTTTTGGGTTTTTTTTTTTTTTCAATGTTTTACTTGTAATGGCTCATAAAATTTGAGAAGAAGTCCTGCTTTTAAAAGGGTCTTCATATTTTTAAGGAAATTTTATTTAGTTTTATAAAAAAAAAGTCATTAACCGTTTTTAC
  3   1   2       bld Gas7 5g3  in                         XZG55254.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTGACTATAAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTG
  5   1   2       bld Gas7      in                         XZG27017.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATAAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTCAAA
  5   1   2       bld Egg       in                   TEgg068h07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAGATCCCTCAGAAGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCT
  3   1   2       bld Gas7      in                         XZG47103.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACGCGTCCGGAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGAT
  3   1   2       bld Egg       in                    TEgg035d13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAAGAATCCTAAAAAAAGACAATGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG47103.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAATTCCTAAAAAAAGACAATTGCAAGAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTAANAAAAAAAAAAAAAGG
  5   1   2       chi Gas7      in                         XZG24158.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTAGGTGCTTGCCGATAGGAAATTAACAATGTAGGAGACAGTCCAGACTAATTACAATGGAGTTAAACCCATGCATGTCTCAATGCCCATTCAAGAGAACAGAGTTAATGCATGCTTAGGCTCAGGACTCTGTTTATTTGCATGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCCGGCCCTTCTTAGTATCATCTTTAAAA
  3   1   2       bld Gas7      in                         XZG10830.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAAGACATTTGCAAGAAAGTCCACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCACGGGTTTAACTCCATTGTAATTAGTCCGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTCGAAAAAAAATGCTGCATAGGATTATACATGTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATCGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTGCATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGCCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGACTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTCAGTATCATCTG
  5   1   2       bld Neu                            TNeu137a15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGTCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCAGTTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTGTCCTACATTGTTAATTTCCTATCGGCGAGGCACCTAGAAAAAAAATACTGCGTATGATTATACATTTGAAATGTTTCTGTGGGTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTGCCATATACTTTTTTCAAAACAGTAAGGTGGGAAATATATTGTGTTTAAAGTAGGTGTTTCGTTGTATTAATGTAGTTATGTATAATCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAAGCTTTTAATCTTTGCTGCGTCTGTGATTTAAGTTAAATACGTTAAGGCGAGAAAGCAAGATCTTTTAAAGCATATATTTTTA
  5   1   2       bld Neu                            TNeu094l18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGGGCAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTGGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTGGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTGATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTA
  5   1   2       bld Neu       out                  TNeu105k17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGTAACATGCAAATAAACAGAGTCCTGAGCCTAAGCATGCATTAACTCTGTTCTCTTGAATGGGCATTGAGACATGCATGGGTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTC
  3   1   2       bld Gas1 5g3  in                       IMAGE:6989970                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAATAGACAAGGGGGTTTATAATTTCCCCTTGGATAATTATGTTCTGGGAACTTTTTTCCCTAACAATTGTTAAATTTCCTTTTGGGCCAAGCCCCTTAGAAAAAAAAAATTCCGGCATTATGATTATACATTTGAAAAGGTTTCCTGTAGTTGAAAGGCTGAAAATATGGGAAGGATTCAAAAGGGGCAATTGTAAGGGTCCCCATATACTTTTTTCAAAACCAGTAAGGTAGGAAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAAGGTAGTTATGTATAGTCTGGAAATGGGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTTTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGGAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCCGGGGCGGAGGGGGGTGGGTGTTGGTTTGGTGGTTTTGTTTTTTTGTGTGTTTTTNTTTTTGTTTTTTCGTTTCTGGTTTGTGT
  5   1   2       bld Neu       in                   TNeu083i04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTAACTCCATTGTAATTAGTCTGGACTGTCTCCTACATTGTTAATTTCCTATCGGCAAGCACCTAGAAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTT
  5   1   2       bld Gas7      in                          XZG5405.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCGGCAAGCACCTAGAAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCNATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTT
  3   1   2       bld Egg       in                    TEgg068h07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTTTGCATGAGTTCTACATGGTACCGCTCATGAATTTTTTTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTTTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas138h04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAAAATACTGCATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTTGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCNTTGTTCTTTATAAATATTATTCATAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas089j14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAANGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTTGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTAATGAATATTATTCATGAAAATGTTAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas053o06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATATGATTATACATTTGAAATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG55188.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGTTTCTGTAGTTGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCACTATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTT
  3   1   2       bld Gas7      in                         XZG48765.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAAAGCTGAAATATGGGAAGATCCAAAGGGCAATTGTAGGCGTCCCATATACTTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTG
  3   1   2       bld Gas1 5g3  in                       IMAGE:6989771                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAATGTAGGCGTCCCATATACTTTTTCANAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTCTTAAA
  3   1   2       bld Tad5      in                         XZT69062.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGTAGGCGTCCCATATACTTTTTCAAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATG
  5   1   2       bld Gas7      in                         XZG58286.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTTTTTTCAAACAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTC
  3   1   2       bld Gas7 5g3  in                          XZG5462.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTAAGGTAGGAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAAAAAAAAAAAAAG
  5   1   2       bld Gas7      in                         XZG39812.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAATATATTGTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATAT
  3   1   2       bld Gas7      in                         XZG44602.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTATTTAAAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTG
  3   1   2       bld Te1       in                         CBWN1137.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGTAGGTATTTCGTTGTATTAATGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCCTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTATTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTAGAACTCCAAATGGAAACTTGTGCAGTGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG24158.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAAGTAGGTATTTCGTTGTATTAAGGTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTT
  5   1   2       bld Gas7      in                         XZG56457.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTAGTTATGTATAGTCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATG
  3   1   2       bld Gas7      in                         XZG56457.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTGGAATGTGTAGGTTGTGCTTGTATTACGTCCAGCTACACACAAGTCTCCACTTCTAGTTCTGCATGAGTTCTACATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCAGGAAAATGTTAAAAAAAAAAAAAAAGG
  3   1   2       bld Egg  5g3  in                    TEgg075c10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATGGTACCGCTCATGAATTCTTCTGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAAAAAAAGAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg027f10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGACATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTTTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTTTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG49144.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGTCTTTTAATCTTTGCTGCTTCTGTTATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTC
  3   1   2       bld Gas  5g3  in                    TGas077g08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTTAAGTTAAATACGTTAAGGCCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg007l16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATG
  3   1   2       bld Egg       in                    TEgg007l16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGAAAGCAAGATCTTTTAAAGCATATATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas       in                  TGas089i04.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTTTAAGTGTAATACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAAAAAAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAAAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCT
  5   1   2       bld Gas7      in                         XZG43465.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACAGATGGAGTTTTTAAATTGGTTTTTAATTGCAAGCATTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCA
  5   1   2       bld Tad5                                 XZT47724.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGACGCGTGGGTTAGTAGAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGANNaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2       bld Gas7      in                         XZG22432.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAAAAGCAGATGTTCTAAAAGCCTGTTTTTGATTAATTCATATGCTGTAAATTCCGCCCTGGCCTTCTTAGTATCATCTTTAAAACCCCTGGAACTTTATTTATTGCTTAATAAAACAGACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCCCCA
  3   1   2       bld Neu       in                    TNeu075b14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTAGATAACTGAAGCAGACTTTGGGGTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATGNAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTTAATATGTTGAACTCCAAATGNGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCTTGATGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG64275.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAGTTCTAGATCGCGGCGGCCGCCCTTTTTTTTTTTTTTTCAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATT
  5   1   2       bld Gas7                                 XZG44265.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGAAGCAGACTTTGGGGTTTTTTTTTTTTAAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTNGTAGCACACACAAGCTGAATTCCTACAGGAGC
  5   1   2       bld Gas7      in                         XZG26608.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTGGGGTTTTTTTTTTTTCAATGTTTACTTGTAATGGCTCATAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGTACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGC
  5   1   2       bld Gas                            TGas099o04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAAATTGAGAAGAGTCCTGCTTTAAAAGGGTCTCATATTTTAGGGAATTTTATTAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACCAAATACAGTTACATTCTGCTTGATGCAATACCACATAAAAAACCTA
  3   1   2       bld Brn4      in                        CAAL18891.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGTTTATAAGAAAAGTCATTACAGTTTTAAGGCACTACTACATTTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATT
  5   1   2       bld Tad5      in                         XZT10184.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTAATATGTTGAACTCCAAATGGAAACTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTNATAAAAT
  5   1   2       bld TpA       in                   TTpA070a03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTGTGCAGGGCTGGATGTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCAGCTTCCCACTTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATAT
  5   1   2       bld Gas0      in                         dad39h03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGGCCCGGGGTGTNTTCCTTATGCATGTTTACTCTTGCTTGCAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCAC
  5   1   2       bld Tbd1      out                        CBXT3559.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCAGTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTA
  5   1   2       bld Egg       in                   TEgg064i17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTACCTTATGCATGTTTACTCTTGCTTGTAGTGTATAGGGATTCTTATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCTTGATGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGGTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACA
  5   1   2       bld Gas7      in                         XZG14710.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTGTAGGCATAATTTGAGTCTCCTTGTATTGCGCTTCCCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGAC
  5   1   2       bld Te1       in                         CBWN5856.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCATTTTAACACTATATATGTATATATGAAATTACTCTTTTTCTTGTTCTTTATAAATATTATTCATGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGGGGGGGGGGGAA
  3   1   2       bld Gas7      in                         XZG16761.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCCTCCCCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTCCCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTGGCACACCCAAGCTGAATTCCTCCAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTCCCTGAATTCTC
  5   1   2       bld Gas                            TGas078b01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAATGTTTGAACTAGTTGTGAAGTGGTTCTTTCTAAAGTTTCTGTTGGGGGGGAAGGCTGTATCATTCAATTCTGAATAGCCTTAAAGGCTTACCTTAACATTGGGCCACATTGGTGGCATCACCAGGAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTA
  3   1   2       bld Neu0      in                       IMAGE:6991811                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTACCCTTAACATTGGGGCAACATGGGTGGCATTCACCAGAAAGGAACATTGCAAGCTTGAGATCCCTCAAACCAATATTTGGACACGACTGGACAAAATACAGTTACATTTTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATCTATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATAGAAATATTTCTAGAA
  5   1   2       bld Gas7      in                         XZG37266.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGGAACATTGCAAGCTTGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTA
  3   1   2       bld Gas                             TGas086i01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAGATCCCTCAAACCATTATTTGGACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACATTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATCTATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCGATGAAGTTTTTCCATTAAAATTTCATATAACAAAAAAAAAAAAAAAAAA
  5   1   2       bld Ovi1      in                         CABI9916.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATCGATTCGTTGGACACGACTGGACAAAATACAGTTACATTCTGCTTGATGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACACATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTAT
  5   1   2       bld Tad5      in                          XZT5876.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCATTATTTGGACCGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAATGT
  3   1   2       bld Gas       in                    TGas089i04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACACGACTGGACAAAATACAGTTACATTCTGCTTGATGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCGATGAAGTTTTTCCATTAAAATTTCATATAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas062e01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACACGACTGGACAAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATCTATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATTAAAAAAAAAAAAAAAAAAA
  3   1   2      seed Fat1 5g3  in                         CABC5689.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGACAAAAATACAGTTACATTCTGCTTGATGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAAC
  5   1   2       bld Gas7                                  XZG4401.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTTTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATG
  3   1   2       bld Gas                             TGas094d03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAATACAGTTACATTCTGCAATACAACATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTATAGAGGAAGTTTTTCCATTAAAATTTCATATAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG37266.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATAAAAAACCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATAT
  3   1   2       bld Gas7      in                          XZG5405.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATACCCC
  3   1   2       bld Gas7      in                         XZG58286.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATAT
  3   1   2       bld Ovi1      in                         CABI9916.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATAGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACACATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAC
  3   1   2       bld Gas7      in                         XZG27017.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATAT
  3   1   2       bld Tad5      in                          XZT5876.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATAT
  3   1   2       bld Gas7      in                         XZG27573.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAATGGATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATAT
  3   1   2       bld Gas7      in                         XZG39812.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATTATGATAAATATTTATCATGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATAT
  3   1   2       bld Gas7      in                         XZG43465.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATGGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAAC
  3   1   2       bld Neu       in                    TNeu131l11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGACAAGCCACTTCATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG41949.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATGCAGACATATGTATTTTACAGTACTGCACTAATATTCTTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAAC
  3   1   2       bld Gas7      in                         XZG64275.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGTACTGCACTAATATTCTTTATAAATCATCCCAGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATAT
  3   1   2       bld Gas7      in                         XZG46588.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGTCCGGTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACATATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAAC
  5   1   2       bld Gas7      in                         XZG46588.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTAAAAGGAATAACTATCAAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACATATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAACAAACAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas  FL   in                    TGas126e01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAAGTTAGATTCAATTAGCTTACNTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATCTATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te1  5g3  in                        CBWN16495.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAGTTAGATTCAATTAGCTTACCTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAACAAAAAAAAAAAAAAA
  3   1   2       bld TbA                             TTbA054m16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATTCAATTAGCTTACNTGATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTTTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATTAAACAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT10184.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATATAATTCTTTTTGATATGGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTACTTGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAA
  3   1   2       bld Gas7      in                         XZG14710.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATATAATTCCTTCTGATATGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATATGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATTAAAC
  3   1   2       bld Te1       in                         CBWN5856.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGCGTTACACCCATGTTTGCTAGGAACTTTCACACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTGGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAAGGACCATATGATTGGCTAACTGACATGGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATACGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATAAAATTGGATTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGGAAAAACCTCTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAACAAATTGCCATCCTAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                   TTpA070a03.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATAGGGCGTTACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTTTGCTGAAACTTGGTCTCTGTTTACCGGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGTTCTGCTGTAGGGAAAAAAATCTATAGGGGTTTTTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGGGTTTTTGTCATTCATGTGATGTTTAATGTAATGGGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTTTATGAAGTTTTTCCATTAAAATTTCATTTACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas7      in                         XZG26608.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACACCCATGTTTGCTAGGAACACTGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATAT
  3   1   2       bld Gas7      in                         XZG55188.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACACCCATGTTTGCTAGGAACACGGCATTCATCTTCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGCCCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATTTTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAAGGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGGGGTATTATAGGGGTGTTTTTGTCATTCATGGGATGTTTAATGTAAGGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGGGGTCCCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCAGGTATATCCATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTAGGAAGTTTTTCCATTAAAATTTCATATAACC
  5  -1   2       bld Egg                            TEgg103a17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATACCAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Neu                             TNeu060a01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTAGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATCTATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA  5g3  in                    TTpA009i05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAGATCATTTGTTATTTCCAATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCTTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGAAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAACGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAACAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg064i17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATTGGTGCCTTTTGTTAGCACACACAAGCTGAATTCTTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCTTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG22432.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTTGTTAGCACACACAAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGCCCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATTTTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAAGGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGGGGTATTATAGGGGGGTTTTTGTCATTCATGGGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGGGGTCCCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCAGGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTAGGAAGTTTTTCCATTAAAATTTCATATAACC
  3   1   2       bld Gas7      in                         XZG59595.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGCTGAATTCCTACAGGAGCTGATTAGATTTCTGCTGAAACTTGGTCTCTGTTTACCTGAATTCTATTAAAATAAAAAAAAAGGCCCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAAGGGTTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGGGGGTTTTTGTCATTCATGGGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTCCCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCAGGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAACC
  3   1   2       bld Gas7 PIPE in                         XZG35846.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATTAGATTTTTGCTGAAACTTGGTTTCTGTTTCCCTGAATTTTTTTAAAATAAAAAAAAGGGCCCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATTTTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTTTTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAAGGGTTTTGCTGTAGGGAAAAAAATATATAGGGGTTTTTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGGGGTATTATAGGGGGGTTTTTGTCATTCATGTGATGTTTAATGTAAGGGGAAAAAAACCCTTTAAATTTAAAAAATTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTCCCAGAATGTGACAAGCATTTACATACATGTGCAGGATTCCACGCAGTTTTAACAATTCATCAGGTATAAACATTTGTGTTTTAAATGTCAAGGGATATGAAATATTTTTTAGGAAGTTTTTCCATTAAAATTTCATTCCCC
  3   1   2       bld Neu       in                    TNeu083i04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTTACCTGAATTCTATTAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATATAACCAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas068o11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAAATAAAAAAAAAGGACCATATGATTGGCTAACTGACATAGTTGCTTCCTAAGGGCCTAGTCATATTAAAGGCAATATATATGGAACAGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGAAATATTTTCTATGAAGTTTTTCCATTAAAATTTCATTAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas0                                 dad41e03.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAGTTTTGTGGCTTCCTATTAAGGACAAGTTAAGATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTAGGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATAAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATTTACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGGAATATTTTCTATGAAGTT
  5   1   2       bld Egg                            TEgg120m11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTAACATTTTGTGGGATATAATGAAACTCTGTCTCAATATAATGGCTCTGCTGTACAGGAAAAAAATATATAGGCGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGCGTATTATAGGTGTGTTTTTGTCATTCATGTGATAGATTAATGGAATGATAAAAAAAACCTCTAAATATAAAAAACTATGAAGAGCCGTCGACTTGGCATGCTTGCTGTAAATGTTGAGGCACCAAAATGTGACAATCATTTACATACATGCGCATGATTCCACACAACTCTAACAATTCATCGTGTATATACATATGTGTTTTAGATGTCAAAGGATATGAAA
  3   1   2       bld Gas0      in                         dad39h03.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGGGGTTTCTCATCCCCTGTGCTATGAAATTGGGTTGTTTTTGCATACACATAGTGGTATTATAGGTGTGTTTTTGTCATTCATGTGATGTTTAATGTAATGAGAAAAAAAACCTCTAAATTTAAAAAACTATGAAAGCCGTGACTTGGCTTGTTTGCTGTAAATGTTGTGGTACCAGAATGTGACAAGCATAATACATACATGTGCATGATTCCACGCAGTTCTAACAATTCATCATGTATATACATTTGTGTTTTAAATGTCAAAGGATATGGGAATTTTTCTATGAAGTTTTCCCATAAAAATTTCCATATAACCAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)