Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-TTpA020g01.3                        291 END     2           1        0                hypothetical protein LOC549897 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 91%

 1012071928 Xt7.1-XZG61544.5 - 115 ESTs
                                                                       ........-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG61544.5                   TGTTCAATTAGTGTATGCGTTTAGTATTGCGAGAAGTAGCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTCTTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTGAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222863                         ATTAGTGTATGCGTTTAGTATTGCGAGAAGTAGCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTCTTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTGAAAAAAAAAAAAAAAAAAAAAAAAAG
                                                      consensus depths                        3     4     4     5     6     8    11    13    21    27    29    34    32    35    35    38    37    40    39    41    39    41    39    41    40    43    40    43    41    45    42    46    42    46    43    47    44    49    44    49    46    51    45    52    49    53    52    56    52    56    59    59    59    59    60    60    61    61    61    61    61    61    65    65    65    66    67    68    67    69    67    69    68    70    68    70    68    70    68    70    67    70    66    71    67    72    67    72    67    72    67    72    68    72    67    73    66    74    69    74    70    75    74    78    72    77    68    72    66    70    65    69    64    68    61    66    61    65    63    67    62    66    62    68    66    71    65    70    65    70    64    69    63    68    62    68    61    67    57    63    53    61    53    60    47    54    41    46    41    46    45    49    44    49    45    51    47    54    46    52    48    55    47    55    46    55    46    54    45    54    46    54    42    52    40    50    39    49    34    49    19    26    25    28    22    28    22    29    21    29    25    31    24    31    25    31    25    31    25    31    23    31    24    31    23    31    24    31    24    31    24    31    24    31    25    31    27    32    26    32    28    33    28    33    28    33    29    33    30    34    29    34    28    34    29    34    29    34    29    34    27    32    28    34    27    34    22    23    16    22    15    22    15    22    15    22    15    22    14    22    15    22    15    22    15    22    15    22    14    21    14    21    13    21    13    21    12    21    12    21     7    14     5     6
                                                                   VAR                                                                                                                                                                                                                                           AGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGTG
                                                                   SNP                                                                                                                                                                                                                                                                                                       ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------C-C---
                                               BLH ATG      46     429                   
                                               BLH MIN      22      96                   
                                               BLH MPR      22      96                   
                                               BLH OVR      46      70                   
                                               EST CLI      36      36                   
                                               ORF LNG      46       5                   
                                                                                                                                                               PROTEIN --- Ce ---- 1e-014     NP_001021034.1 SMN (human Survival Motor Neuron gene) homolog family member (smn-1) [Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                          PROTEIN === Dm ==== 2e-017     NP_524112.1 survival motor neuron CG16725-PA [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                             PREDICTED = Sp ==== 2e-040     XP_781229.2 PREDICTED: similar to survival motor neuron protein [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                  PROTEIN === Hs ==== 5e-079     NP_000335.1 survival of motor neuron 1, telomeric isoform d; gemin 1 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                     PROTEIN --- Mm ---- 6e-080     NP_035550.1 survival motor neuron [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                    PROTEIN -== Dr ==== 2e-083     NP_571266.1 survival motor neuron [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PROTEIN === Gg ==== 2e-095     NP_989530.1 survival motor neuron [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                               PREDICTED = Xl ==== 8e-160     AAH45073.1 Unknown (protein for IMAGE:5542088) [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                       PROTEIN === Xt ==== 2e-170     AAI35222.1 Unknown (protein for MGC:121935) [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                       PROTEIN === ?? ==== 2e-170     NP_001093710.1 survival of motor neuron 2, centromeric [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG61544.5                                                                 ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------ATG---------------ATG---------------------------------------------ATG---------------------------------TAATAG---------------------------------TAG---------------------TGA---------------------------------------------------TAG---------------------------------------TGAATG---------------------------------------------------------ATG---------------TGA---TGA---------------TAA---------------------------------------------------TGA------------------------------------ATG------------TAA------------------------TAA------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------TAA---------TAA---TAG
                                                                   ORF                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  0   1   1           Tad5 FL                          XZT19119.FL-MGC                AAGTGTTCAATTAGTGTATGCGTTTAGTATTGCGAGAAGTAGCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAA
  5   1   1         - 1030 5g                         IMAGE:7027393.5p GAATACGGAAGCCTTAAGTGTTCAATTAGTGTATGCGTTTAGTATTGCGAGAAGTAGCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGGCAGGAGCTAAATGGAAATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGGAGATACCAAAGTCCTCCCAGTGGGAAGGGCCAGTTCCCTCCCGGTTCCCTCCTCCATTTAAGCCTGGGTTTTGGAAGGCACGGTGGAAAATTTGGAATAAGCCGCATCCTTTCCTCTCTGGGCTGGCCCCCACCATTTCTACCTGGGACCACCTATGGATTCCTTCAAACCTCCTCTCAAAGAACCCCTAAATGCCTTGTTGAAAATG
  5   1   1   10    - Te1  5g3  in                        CBWN14714.b1 ......GGAAGCCTTAAGTGTTCAATTAGTGTATGCGTTTAGTATTGCGAGAAGTAGCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCTCTCCATTTATGCCTGGGTTTGGAA
  5   1   1         - In66                            IMAGE:8964541.5p             ATTTTATTTTTTCACTTTTTATATATAATATAAAAAAAATCGTGTGTCTTGGCTGGCTTCGGAGGACAGTTTTTTTTAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGCAGTATGCTGATCGCTTGTACATGAGTGATATCCACACCTGCTTACTATCTGGGCCTAAGCAGGGCGAATGAATCTCCCTTGGAAAATCTCCTTCACCAGAAGTATAGGAACGTCACAGGCGTGTCGGTTTAACATAGAGCTCTCATGTTTTCTCGCGCATATTGA
  5   1   1         - Tad5 FL   in                         XZT19119.5p                AAGTGTTCAATTAGTGTATGCGTTTAGTATTGCGAGAAGTAGCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGNGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGG
  5   1   1   30    - Te1  5x3  out                       CBWN11678.b1 ........................ATTAGTGTATGCGTTTAGTATTGCGAGAAGTAGCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGT
  5   1   1         - TpA  5g                        TTpA037p08.p1kSP6                                    CGTTTAGTATTGCGAGAAGTAGCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATC
  5   1   1         - Thy1      in                        CBST4781.fwd                                      TTTAGTATTGCGAGAAGTAGCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGC
  5   1   1         - HdA  5g3  in                   THdA044n24.p1kSP6                                           ATTGCGAGAAGTAGCGTGTCTATGGCAGGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGNGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGNGCTAAAGCAACGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACC
  5   1   1         - TpA  5g                        TTpA034o16.p1kSP6                                              TGCGAGAAGTAGCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGNGCTAANGCAAGGGCGAATGGAATCTT
  5   1   1         - Egg       in                   TEgg036o17.p1kSP6                                                CGAGAAGTAGCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTCATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAG
  5   1   1         - Egg  5g                        TEgg133o21.p1kSP6                                                CGAGAAGTAGCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTCATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGC
  5   1   1   10    - Tail 5g3  in                         CBSW9337.b1 ...............................................TGAGAAGTAGCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGG
  5   1   1         - HdA  5g3  in                  THdA016m23.p1kaSP6                                                       TAGCGTGTCTATGGCAAGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGAGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAATCTC
  5   1   1   12    - Gas7 5g3  in                          XZG3860.5p .......................................................AGCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGTAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGNGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTT
  5   1   1   12    - Gas7 5g3  in                         XZG43112.5p .......................................................AGCGTGTCTATGCCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCT
  5   1   1         - Egg  5g                        TEgg100d13.p1kSP6                                                         GCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACGGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGG
  5   1   1         - Egg  5g3  in                   TEgg004i15.p1kSP6                                                          AATCCCCGGGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCC
  5   1   1         - AbdN 5g                            IMAGE:7006291                                                          CGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGGATTGGAATCTTTCCTTTGGAAAATCTCCC
  5   1   1         - Neu  5g                        TNeu046l24.p1kSP6                                                          CGTGTCTATGGCAGGCTCGNGAGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGGGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGC
  5   1   1         - Gas  5x3  out                  TGas124a21.p1cSP6                                                           GTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCT
  5   1   1         - Gas8 5g3  in                         st107e16.5p                                                            TGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGC
  5   1   1         - Gas8 5g3  in                         st108e16.5p                                                             GTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGNAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAA
  5   1   1         - Egg  5g                        TEgg092n01.p1kSP6                                                              TCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCCTGTTCCTCCTCCATTTATGCCTGGG
  5   1   1   12    - Gas7 5g3  in                         XZG61544.5p ..............................................................CTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCC
  5   1   1         - Egg0                                 dad67e12.y1                                                                 CCCGGGGCTCGGNGGACAGTGGGGAAGTGCTGTTCAGACGTGGCAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATATAATCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTC
  5   1   1         - HdA  5g                        THdA005p10.p1kSP6                                                                 ATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCT
  5   1   1         - Tad5      in                         XZT45429.5p                                                                  ATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGNGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATC
  5   1   1         - Gas7      in                         XZG53043.5p                                                                    GCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGNGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCCTTTG
  5   1   1         - Egg       in                   TEgg065k07.p1kSP6                                                                     CAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCT
  5   1   1         - Gas7      in                         XZG29363.5p                                                                     CAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACC
  5   1   1         - Gas7      in                         XZG62827.5p                                                                     CAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCG
  5   1   1         - TpA       in                   TTpA068d08.p1kSP6                                                                           CCCGGGGCAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGNGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTC
  5   1   1         - Neu       in                   TNeu054f16.p1cSP6                                                                              AGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGCAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGC
  5   1   1         - Gas                            TGas047a24.p1kSP6                                                                               GACAGTGGGGAAGTGCTGTTCANACGTGGAGCCGGGCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAAGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAGAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCANAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTG
  5   1   1         - Brn4      in                         CAAL8158.5p                                                                                       GGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGNGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTTGGAAAATCTC
  5   1   1         - TpA       in                   TTpA078e10.p1kSP6                                                                                               CTGTTCAGACGTGGAGCCGGCCAGAGTGATTACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAAGCAGGGCGAATGGAATCT
  3  -1   1         - Hrt1      in                         CAAQ6830.3p                                                                                                   TCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACTCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCT
  5   1   1         - Ova1      in                        CABE10971.5p                                                                                                    CAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCTGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCA
  5   1   1         - Gas7      in                         XZG52401.5p                                                                                                         GTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCT
  5   1   1         - Ski1      in                          CABJ807.5p                                                                                                          TGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGNGCTAAAGCAAGGGCGAATGGAATCTTCCTT
  5   1   1         - Gas7      in                         XZG48930.5p                                                                                                                               CTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAGGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATG
  3   1   1         - Egg       ?                     TEgg016b22.q1kT7                                                                                                                                                             TTAAAGCATATGATAAAGCAGTGTCTTCTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGCCCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATGTGTTACTTTAGCA
  3   1   1         - Egg       in                    TEgg065k07.q1kT7                                                                                                                                                             TAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGAAGGCACTGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTA
  5   1   1         - Tad5 5x                              XZT45390.5p                                                                                                                                                                                      AGCGTGTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTGTAAGTCCTTTTTATGTTACAAATGTATATATAGTGCACTGGCTTACATACATTATCAAAaaacctgttatccagaaagttctgtattacgggaaggccatttcccatagactgcattttaatcaaattcaattataaatttaattcacatttttaaaaatggtttcctttttctctgtaataataaaacagtacctttatacttgatcccaaatatagataattaatccttattggagacaaaacaatccttttaggtttaattaatgtttaaTTTTT
  5   1   1         - Neu0 5g                            IMAGE:6996129                                                                                                                                                                                           GTCTATGGCAGGCTCGGAGGACAGTGGGGAAGTGCTGTTCAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGGTGTCGGGTGTTTTACATAGAAAGCTCCCCATGTTTTCTGCGCTATGAAAGAAAACCACCTTCTGGGNACATATGAAAACCCATTTCTGGAAAAGTTAACTGTTCAACCCATCCTAGGCTTTTG
  5   1   1         - Egg       in                   TEgg061n01.p1kSP6                                                                                                                                                                                                      TGAAAAATGGGGATTGTACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACT
  3   1   1         - Egg       in                    TEgg061n01.q1kT7                                                                                                                                                                                                                      TACAGTTAGTGCAGAAGCAGAAGAAAAAATTCCCAGGACCAAAAGGAAAAATAATAAGAAGAATAGAGCCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATGTTACTTA
  5   1   1         - Ovi1      in                         CABI9706.5p                                                                                                                                                                                                                                  CAGACGTGGAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGANACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATC
  5   1   1         - HeRe      in                     EC2CAA39BA09.g1                                                                                                                                                                                                                                          GAGCCGGCCAGAGTGATGACTCTGATATCTGGGACGATACAGCTCTCATTAAAGCATATGATAAAGCAGTGTCTTCTTTTAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCCCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCTTCTCTGGCTGGCCCCCACCATTTCTACCTGGA
  3   1   1         - Ova1      in                        CABE10971.3p                                                                                                                                                                                                                                                               AAAGGAAAAATAATAAGAGGAATAGAAGCAGGAAGAAGTGTAATGCTGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCCAATATTGTTACTTTAGC
  3   1   1         - Tad5 FL   in                         XZT19119.3p                                                                                                                                                                                                                                                               AAAGAAAAAATATTAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAAGG
  5   1   1         - Egg                            TEgg052i20.p1kSP6                                                                                                                                                                                                                                                                    AAAAATAATAAGAAGAATAGAAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCA
  3   1   1         - Ovi1      out                        CABI4342.3p                                                                                                                                                                                                                                                                                        AAGCAGGAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTAG
  3   1   1         - Egg       in                    TEgg036o17.q1kT7                                                                                                                                                                                                                                                                                              GAAGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTA
  3   1   1         - HdA  5g3  in                    THdA044n24.q1kT7                                                                                                                                                                                                                                                                                                AGAAGTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTAGCAAAAAAAAAAAAAAAAAAGCG
  3   1   1         - Ski1      in                          CABJ807.3p                                                                                                                                                                                                                                                                                                    GTGTAATGCCGCTCCACTGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTACTTAGC
  3   1   1         - Gas7 5g3  in                          XZG3860.3p                                                                                                                                                                                                                                                                                                                     TGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGTAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATGTTACTTAGCAAAAAAAAAAAAAAAGG
  3   1   1         - Gas7      in                         XZG48930.3p                                                                                                                                                                                                                                                                                                                     TGAAAAAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTT
  3   1   1         - Gas8 5g3  in                         st107e16.3p                                                                                                                                                                                                                                                                                                                          AAGTGGAGAGTAGGCGACACGTGTAATGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATGCTCCAAAAAT
  3   1   1         - Thy1      in                        CBST4781.rev                                                                                                                                                                                                                                                                                                                                                    TGCCATTTGGTCGGAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGC
  3   1   1         - Gas7 5g3  in                         XZG61544.3p                                                                                                                                                                                                                                                                                                                                                                 GAAGATGGAAATATTTACCCAGCAACCATCTCTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGC
  3   1   1         - Tail 5g3  in                         CBSW9337.g1                                                                                                                                                                                                                                                                                                                                                                                                CTTCAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAA
  3   1   1         - Neu       in                    TNeu054f16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                   CAATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATAAGGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCCAGTTGTGGGTGTGTGATATTAGGCAATATTGTTACTTA
  3   1   1         - Gas7 5g3  in                         XZG43112.3p                                                                                                                                                                                                                                                                                                                                                                                                    AATTGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCCCAAGAAAAAAAAAAGG
  3   1   1         - Egg                             TEgg030k01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                       TGATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAAAAAAGCGAACTAGGTCGACGC
  3   1   1         - Gas8 5g3  in                         st108e16.3p                                                                                                                                                                                                                                                                                                                                                                                                        GATGCTAAAAAAGGGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTCCAAAAA
  5   1   1         - Neu       in                   TNeu093h11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                     GGACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAA
  3   1   1         - Neu       in                    TNeu093h11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                      GACATGTATAGTTGTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACT
  3   1   1         - Te1  5g3  in                        CBWN14714.g1                                                                                                                                                                                                                                                                                                                                                                                                                                     GTATACAGCGGATATGGGAACAGTGAGGAACAAAGTTTGGCTGACTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAA
  3   1   1         - Egg  5g3  in                    TEgg004i15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAAAGTTTGGCTGACCTGCGCTTTCCAGATACTTCTGAAGCAGAAAGTGACCAGAGGGAGCAAGGGCAGGAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAATAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAAAAA
  5   1   1         - TpA                            TTpA034p01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGCAGGAGCTAATTGGAGATCGAGCATTCATCAGATGAAAGTGATATATCCTCTCGATCGCCTCAATGCACAGATTCTCATAACCGGGAGATACCAAAGTCCTCGCAGCTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGCTCGGAAAGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCT
  3   1   1         - Egg0                                 dad56d01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCTAAATGGAGATGAGCATTCAACAGATGAAAGTGATAGATCCTCAAGATCGCCTCAATGCAAAGATTCTCAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCGTCCAAAAATGAATGTGTGATATTAAACAATATTGTTACTTTAG
  3   1   1         - HeRe      in                     EC2CAA39BA09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGATTCGTAAAAACCGGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCTTTTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGTTCCAAAAATGAATGTGTGATATTAG
  5   1   1         - Hrt1      in                         CAAQ6830.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAACCGCGGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACAATATTGCCTAATATCACACATACATTTTTGGAAATACTC
  3   1   1         - TpA       in                   TTpA068d08.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGAGATACCAAAGTCCTCGCAGTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATAGGCAATATGTTACTTAGCAAAAAAAAAAAAAAAAAA
  5   1   1         - Gas7      in                         XZG22258.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAAGTTTCTTCTC
  5   1   1         - Egg       in                   TEgg037c11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGC
  3   1   1         - Egg       in                    TEgg037c11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGAATGGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCGCATCCTTTCCTCTCTGGCTGGCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTA
  5   1   1         - Gas7      in                         XZG38465.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCCAGTTCCCTCCTGTTCCTCCTCCATTTATGCCTGGGTTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGAT
  3   1   1         - HdA  5g3  in                   THdA016m23.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTGGAAGGCACGGTGAGAAGTTGGATCAAGCACATCCTTTCCTCTCTGGCTGGCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTTTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTTTCTAAAAAAAAAAAAAAAAGCG
  3   1   1         - Ovi1      in                         CABI9706.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCCCCACCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGCTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTACACAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCC
  3   1   1         - Gas7      in                         XZG38465.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCCCCATCATTTCTACCTGGACCACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAAAAAAAGG
  3   1   1         - Gas7      in                         XZG62827.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCTATGATTCCTCCACCTCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAAAAAAGG
  5   1   1         - Tad5                                 XZT33783.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGACGCGTGGGTTTTTTTTTTGCTAAAGTAACAATATTGCCTAATATCACACATTCATTTTTGGAAGCAATCTAAATCATTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGATGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCAGAAAGGAACTGTCCCCATCTAGCTTGGGGTTATATCCAATGAATTAGATTGCTTCCAAAAATGGATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAATGCGCCCC
  3   1   1         - Gas7      in                         XZG53043.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAAAAAAAGG
  3   1   1         - Brn4      in                         CAAL8158.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGCTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTACACAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCT
  3   1   1         - Gas7      in                         XZG29363.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCAATGAGCCCTGATGCTTGTGAAGATGATGAGGCATTGGGCAGTATGCTGATCGCTTGGTACATGAGTGGATATCACACTGGCTACTATCTGGGGCTAAAGCAAGGGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGCTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTACACAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAAAAAAGG
  5   1   1         - TpA       in                   TTpA045d06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACACATTTGTTTGTGGCAGACTGTTGCTGTANCAGCCTTCTTATCGACCGCCTTGATGACTCCTACAGCAACAGTCTGCCTCATGTCACGGACAGCAAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCT
  3   1   1         - Lun1      out                       CABD14390.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCGAATGGAATCTTCCTTTGGAAAATCTCCTCACCAGAAGTAATAGGAAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGCTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTACACAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTATTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTG
  3   1   1         - TpA       in                    TTpA045d06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAGCAAAACGTCCAACAGCCGGTGTCAGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTGGTTATTCTAAAAAAAAAAAAAAAAAG
  3   1   1         - Hrt1      in                         CAAQ7561.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGCTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTACACAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTATTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTG
  5   1   1         - Hrt1      in                         CAAQ7561.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACGTCCAACAGCCGGTGTCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGCTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTACACAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTATTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTGAAAAAAAAAAAAAAAAAA
  3   1   1         - Tad5      in                         XZT70434.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACGCGTCCGCATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGCTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTACACAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCT
  3   1   1         - Tad5      in                         XZT45429.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCGGGTGTTTACATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGCTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTACACAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTAGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTATTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTG
  5   1   1         - Tad5      in                         XZT70434.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGCTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTACACAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAAAAAAAAGG
  3   1   1         - Gas7      in                         XZG52401.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATAGAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTCTTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTGAAAAAAAAAAAAAAAGG
  3   1   1         - Egg                             TEgg036k03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGCTCCATGTTTCTGCGCTATGAAGAAACCACTTCTGGACATATGAAACCATTTTGAAAGTAACTGTCCCCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCCCAAAATGAATACCCGCGTCAGGTTAAGTATTAAATAATCATTTCCTAGCGAAGAACACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATATGAAATTCAGGGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTTTCTCTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTACCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTCATTTTTTATTCTAATAGCTTATGTGAGAGGGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGAATAAATATACAGCTTTATTTGTAAGTTAAACAATAAAGTAATTTTAGGTGAAAAAAAAAAAAAAAAAAAA
  5   1   1         - Egg                            TEgg124k17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGCTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTACACAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTATTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAA
  5   1   1         - Tbd1      in                        CBXT15847.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTCTTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTAAAAAAAAAAAAAAA
  3   1   1         - Tbd1      in                        CBXT15847.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAAACCACTTCTGGACATATGAAACCATTCTGAAAGTAACTGTCACCATCTAGCTTTGTGTTATATCCAATGATTTAGATTGCTTCCAAAAATGAATGTGTGATATTAGGCAATATTGTTACTTTAGCAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTCTTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTAAAAAAAAAAAAAAA
  3   1   1         - TpA       in                   TTpA078e10.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTCTTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTGAAAAAAAAAAAAAAAAAAAA
  3   1   1         - TbA  5g3  out                   TTbA071n12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGGCAATATTGTTACTTTTGCAAAAAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGGTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTTTGATTTGGTGATTTGTATTTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTTTTTTTTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGAGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTTTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAAGCCTTTTGTGTTCTTTTTCTATTTTAATAGCTTATGTGAAATTGAAAGAAAGCCTTTTTTTTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTGAAAAAAAAAAAAAA
  3   1   1         - Tad5      in                         XZT70586.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACGCGTCCGAAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGCTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTACACAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTATTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTG
  3   1   1         - TbA  5g3  out                   TTbA071l14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAAAAAAAAAAAGCATCCAGTTTATATGCGTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGGGTGAACTAATCATTTCCTAGCGAAGAGCACAGAATAAGGTTTCAGATTGTGATTGGGGGATTTGGATCTGAAATTCAGGGGGTTTATAAGGTATTGTATTCAGTAAAGAGGGAAACAGGCATTTAAGAGTTAATTTGTTAGGAAACGTTTATCACTGAATTTACTAGGGAATATCACTAGTTTTTTTTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTACGTAGGCACAGTATTTAACAACAAAAGGGTAAACAATGTGGCCGAAGTATTCAGATCCTTAATAAGGGCTGGGCAGGTAGTTTGGTTATTTTAAAAAAAAAA
  5   1   1         - Tad5      in                         XZT70586.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGCTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTACACAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTATTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTGAAAAAAAAAAAAAAAAAAAAAAAGG
  5  -1   1         - Egg                            TEgg088f22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAAAAAGCATCCAGTTTATATGCCTGTTTCAAGGTGCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGCTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTACACAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTATTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTGAAAAAAAAAAAAAAAAAA
  5   1   1         - Gas                            TGas051g03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTTATTATGCCTGTTTCAAGGTGCCTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTCTTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTGAAAAAAAAAAAAAAAAAAAAAAAAAGCGGCCG
  5   1   1         - Gas                            TGas111a12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGAAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGTGGTTTTATAATGTATTGTATTCAGTAAAGAGGGAAACAGGCACTTAAGAGTTAATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTGGTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTCTTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTG
  3   1   1         - Gas7      in                         XZG22258.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAATGAATACCCGCATCATGTTAAGTATTAACTAATCATTTCCTAGCGAAGAGCACAGAATATGGTTTCAGATTCTGATCTGGTGATTTGTATCTGAAATTCAGGGGTTTTATAATGTATTGTTTTCCGTAAAGAGGGAAACAGGCCCTTAAGAGTTAATTTGTTATGAAATGTTTATCCCTGAATTTACTAGGGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTTTGTAGGCCCAGTTTTCACCAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTCTTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTGGGGGAAAAAAAAAGGT
  5   1   1         - Gas7                                 XZG25543.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTTGTTATGAAATGTTTATCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTA
  5  -1   1         - Gas7                                 XZG60473.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCACTGAATTTACTAGTGAATATCACTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTCTTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTGAAAAAAAAAAAAAAAGGGCGGCCCTCGCGATCTAGAACTGCCCACGCGTCCG
  5   1   1         - Tad5                                 XZT48556.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTAGTTTCTTCTCTTCCCTTGTGCCAGTTTGGAAGCAGGATTACTGTTTATGTAGGCACAGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTAGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTATTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGAAGaaaaaaaaaaaaaaaaaaaaaaaaaaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5  -1   1         - TbA                            TTbA060n16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCCAGTTTGGAAGCAGGATTTCTGTTTATGTAGGCACCGTATTCAACAACAAAAGGGTAAACAATGTGGCAGAACTATACAGATCCTTAATAACGGCTTGTCAGTTACTTTGGTTATTTTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTCTTTTTCTATTTTAATAGCTTATGTGAGATTGAAAGGAGCCTTTTTTTTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTGAAAANNNNNNAAAAAAAAAAAAAAAAAAAG
  5   1   1         - Gas                            TGas071k20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTATTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTG
  5   1   1         - Gas                            TGas071o12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTAATAACGGCTTGTCAGTTACTTTGGTTATTCTAAAAAAAAAAATAGTTTCCCTTGGTTGGTTTATATAACCAGCCCCAGCAATTAGCAGCAGGCCTTTTGTGTTATTTTTCTATTCTAATAGCTTATGTGAGATTGAAAGGAGCCTCTTTTCTGTTTCCAACACAAGTAAAATTTCTGTTTATTTTGATAAATATACAGCTTTTTTTTGTAAGTTAAACAATAAAGTAATTTTAGGTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)