Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-XZT5097.5                            71 END     1           1        1                (no blast hit)
     2   2.0    0Xt7.1-CAAK11984.5                           4 END     2           2       50                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012072042 Xt7.1-CAAN4346.3.5 - 79 ESTs
                                                                       .......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAN4346.3.5                                                                                                                                                                                  AGCAGCGGGCAGGAGCAGCACAAAGAGCAGCACTTCACACTGCACCACACAGGGCAGCGCACACTGGATCCCAGGCACTAGGCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGACAGCAGTATATGATGGTTTGAGAAGTGGTTATACAGTGGGCTCCCATGAGGGTCGGCCCCAGACCCTACCAATGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAGTTCGGCATCAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGACGATGACTTTAAACAGCAAGATAGAGAGTTGAAGGAAAGTGCACCATTTGCAGTCATTGGCAGCAACACTGTTGTAGAGGCCAAAGGCCAGAGGGTGAGAGGTCGTCTGTACCCATGGGGCATTGTTGAAGTGGAGAATCAGGCACATTGTGACTTTGTGAAGCTAAGGAACATGCTAATTCGGACACACATGCATGACCTGAAAGATGTCACTTGTGATGTACACTATGAGAACTACCGAGCCCAGTGCATCCAGCAGATGACAAGGAATGAAGAAAGACACAACACTGCATCAAGCAAATTGACTCAAGATAATAGGATAGAAAGTCCAATACCCATCCTGCCACTGCCAACCCCAGATGCTGAGACAGAAAAACTGATTAAAATGAAAGATGAGGAGTTGCGACGGATGCAGGAAATGTTGCAGAAAATGCAGCAGCAAATACAGGAACAGTGAATATCCTGTCAGAACGGCACTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAAAAAAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTGTTTCTTCCACTGTCTCTGACCCTAATGCAGAAAGAGGGATATTTCTTGGAGAAAGGATTCCAAATCAGTTTTCTACCAACTCCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGACTCAGGACTTCCTTTTTTATTTGTATTATTTTATTTGTATTATTATTTTTCTGTATCGATGTTTACTCAGCAGGTGACTGACTAATTATAGCAGAACCCAGAAAGGTGGTAGTTCTTTCCAAAGGAGTGAGGGTTGCACATTGCTGCCATTTATTTTTGTTTTTTAAAAGCAGGCCCAAGTATCGCACACAAAAACACATGCTTTAGACCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATGGCTATTTAAGAAAAATCCAATGTTTACACCAAAACCAAGTCAGGATTTTCTTATCTTTATCCTTATCTGATCAGAAGTTGCTGATAAATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGCCGTGATTGTACTGAAACTCAATAAAAGAAGCAGACAAATCATAGTCCAGTAGGGTAACGTCAAGTGCAAGTGACAAGCTATGCCCTGTGTTAGTTTAATAACCAGTTCAAAGACGTCACCTAGAGTCTCTCTTTTATCCGTAAGGATGCTGGGCAGCTCAAACTGTCTTGCTAACTATTGCTTGTGTGTCTAGCAGCCTAATACTGACCTTGAGTTATATCATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGAGGAAACTGAAGTAACAGGAAGAAAACCCCCACAAATAGGAGAAGAATATACCTACTCCTTGCTGAGAGTGCCCTGACTGTAATTCAACCTTGAAGCCTCAGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTTTTCTGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGCAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCTCAGTTTAATCAGGGAAGGACACAATCCCAGTTTTTTATTTCTGTTCTTTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGCAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008223962                                                                                                                                                                                        GGGCAGGAGCAGCACAAAGAGCAGCACTTCACACTGCACCACACAGGGCAGCGCACACTGGATCCCAGGCACTAGGCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGACAGCAGTATATGATGGTTTGAGAAGTGGTTATACAGTGGGCTCCCATGAGGGTCGGCCCCAGACCCTACCAATGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAGTTCGGCATCAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGACGATGACTTTAAACAGCAAGATAGAGAGTTGAAGGAAAGTGCACCATTTGCAGTCATTGGCAGCAACACTGTTGTAGAGGCCAAAGGCCAGAGGGTGAGAGGTCGTCTGTACCCATGGGGCATTGTTGAAGTGGAGAATCAGGCACATTGTGACTTTGTGAAGCTAAGGAACATGCTAATTCGGACACACATGCATGACCTGAAAGATGTCACTTGTGATGTACACTATGAGAACTACCGAGCCCAGTGCATCCAGCAGATGACAAGGAATGAAGAAAGACACAACACTGCATCAAGCAAATTGACTCAAGATAATAGGATAGAAAGTCCAATACCCATCCTGCCACTGCCAACCCCAGATGCTGAGACAGAAAAACTGATTAAAATGAAAGATGAGGAGTTGCGACGGATGCAGGAAATGTTGCAGAAAATGCAGCAGCAAATACAGGAACAGTGAATATCCTGTCAGAACGGCACTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAAAAAAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTGTTTCTTCCACTGTCTCTGACCCTAATGCAGAAAGAGGGATATTTCTTGGAGAAAGGATTCCAAATCAGTTTTCTACCAACTCCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGACTCAGGACTTCCTTTTTTATTTGTATTATTTTATTTGTATTATTATTTTTCTGTATCGATGTTTACTCAGCAGGTGACTGACTAATTATAGCAGAACCCAGAAAGGTGGTAGTTCTTTCCAAAGGAGTGAGGGTTGCACATTGCTGCCATTTATTTTTGTTTTTTAAAAGCAGGCCCAAGTATCGCACACAAAAACACATGCTTTAGACCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATGGCTATTTAAGAAAAATCCAATGTTTACACCAAAACCAAGTCAGGATTTTCTTATCTTTATCCTTATCTGATCAGAAGTTGCTGATAAATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGCCGTGATTGTACTGAAACTCAATAAAAGAAGCAGACAAATCATAGTCCAGTAGGGTAACGTCAAGTGCAAGTGACAAGCTATGCCCTGTGTTAGTTTAATAACCAGTTCAAAGACGTCACCTAGAGTCTCTCTTTTATCCGTAAGGATGCTGGGCAGCTCAAACTGTCTTGCTAACTATTGCTTGTGTGTCTAGCAGCCTAATACTGACCTTGAGTTATATCATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGAGGAAACTGAAGTAACAGGAAGAAAACCCCCACAAATAGGAGAAGAATATACCTACTCCTTGCTGAGAGTGCCCTGACTGTAATTCAACCTTGAAGCCTCAGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTTTTCTGxxxAxTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGCAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCTCAGTTTAATCAGGGAAGGACACAATCCCAGTTTTTTATTTCTGTTCTTTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGCAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                       2     4     6     8     6     8     6     8     6     8     6     8     6     8     6     9     6     9     6     9     6     9     6     9     6     9     6    10     6    10     6    10     6    10     6    10    10    10    10    10    10    11    10    11    10    11    10    11    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    12    13    11    13    11    13    11    13    11    13    11    13    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    11    12    12    11    11    11    11    11    11    11    11    11    11    10    11    11    11    11    12     9    11     8    11    10    11    10    11     9    10     8     9     7     8     6     7     7     8     7     8     6     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     7     5     7     5     7     5     7     3     5     2     4     2     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     6     6     6     6     6     6     6     7     6     7     6     7     6     7     6     8     6     8     6     8     6     9     7     9     7     9     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     7     6     7     6     7     6     7     6     7     7     8     7     8     7     8     7     8     7     8     6     7     6     7     6     7     6     7     6     7     7     8     7     8     7     8     7     8     6     8     6     8     6     9     6    10     7     9     7     9     7     9     7     9     8     9     8     9     8     9     8     9     8     9     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     7     7     7     7     7     7     6     7     6     7     6     7     6     7     7     8     7     8     6     6     6     6     6     6     6     6     6     6     6     7     6     7     6     7     6     7     6     7     6     7     7     8     7     8     8     9     9    10     9    10     9    10     8     9     8     9     8     9     8     9     8     9     8     9     6     7     7     8     7     8     7     8     7     8     4     8     4     8     4     9     4     9     4     9     3     8     3     8     3     8     3     8     3     8     3     8     3     8     4     9     4     9     4     9     4     9     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     4     9     4     8     6     8     6     8     6     8     6     8     8     8     6     8     6     8     6     8     6     8     6     8     7     9     7     9     8     9     8     9     8     9    10    11    10    12    12    15    13    15    18    21    19    23    23    27    22    27    25    29    24    29    25    29    26    31    28    33    28    34    29    34    30    35    29    35    30    35    30    35    30    35    30    35    31    36    30    36    29    35    30    35    29    36    31    36    31    36    30    36    32    37    31    37    32    37    32    37    32    37    31    38    32    37    32    38    32    37    32    37    32    37    32    37    33    38    33    38    33    38    32    38    33    38    33    38    31    37    32    38    33    38    31    38    32    38    33    38    33    38    32    38    32    38    33    38    32    38    33    38    33    38    33    38    32    38    32    38    30    38    30    38    30    38    29    37    28    36    27    34    26    32    24    30     6     9
  5   1   2  SIG                                      Xt7.1-CAAN4346.3                                                                                                                                                                                     AGCGGGCAGGAGCAGCACAAAGAGCAGCACTTCACACTGCACCACACAGGGCAGCGCACACTGGATCCCAGGCACTAGGCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGACAGCAGTATATGATGGTTTGAGAAGTGGTTATACAGTGGGCTCCCATGAGGGTCGGCCCCAGACCCTACCAATGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAGTTCGGCATCAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGACGATGACTTTAAACAGCAAGATAGAGAGTTGAAGGAAAGTGCACCATTTGCAGTCATTGGCAGCAACACTGTTGTAGAGGCCAAAGGCCAGAGGGTGAGAGGTCGTCTGTACCCATGGGGCATTGTTGAAGTGGAGAATCAGGCACATTGTGACTTTGTGAAGCTAAGGAACATGCTAATTCGGACACACATGCATGACCTGAAAGATGTCACTTGTGATGTACACTATGAGAACTACCGAGCCCAGTGCATCCAGCAGATGACAAGGAATGAAGAAAGACACAACACTGCATCAAGCAAATTGACTCAAGATAATAGGATAGAAAGTCCAATACCCATCCTGCCACTGCCAACCCCAGATGCTGAGACAGAAAAACTGATTAAAATGAAAGATGAGGAGTTGCGACGGATGCAGGAAATGTTGCAGAAAATGCAGCAGCAAATACAGGAACAGTGAATATCCTGTCAGAACGGCACTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAAAAAAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTGTTTCTTCCACTGTCTCTGACCCTAATGCAGAAAGAGGGATATTTCTTGGAGAAAGGATTCCAAATCAGTTTTCTACCAACTCCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGACTCAGGACTTCCTTTTTTATTTGTATTATTTTATTTGTATTATTATTTTTCTGTATCGATGTTTACTCAGCAGGTGACTGACTAATTATAGCAGAACCCAGAAAGGTGGTAGTTCTTTCCAAAGGAGTGAGGGTTGCACATTGCTGCCATTTATTTTTGTTTTTTAAAAGCAGGCCCAAGTATCGCACACAAAAACACATGCTTTAGACCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATGGCTATTTAAGAAAAATCCAATGTTTACACCAAAACCAAGTCAGGATTTTCTTATCTTTATCCTTATCTGATCAGAAGTTGCTGATAAATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGCCGTTATTGTACTGAAACTCAATAAAAGAAGCAGACAAATCATAGTCCAGTAGGGTAACGTCAAGTGCAAGTGACAAGCTATGCCCTGTGTTAGTTTAATAACCAGTTCAAAGACGTCACCTAGAGTCTCTCTTTTATCCGTAAGGATGCTGGGCAGCTCAAACTGTCTTGCTAACTATTGCTTGTGTGTCTAGCAGCCTAATACTGACCTTGAGTTATATCATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGAGGAAACTGAAGTAACAGGAAGAAAACCCCCACAAATAGGAGAAGAATATACCTACTTGCTGAGAGTGCCCTGACTGTATTTCAACCTTGGAGCCTCTGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTGAGTGGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGCAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCTCAGTTTAATCAGGGAAGGACACAATCCCAGTTTTTTATTTCTGTTCTTTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGCAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAN7990.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATTAATGTGCATTGCTTTACCGTTTAGGATCTGCTTTTATTCCATTGCAACTCCATTTACTGACTTTGCTCTCTTTGTCTCACAGCAAATTGACTCAAGATAATAGGATAGAAAGTCCAATACCCATCCTGCCACTGCCAACCCCAGATGCTGAGACAGAAAAACTGATTAAAATGAAAGATGAGGAGTTGCGACGGATGCAGGAAATGTTGCAGAAAATGCAGCAGCAAATACAGGAACAGTGAATATCCTGTCAGAACGGCACTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAAAAAAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTGTTTCTTCCACTGTCTCTGACCCTAATGCAGAAAGAGGGATATTTCTTGGAGAAAGGATTCCAAATCAGTTTTCTACCAACTCCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGA------------------------------------------------------------------------------------------------------------------------------------------------CCCGGGGATGTGTTTTTGTGTGCGAATACTTGGGCCTGGCTTTTAAAAAACACATGGCTTTAGACCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATGGCTATTTAAGAAAAATCCAATGTTTACACCAAAACCAAGTCAGGATTTTCTTATCTTTATCCTTATCTGATCAGAAGTTGCTGATAAATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGCCGTGATTGTACTGAAACTCAATAAAAGAAGCAGACAAATCATAGTCCAGTAGGGTAACGTCAAGTGCAAGTGACAAGCTATGCCCTGTGTTAGTTTAATAACCAGTTCAAAGACGTCACCTAGAGTCTCTCTTTTATCCGTAAGGATGCTGGGCAGCTCAAACTGTCTTGCTAACTATTGCTTGTGTGTCTAGCAGCCTAATACTGACCTTGAGTTATATCATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGAGGAAACTGAAGTAACAGGAAGAAAACCCCCACAAATAGGAGAAGAATATACCTACTCCTTGCTGAGAGTGCCCTGACTGTAATTCAACCTTGAAGCCTCAGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTTTTCTGTTGAGTGGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGTAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCTCAGTTTAATCAGGGAAGGACACAATCCCAGTTTTTTATTTCTGTTCTTTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAAGAACTGACATTCCCAGGCATTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                              GCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGCTGAGAGTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCAACCTTGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTGAGTGGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTGAGTGGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGTAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCTCAGTTTAATCAGGGAAGGACACAATC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAAC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----A------
                                               BLH ATG      86     870                                                                                                                                                                                  
                                               BLH MIN      86     244                                                                                                                                                                                  
                                                                                                                                                                                                             PROTEIN --- Sc ---- 1e-068     NP_013418.1 Involved in proper bud growth; Cdc3p [Saccharomyces cerevisiae] ----------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Ce ==== 1e-081     NP_493388.1 UNCoordinated locomotion UNC-59, septin (52.9 kD) (unc-59) [Caenorhabditiselegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 1e-120     XP_788114.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 4e-132     NP_728003.1 CG9699-PA [Drosophila melanogaster] -----------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                              PROTEIN === Gg ==== 2e-142     NP_001025825.1 septin 5 [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 0          NP_956282.1 Unknown (protein for MGC:73218) [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 0          NP_002679.2 peanut-like 1; septin HCDCREL-1 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 0          NP_998779.1 Sept5; cell division control related protein 1; peanut-like 1 homolog(Drosophila) [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 0          AAH80406.1 Sept1 protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                              PROTEIN === ?? ==== 0          NP_001090512.1 septin 1 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 0          AAI36172.1 Unknown (protein for MGC:122834) [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAN4346.3.5                                                                                                                                                                                                                                                                        ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------ATG---------ATG---------------------TGA------------------------------------------------------------TAA------------------------------------------------------------TAA------------------------------------------TAATGA------------------------------ATG------------------------TAA------------------------------------------------------TAA---TAA---------------------------------------------TGA---------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------ATG---TAG---------ATG---------ATG---------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------TGA------TGA---------------------------TAG---------------------------------------------------TAATAA---------------------------------------TAA------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------TGA------TGA---------------------------------------------------------------------------------TGA------------------------------------------TAG---------------------------------------------------------------------------------TAG---------------------------------------------------------------------------TAG---------ATG------------------------------------------------------TAG---------------------ATG------------------------TAA---TAAATG---------------------TAA------------------------------------------------------------------ATG---------------------------ATG------------TAGTAA---------------------------------------------TAGTAA------TGA------------------TGA---------------------------TGA------------ATG---------------------TGATAA------------------------------------------------TGA------TAG------ATG---------------TAA---------------------------------------------------------------TAA------------------------------------TAA------------------------------------------------------------------------------------------------------TGA---------TAG---------TAA------------------------TAG---------------------TGA------------TAG---------------------------------------------------------------------------ATG------------------------------TAA------------------------------------------------------TGA------------TAGTAG---------------------------------------------TAA---------TAA---ATG---------TGA------TAATAA---------ATG
                                                                   ORF                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2  SIG                                      Xt7.1-CAAN4346.3                                                                                                                                                                                     AGCGGGCAGGAGCAGCACAAAGAGCAGCACTTCACACTGCACCACACAGGGCAGCGCACACTGGATCCCAGGCACTAGGCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGACAGCAGTATATGATGGTTTGAGAAGTGGTTATACAGTGGGCTCCCATGAGGGTCGGCCCCAGACCCTACCAATGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAGTTCGGCATCAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGACGATGACTTTAAACAGCAAGATAGAGAGTTGAAGGAAAGTGCACCATTTGCAGTCATTGGCAGCAACACTGTTGTAGAGGCCAAAGGCCAGAGGGTGAGAGGTCGTCTGTACCCATGGGGCATTGTTGAAGTGGAGAATCAGGCACATTGTGACTTTGTGAAGCTAAGGAACATGCTAATTCGGACACACATGCATGACCTGAAAGATGTCACTTGTGATGTACACTATGAGAACTACCGAGCCCAGTGCATCCAGCAGATGACAAGGAATGAAGAAAGACACAACACTGCATCAAGCAAATTGACTCAAGATAATAGGATAGAAAGTCCAATACCCATCCTGCCACTGCCAACCCCAGATGCTGAGACAGAAAAACTGATTAAAATGAAAGATGAGGAGTTGCGACGGATGCAGGAAATGTTGCAGAAAATGCAGCAGCAAATACAGGAACAGTGAATATCCTGTCAGAACGGCACTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAAAAAAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTGTTTCTTCCACTGTCTCTGACCCTAATGCAGAAAGAGGGATATTTCTTGGAGAAAGGATTCCAAATCAGTTTTCTACCAACTCCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGACTCAGGACTTCCTTTTTTATTTGTATTATTTTATTTGTATTATTATTTTTCTGTATCGATGTTTACTCAGCAGGTGACTGACTAATTATAGCAGAACCCAGAAAGGTGGTAGTTCTTTCCAAAGGAGTGAGGGTTGCACATTGCTGCCATTTATTTTTGTTTTTTAAAAGCAGGCCCAAGTATCGCACACAAAAACACATGCTTTAGACCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATGGCTATTTAAGAAAAATCCAATGTTTACACCAAAACCAAGTCAGGATTTTCTTATCTTTATCCTTATCTGATCAGAAGTTGCTGATAAATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGCCGTTATTGTACTGAAACTCAATAAAAGAAGCAGACAAATCATAGTCCAGTAGGGTAACGTCAAGTGCAAGTGACAAGCTATGCCCTGTGTTAGTTTAATAACCAGTTCAAAGACGTCACCTAGAGTCTCTCTTTTATCCGTAAGGATGCTGGGCAGCTCAAACTGTCTTGCTAACTATTGCTTGTGTGTCTAGCAGCCTAATACTGACCTTGAGTTATATCATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGAGGAAACTGAAGTAACAGGAAGAAAACCCCCACAAATAGGAGAAGAATATACCTACTTGCTGAGAGTGCCCTGACTGTATTTCAACCTTGGAGCCTCTGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTGAGTGGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGCAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCTCAGTTTAATCAGGGAAGGACACAATCCCAGTTTTTTATTTCTGTTCTTTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGCAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008282464                                                                                                                                                                                           CAGGAGCAGCACAAAGAGCAGCACTTCACACTGCACCACACAGGGCAGCGCACACTGGATCCCAGGCACTAGGCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGACAGCAGTATATGATGGTTTGAGAAGTGGTTATACAGTGGGCTCCCATGAGGGTCGGCCCCAGACCCTACCAATGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAGTTCGGCATCAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGACGATGACTTTAAACAGCAAGATAGAGAGTTGAAGGAAAGTGCACCATTTGCAGTCATTGGCAGCAACACTGTTGTAGAGGCCAAAGGCCAGAGGGTGAGAGGTCGTCTGTACCCATGGGGCATTGTTGAAGTGGAGAATCAGGCACATTGTGACTTTGTGAAGCTAAGGAACATGCTAATTCGGACACACATGCATGACCTGAAAGATGTCACTTGTGATGTACACTATGAGAACTACCGAGCCCAGTGCATCCAGCAGATGACAAGGAATGAAGAAAGACACAACACTGCATCAAGCAAATTGACTCAAGATAATAGGATAGAAAGTCCAATACCCATCCTGCCACTGCCAACCCCAGATGCTGAGACAGAAAAACTGATTAAAATGAAAGATGAGGAGTTGCGACGGATGCAGGAAATGTTGCAGAAAATGCAGCAGCAAATACAGGAACAGTGAATATCCTGTCAGAACGGCACTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAAAAAAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTGTTTCTTCCACTGTCTCTGACCCTAATGCAGAAAGAGGGATATTTCTTGGAGAAAGGATTCCAAATCAGTTTTCTACCAACTCCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGACTCAGGACTTCCTTTTTTATTTGTATTATTTTATTTGTATTATTATTTTTCTGTATCGATGTTTACTCAGCAGGTGACTGACTAATTATAGCAGAACCCAGAAAGGTGGTAGTTCTTTCCAAAGGAGTGAGGGTTGCACATTGCTGCCATTTATTTTTGTTTTTTAAAAGCAGGCCCAAGTATCGCACACAAAAACACATGCTTTAGACCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATGGCTATTTAAGAAAAATCCAATGTTTACACCAAAACCAAGTCAGGATTTTCTTATCTTTATCCTTATCTGATCAGAAGTTGCTGATAAATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGCCGTTATTGTACTGAAACTCAATAAAAGAAGCAGACAAATCATAGTCCAGTAGGGTAACGTCAAGTGCAAGTGACAAGCTATGCCCTGTGTTAGTTTAATAACCAGTTCAAAGACGTCACCTAGAGTCTCTCTTTTATCCGTAAGGATGCTGGGCAGCTCAAACTGTCTTGCTAACTATTGCTTGTGTGTCTAGCAGCCTAATACTGACCTTGAGTTATATCATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGAGGAAACTGAAGTAACAGGAAGAAAACCCCCACAAATAGGAGAAGAATATACCTACTTGCTGAGAGTGCCCTGACTGTATTTCAACCTTGGAGCCTCTGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTGAGTGGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGCAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCTCAGTTTAATCAGGGAAGGACACAATCCCAGTTTTTTATTTCTGTTCTTTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGCAAAAAAAAA
  0   1   1           Brn4 FLsh                         CAAL476.FL-MGC                                          GGCTGGCCCAGGACATTCGTGCTTCCCTATTGGCTCAATGCTAAGGGCTAGGCCGGGCGAAACCAATGGTAGGCGGCCGTGGGCTCAGTTATGCAGCAGGAGCTGCTCTCCCCAGCTCTGTGTCTATTGTAAGGGGAGCAGCGGGCAGGAGCAGCACAAAGAGCAGCACTTCACACTGCACCACACAGGGCAGCGCACACTGGATCCCAGGCACTAGGCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAGTTCGGCATCAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGACGATGACTTTAAACAGCAAGATAGAGAGTTGAAGGAAAGTGCACCATTTGCAGTCATTGGCAGCAACACTGTTGTAGAGGCCAAAGGCCAGAGGGTGAGAGGTCGTCTGTACCCATGGGGCATTGTTGAAGTGGAGAATCAGGCACATTGTGACTTTGTGAAGCTAAGGAACATGCTAATTCGGACACACATGCATGACCTGAAAGATGTCACTTGTGATGTACACTATGAGAACTACCGAGCCCAGTGCATCCAGCAGATGACAAGCAAATTGACTCAAGATAATAGGATAGAAAGTCCAATACCCATCCTGCCACTGCCAACCCCAGATGCTGAGACAGAAAAACTGATTAAAATGAAAGATGAGGAGTTGCGACGGATGCAGGAAATGTTGCAGAAAATGCAGCAGCAAATACAGGAACAGTGAATATCCTGTCAGAACGGCACTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAAAAAAAAAAAAAAA
  5   1   2       add Brn2      out                       CAAJ16666.5p AAAAGCTTGTGTCTCCAGGTATGGCCAAACATACAAGTTCTTGATCACAGCACATAACCATCTATTGGTAAATACCAACAGTTCAGTGGTTCAGGTTCTCAAATAAATTCTTATCTTTTACATAGGGTGAGTGTTGTTTTGCTGTCTGTGGGATTGCAGCTTCTGTATATATTATTTTGTTGGAGGTAGTGTTGCTTCCCCATTTTTGCATTCGTGGTTGTACATAAAGCAAGTAGTCTAATGAATGAAAGGTCGTGCTTCAAAATAGGCAAAATTTAGTCTGAAGGAAAAAAGACAAGCATTTGTCTTTTCTAGTGCTAGAACTAGGAGATTGTAAACTGGCAGTTAGTATGTGTATAAGTTTGCTTGTCACTGTGTAACTTTCCTTGTAGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGGTAGGCCATACATCTTTTTGGCAAAGAGGATATGACATCACATGCATGATGTAATGGGGTCTTGTCTACTGTTTATTATTTGCTTTGTATTGATGTGCCTATAGCACCTTGATATAATTATTTTTCCATCTCATTTATTGTTTTGAATTCTAATTCAAAGCTAAAGCTACTGTGATATAAACTGTATCTATATCTATATATATATTTATATTTATATGCACAATGTAAAAGTTGCTGATCGAGCATCAATATGTGCTGTTCTGTTTGCCATAT
  5   1   2       add Brn4 FLsh in                          CAAL476.5p                                                                                                                      GCTGGCCCAGGACATTCGTGCTTCCCTATTGGCTCAATGCTAAGGGCTAGGCCGGGCGAAACCAATGGTAGGCGGCCGTGGGCTCAGTTATGCAGCAGGAGCTGCTCTCCCCAGCTCTGTGTCTATTGTAAGGGGAGCAGCGGGCAGGAGCAGCACAAAGAGCAGCACTTCACACTGCACCACACAGGGCAGCGCACACTGGATCCCAGGCACTAGGCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGAAAGCTCTGCATGA
  5   1   2   10  add Eye  5g3  in                          CCAX698.b1 .........................................................................................................................................................................GTAAGGGGAGCAGCGGGCAGGAGCAGCACAAAGAGCAGCACTTCACACTGCACCACACAGGGCAGCGCACACTGGATCCCAGGCACTAGGCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGACAGCAGTATATGATGGTTTGAGAAGTGGTTATACAGTGGGCTCCCATGAGGGTCGGCCCCAGACCCTACCAATGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAGTCGGCATCAAGGTTTATCAG
  5   1   2   24  ext Te3  5g   ?                          CAAM7519.5p ...........................................................................................................................................................................AAGGGGAGCAGCGGGCAGGAGCAGCACAAAGAGCAGCACTTCACACTGCACCACACAGGGCAGCGCACACTGGATCCCAGGCACTAGGCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGACAGCAGTATATGATGGTTTGAGAAGTGGTTATACAGTGGGCTCCCATGAGGGTCGGCCCCAGACCCTACCAATGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAAGCTCAGGACCGGATTAGGGAGGAGATAGAGAAGTTCGGCATCAAGGGTTATCAGTTCCCAGAATGTGACTCTGATGAGGA
  5   1   2   14  ext Te4  5g3  in                         CAAN1818.5p ....................................................................................................................................................................................AGCGGGCAGGAGCAGCACAAAGAGCAGCACTTCACACTGCACCACACAGGGCAGCGCACACTGGATCCCAGGCACTAGGCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGACAACAGATGAGAAGGAGACAGCAGTATATGATGGTTTGAGAAGTGGTTATACAGTGGGCTCCCATGAGGGTCGGCCCCAGACCCTACCAATGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAAGAAATTCTACCTTGGAGAACAGTCTAATTTTGACAGATCTCTATAAGGACAGGAAATTGCTCCATGCAGAAGAACGAATTAGCTCAAACGGTGGAGATTCTTAAGCATACAGTGTACATTGAGGAAAAGTGGAGTAAAGCTGAAATTAACC
  5   1   3   14   nb Brn3 5g3  in                         CAAK5164.5p ......................................................................................................................................................................................CGGGCAGGAGCAGCACAAAGAGCAGCACTTCACACTGCACCACACAGGGCAGCGCATACTGGATCCCAGGCACTAGGCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGACAGCAGTATATGATGGTTTGAGAAGTGGTTATACAGTGGGCTCCCATGAGGGTCGGCCCCAGACCCTACCAATGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGANAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAGTTCGGCATNCAGGTTTATCAGGTCCCAGAATGTGACTCTGATGAGGACGATGACTTTAAACAGNCAGATAGAGAGTTGAA
  5   1   4   14 seed Te4  5g3  in                         CAAN3949.5p ......................................................................................................................................................................................CGGGCAGGAGCAGCACAAAGAGCAGCACTTCACACTGCACCACACAGGGCAGCGCACACTGGATCCCAGGCACTAGGCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGACAGCAGTATATGATGGTTTGAGAAGTGGTTATACAGTGGGCTCCCATGAGGGTCGGCCCCAGACCCTACCAATGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGA
  5   1   3   14   nb Te4  5g3  in                        CAAN10245.5p .........................................................................................................................................................................................GCAGGAGCAGCACAAAGAGCAGCACTTCACACTGCACCACACAGGGCAGCGCACACTGGATCCCAGGCACTAGGCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGACAGCAGTATATGATGGTTTGAGAAGTGGTTATACAGTGGGCTCCCATGAGGGTCGGCCCCAGACCCTACCAATGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGANAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAGTTCGGCATCAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGACGATGACTT
  5   1   2   15  add Brn2 5g3  in                        CAAJ19879.5p .................................................................................................................................................................................................................................................................CGGGCAGGAGCAGCACAAAGAGCAGCACTTCACACTGCACCACACAGGGCAGCGCACACTGGATCCCAGGCACTAGGCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAGTTCGGCATCAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGACGATGACTTTAAACAGCAAGATAGAGAGTTTGAGGAAAGTGCACCATTTGCAGTCATTGGCAGCAACACTGTTGTAGAGGCCCAAG
  5   1   2       add Eye       in                         CCAX7137.b1                                                                                                                                                                                                                                                                                                                                    CAGGCACTAGGCACCATGAGCACCAGTATCAGGTACAAGAGCAAGCTGCTGAAAACAGATGAGAAGGAGGACCAAGAGAAGCAGTATGTTGGCTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAGTTCGGCATCAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGACGATGACTTTAAACAGCAAGATA
  5   1   3        nb Neu                            TNeu035l05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTTGCCACTTTGCCCAATCAAGTTCACAGGAAGTCTGTGAAGAAAGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAGTTCGGCATCAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGACGATGACTTTAAACAGCAAGATAGAGAGTTGAAGGAAAGTGCACCATTTGCAGTCATTGGCAGCAACACTGTTGT
  5   1   2       ext Te4       in                         CAAN8679.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAAAGGATTTGACTTTACTCTCATGGTAGCCGGGGAGTCCGGCCTAGGAAAGTCTACCTTGGTGAACAGTCTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAGTTCGGCATCAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGACGATGACTTTAAACAGCAAGATAGAGAGTTGAAGGAAAGTGCACCATTTGCAGTCATTGGCAGCAACACTGTTGTAGAGGCCAAAGGCCAGAGGGTGAGAGGTCGTCTGTACCCATGGGGCATTGTTGAAGTGGAGAATCAGGCACATTGTGACTTTGTGAAGCTAAGGAACATGCTAATTCGGACACACATGCATGACCTGAAAGATGTCACTTGTGATGTACACTATGAGAACTACCGAGCCCAGTGCATCCAGCAGAATGACA
  5   1   3        nb Te4       in                         CAAN4903.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTATTTTTGACAGATCTCTATAAGGACAGGAAATTGCTCAATGCAGAAGAGCGAATTAGCCAAACGGTGGAGATTCTTAAGCATACAGTGGACATTGAGGAAAAGGGAGTAAAGCTGAAATTAACCATAGTGGACACGCCTGGGTTTGGGGATGCAGTCAATAACAATGAATGCTGGAAGCCTATAACAGACTACATAGACCAGCAGTTTGAACAGTATTTTCGGGATGAGAGTGGCCTGAATCGGAAGAACATTCAGGACAACAGAGTGCACTGCTGCTTGTACTTCATCTCACCTTTTGGACATGGGCTACGACCAGTGGATGTGGCTTTCATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAGTTCGGCATCAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGACGATGACTTTAAACAGCAAGATAGAGAGTTGAAGGAAAGTGCACCATTTGCAGTCATTGGCAGCAACACTGTTGTAGAGGCCAAAGGCCAGAGGGTGAGAGGTCGTCTGTACCCATGGGGCATTGTTGAAGTGGAGAATCAGGCACATTGTGACTTTGTGAAGCTAAGGAACATGCTAATTCGGACACACATGCATGACCTGAAAGATGTCACTTGTGATGTACACTATGAGAACTACCGAGCCAAGTGCATCCAGCAGATGACAAGGAATGAAGAAAGA
  5   1   3        nb Tail      in                         CBSW6124.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGAAAGCTCTGCATGAGAAGGTGAACATTGTTCCTCTGATTGCTAAGGCTGACTGCCTGATTCCTGGCGAGATCCGCAAGCTCAAGGACCGGATTAGGGAGGAGATAGAGAAGTTCGGCATCAAGGTTTATCAGTTCCCAGAATGTGACTCTGATGAGGATGATGACTTTAAACAGCAAGATAGAGAGTTGAAGGAAAGTGCACCATTTGCAGTCATTGGCAGCAACACTGTTGTAGAGGCCAAAGGCCAGAGGGTGAGAGGTCGTCTGTACCCATGGGGCATTGTTGAAGTGGAGAATCAGGCACATTGTGACTTTGTGAAGCTAAGGAACATGCTAATTCGGACACACATGCATGACCTGAAAGATGTCACTTGTGATGTACACTATGAGAACTACCGAGCCCAGTGCATCCAGCAGATGACAAGGAATGAAGAAAGACACAACACTGCATCAAGCAAATTGACTCAAGATAATAGGATAGAAAGTCCAATACCCATCCTGCCACTGCCAACCCCAGATGCTGAGACAGAAAAACTGATTAAAATGAAAGATGAGGAGTTGCGACGGATGCAGGAAATGTTGCAGAAAATGCAGCAGCAAATACAGGAACAGTGAATATCCTGTCAGAACGGCACTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTAT
  3   1   0       chi Brn4 FLsh in                          CAAL476.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGGAGGAGATAGAGAAGTTCGGGCATCAAGGTTTTATCAGTTCCCAGAATGTGACTCTGATGAGGACGATGACTTTAAACAGCAAGATAGAGAGTTGAAGGAAAGTGCACCATTTGCAGTCATTGGCAGCAACACTGTTGTAGAGGCCAAAGGCCAGAGGGTGAGAGGTCGTCTGTACCCATGGGGCATTGTTGAAGTGGAGAATCAGGCACATTGTGACTTTGTGAAGCTAAGGAACATGCTAATTCGGACACACATGCATGACCTGAAAGATGTCACTTGTGATGTACACTATGAGAACTACCGAGCCCAGTGCATCCAGCAGATGACAAGCAAATTGACTCAAGATAATAGGATAGAAAGTCCAATACCCATCCTGCCACTGCCAACCCCAGATGCTGAGACAGAAAAACTGATTAAAATGAAAGATGAGGAGTTGCGACGGATGCAGGAAATGTTGCAGAAAATGCAGCAGCAAATACAGGAACAGTGAATATCCTGTCAGAACGGCACTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATG
  5   1   2       ext Te4       in                         CAAN4346.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAGTGCACCATTTGCAGTCATTGGCAGCAACACTGTTGTAGAGGCCAAAGGCCAGAGGGTGAGAGGTCGTCTGTACCCATGGGGCATTGTTGAAGTGGAGAATCAGGCACATTGTGACTTTGTGAAGCTAAGGAACATGCTAATTCGGACACACATGCATGACCTGAAAGATGTCACTTGTGATGTACACTATGAGAACTACCGAGCCCAGTGCATCCAGCAGATGACAAGGAATGAAGAAAGACACAACACTGCATCAAGCAAATTGACTCAAGATAATAGGATAGAAAGTCCAATACCCATCCTGCCACTGCCAACCCCAGATGCTGAGACAGAAAAACTGATTAAAATGAAAGATGAGGAGTTGCGACGGATGCAGGAAATGTTGCAGAAAATGCAGCAGCAAATACAGGAACAGTGAATATCCTGTCAGAACGGCACTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAANAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTATTTCTCCACTGTCTCTGACCCCTATGCAGAAAGAGGGAT
  5   1   2       ext TbA       in                   TTbA051j04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGATGCTGAGACAGAAAAACTGATTAAAATGATAGATGAGGAGTTGCGACGGATGCAGGAAATGCTGCAGAAAATGCAGCATCTAATACAGGATGAGTGAATATCCTGCCGCAACGGCGCTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGGCAGTGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAGCCGAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAAAAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTATTTCTTCCACTGTCTCTGACCCTAATGCAGAAAGAGGGATATTTCTTGGAGAAAGGATTCCAAATCAGTTTTCTACCAACTCCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGACTCAGGACTTCCTTTTTTATTTGTATTATTTTATTTGTATTATTATTTTTCTGTATCGATGTTTACTCAGCAGGTGACTGACTAATTATAGCAGAACCCAGAAAGGTGGTAGTTCTTTCCAAAGGAGTGAGGGTTGCACATTGCTGCCATTTATTTTTGTTTTT
  5   1   3        nb HdA                           THdA009l13.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGATGAGGAGTTGCGACGGATGCAGGAAATGTTGCAGAAAATGCAGCAGCAAATACAGGAACAGTGAATATCCTGTCAGAACGGCACTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAAAAAAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTGTTTCTTCCACTGTCTCTGACCCTAATGCAGAAAGAGGGATATTTCTTGGAGAAAGGATTCCAAATCAGTTTTCTACCAACTCCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGACTCAGGACTTCCTTTTTTATTTGTATTATTTTATTTGTATTATTATTTTTCTGTATCGATGTTTACTCAGCAGGTGACTGACTAATTATAGCAGAACCCAGAAAAGGTGGTAGTTCTTTCCAAGGAATTGAGGGTTGCACATTGCTGCCATTTATTTTTGTTTTTTANAAGCAGGCCCAAGTATCGCACACAAAAACACATGCTTTAGACCAAATTTATGACAGTAGAATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATGGC
  5   1   2       ext Te4       in                         CAAN6190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAAAAAAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTGTTTCTTCCACTGTCTCTGACCCTAATGCAGAAAGAGGGATATTTCTTGGAGAAAGGATTCCAAATCAGTTTTCTACCAACTCCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGACTCAGGACTTCCTTTTTTATTTGTATTATTTTATTTGTATTATTATTTTTCTGTATCGATGTTTACTCAGCAGGTGACTGACTAATTATAGCAGAACCCAGAAAGGTGGTAGTTCTTTCCAAAGGAGTGAGGGTTGCACATTGCTGCCATTTATTTTTGTTTTTTAAAAGCAGGCCCAAGTATCGCACACAAAAACACATGCTTTAGACCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATGGCTATTTAAGAAAAATCCAATGTTTACACCAAAACCAAGTCAGGATTTTTCTATCTTTATCCTTATCTGATCAGAAGTTGCTGATAAATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGC
  5   1   3        nb Eye       in                         CCAX6393.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAAAAAAAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTGTTTCTTCCACTGTCTCTGACCCTAATGCAGAAAGAGGGATATTTCTTGGAGAAAGGATTCCAAATCAGTTTTCTACCAACTCCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGACTCAGGACTTCCTTTTTTATTTGTATTATTTTATTTGTATTATTATTTTTCTGTATCGATGTTTACTCAGCAGGTGACTGACTAATTATAGCAGAACCCAGAAAGGTGGTAGTTCTTTCCAAAGGAGTGAGGGTTGCACATTGCTGCCATTTATTTTTGTTTTTTAAAAGCAGGCCCAAGTATCGCACACAAAAACACATGCTTTAGACCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATGGCTATTTAAGAAAAATCCAATGTTTACACCAAAACCAAGTCAGGA
  5   1   3        nb Te1       in                         CBWN6645.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAAAAAAAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTGTTTCTTCCACTGTCTCTGACCCTAATGCAGAAAGAGGGATATTTCTTGGAGAAAGGATTCCAAATCAGTTTTCTACCAACTCCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGACTCAGGACTTCCTTTTTTATTTGTATTATTTTATTTGTATTATTATTTTTCTGTATCGATGTTTACTCAGCAGGTGACTGACTAATTATAGCAGAACCCAGAAAGGTGGTAGTTCTTTCCAAAGGAGTGAGGGTTGCACATTGCTGCCATTTATTTTTGTTTTTTAAAAGCAGGCCCAAGTATCGCACACAAAAACACATGCTTTAGACCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATGGCTATTTAAGAAA
  5   1   3        nb Brn3                                CAAK10142.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTAATCTTTTGTCAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAAAAAAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTGTTTCTTCCACTGTCTCTGACCCTAATGCAGAAAGAGGGATATTTCTTGGAGAAAGGATTCCAAATCAGTTTTCTACCAACTCCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGACTCAGGACTTCCTTTTTTATTTGTATTATTTTATTTGTATTATTATTTTTCTGTATCGATGTTTACTCAGCAGGTGACTGACTAATTATAGCAGAACCCAGAAAGGTGGTAGTTCTTTCCAAAGGAGTGAGGGTTGCACATTGCTGCCATTTATTTTTGTTTTTTAAAAGCAGGCCCAAGTATCGCACACAAAAACACATGCTTTAGACCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATGGCTATTTAAGAAAAATCCAATGTTTACACCAAAACCAAGTCAGGATTTTCTTATCTTTATCCTTATCTGATCAGAAGTTGCTGATAAATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGCCGTTATTGTACTGAAACTCAATAAAAGAAGCAGACAAATCATAGTCCAGTAGGGTAACGTCAAGTGCAAGTGACAAGCTATGCCCTGTNGTAGTTTAATAC
  5   1   2       ext Brn4      in                        CAAL19581.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGACTCAGGACTTCCTTTTTTATTTGTATTATTTTATTTGTATTATTATTTTTCTGTATCGATGTTTACTCAGCAGGTGACTGACTAATTATAGCAGAACCCAGAAAGGTGGTAGTTCTTTCCAAAGGAGTGAGGGTTGCACATTGCTGCCATTTATTTTTGTTTTTTAAAAGCAGGCCCAAGTATCGCACACAAAAACACATGCTTTAGACCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATGGCTATTTAAGAAAAATCCAATGTTTACACCAAAACCAAGTCAGGATTTTCTTATCTTTATCCTTATCTGATCAGAAGTTGCTGATAAATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGCCGTTATTGTACTGAAACTCAATAAAAGAAGCAGACAAATCATAGTCCAGTAGGGTAACGTCAAGTGCAAGTGACAAGCTATGCCCTGTGTTAGTTTAATAACCAGTTCAAAGACGTCACCTAGAGTCTCTCTTTTATCCGTAAGGATGCTGGGCAGCTCAAACTGTCTTGCTAACTATTGCTTGTGTGTCTAGCAGCCTAATACTGACCTTGAGTTATATCATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGGATGTGTG
  3   1   2       add Eye       in                         CCAX7137.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGATGTTTACTCAGCAGGTGACTGACTAATTATAGCAGAACCCAGAAAGGTGGTAGTTCTTTCCAAAGGAGTGAGGGTTGCACATTGCTGCCATTTATTTTTGTTTTTTAAAAGCAGGCCCAAGTATCGCACACAAAAACACATGCTTTAGGCCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATTGCTATTTAAGAAAAATCCAATGTTTACACCAAAACCAAGTCAGGATTTTCTTATCTTTATCCTTATCTGATCAGAAGTTGCTGATAAATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGCCGTGATTGTACTGAAACTCAATAAAAGAAGCAGACAAATCATAGTCCAGTAGGGTAACGTCAAGTGCAAGTGACAAGCTATGCCCTGTGTTAGTTTAATAACCAGTTCAAAGACGTCACCTAGAGTCTCTCTTTTATCCGTAAGGATGCTGGGCAGCTCAAACTGTCTTGCTAACTATTGCTTGTGTGTCTAGCAGCCTAATACTGACCTTGAGTTATATCATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTAC
  5   1   2       add Limb                                CBSU8829.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCCGGCACATTGCTGCCATTTATTTTTGTTTTTTAAAGCAGGCCCAAGTATCGCACACAAAAACACATGCTTTAGGCCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATTGCTATTTAAGAAAAATCCAATGTTTACACCAAAACCAAGTCAGGATTTTCTTATCTTTATCCTTATCTGATCAGAAGTTGCTGATAAATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGCCGTGATTGTACTGAAACTCAATAAAAGAAGCAGACAAATCATAGTCCAGTAGGGTAACGTCAAGTGCAAGTGACAAGCTATGCCCTGTGTTAGTTTAATAACCAGTTCAAAGACGTCACCTAGAGTCTCTCTTTTATCCGTAAGGATGCTGGGCAGCTCAAACTGTCTTGCTAACTATTGCTTGTGTGTCTAGCAGCCTAATACTGACCTTGAGTTATATCATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAACGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGAGGAAACTGAAGTAACAGGAAGAAAACCCCCACAAATTGGAGAAGAATATACCTACTCCTTGCTGAGAGTGCCCTGACTGTAATTCAACCTTGAAGCCTCTGCACTACAAGGCAGCGATGC
  5   1   3        nb Eye       in                          CCAX708.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGATTTTCTTATCTTTATCCTTATCTGATCAGAAGTTGCTGATAAATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGCCGTGATTGTACTGAAACTCAATAAAAGAAGCAGACAAATCATAGTCCAGTAGGGTAACGTCAAGTGCAAGTGACAAGCTATGCCCTGTGTTAGTTTAATAACCAGTTCAAAGACGTCACCTAGAGTCTCTCTTTTATCCGTAAGGATGCTGGGCAGCTCAAACTGTCTTGCTAACTATTGCTTGTGTGTCTAGCAGCCTAATACTGACCTTGAGTTATATCATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGAGGAAACTGAAGTAACAGGAAGAAAACCCCCACAAATAGGAGAAGAATATACCTACTTGCTGAGAGTGCCCTGACTGTATTTCAACCTTGGAGCCTCAGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTGAGTGGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGCAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCCCAGTTTAATCAGGGAAGGACACAATCCCAGT
  5   1   3        nb TbA       in                   TTbA028i20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGCCGTGATTGTACTGAAACTCAGTAGAGGAGGGCAAACAAATCATAGTCCAGTAGGGTAACGTCAAGTGCAAGTGANCAGCTATGCCCTGTGTTAGTTTAATAA
  5   1   2       add Te5       in                         CAAO5543.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCTTTTATCCGTAAGGATGCTGGGCAGCTCAAACTGTCTTGCTAACTATTGCTTGTGTGTCTAGCAGCCTAATACTGACCTTGAGTTATATCATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGAGGAAACTGAAGTAACAGGAAGAAAACCCCCACAAATAGGAGAAGAATATACCTACTTGCTGAGAGTGCCCTGACTGTATTTCAACCTTGGAGCCTCAGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTGAGTGGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGCAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCCCAGTTTAATCAGGGAAGGACACAATTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTAT
  5   1   2       ext Te5       in                         CAAO4304.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGAGGAAACTGAAGTAACAGGAAGAAAACCCCCACAAATAGGAGAAGAATATACCTACTTGCTGAGAGTGCCCTGACTGTATTTCAACCTTGGAGCCTCTGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTGAGTGGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGCAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCTCAGTTTAATCAGGGAAGGACACAATCCCAGTTTTTTATTTCTGTTCTTTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGAC
  5   1   2       ext Bone      in                       CBTC11054.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAACTGAAGTAACAGGAAGAAAACCCCCACAAATAGGAGAAGAATATACCTACTTGCTGAGAGTGCCCTGACCGTATTTCAACCTTGGAGCCTCTGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTGAGTGGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGCAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCTCAGTTTAATCAGGGAAGGACACAATCCCAGTTTTTTATTTCTGTTCTTTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGA
  3   1   2       add Eye  5g3  in                          CCAX698.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATATACTTACTTGCTGAGAGTGCCCTGACTGTATTTCACCTTGGAGCCTCAGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTGAGTGGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGCAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCCCAGTTTAATCAGGGAAGGACACAATTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTA
  5   1   3        nb Tad5                                 XZT28717.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGCAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCCCAGTTTAATCAGGGAAGGACACAATCCCAGTTTTTTATTTCTGTTCTTTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCAAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAAGGATCCACCATCAG
  5   1   2       ext BrSp      in                    EC0CBA001BH07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGTAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCTCAGTTTAATCAGGGAAGGACACAATCCCAGTTTTTTATTTCTGTTCTTTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAATGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACCTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATT
  5   1   2       ext Gas8      in                          st14d08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCAAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTT
  5   1   2       ext TpA       in                   TTpA068k08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGC
  3   1   2       ext Brn4      in                        CAAL19581.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   2       ext Te4       in                         CAAN4346.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   3        nb Te4  5g3  in                        CAAN10245.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGCATAGTAAATACCCCTACTATATTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTNATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   0       chi TpA       out                   TTpA053b16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACATTACGGACACCCCCCTCCCCAATTTCCGTTAAATGGGGTTTGAACAAGGCGACCGGAGGAGGGGGGGAAAAGTTTCCTACATGGGGTTTCACTTTGTTTTTTTTTTTTTTTTTTAAAATTGCGGGGAATTTTCCTTCCCCCAAACAAAATAATTTCATATCACATTCTTAAAACTAATGAAATCCGCCCTTTTGCCCCGGAAAAGACAAACAAAATACAAAATGGGAAACCCGGAGGGGAGAGGGGCCCAGGAAATTTAATTTCTCTTGGCCAGGATACAAAACGTTGGTTAGCAAGGAATTGCCATAAAAGGCATGGTATCCATCCCAAAAAAAAGTGGTGTGCTAATTGGGGGGGTAAAAAAGGCGATAAGGCCGTCCTTCTCaaaaaaaaacaaaaaaaagcacaagaaaaaaaaaaaaaaaaaaa
  3   1   3        nb TbA       in                    TTbA028i20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACATTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCTTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGTTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATAGTTGCCGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAATGCAAAAAAAAAAAAAAAAGC
  3   1   3        nb Brn3 5g3  in                         CAAK5164.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   4      seed Te4  5g3  in                         CAAN3949.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   2       add Brn2 5g3  in                        CAAJ19879.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   2       ext Te4       in                         CAAN8679.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   2       ext Gas8      in                          st14d08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCAAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATT
  5   1   3        nb Tad5                                 XZT64608.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGCAAAANAAANAAAA
  3   1   3        nb Brn3      out                       CAAK11984.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   3        nb Te3       out                       CAAM14045.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   2       ext Te4       in                         CAAN6190.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   2       ext Bone      in                       CBTC11054.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3  -1   3        nb Kid1      in                         CABA4721.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTATAGGGCGAGAGGTTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCAAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTA
  5  -1   3        nb Kid1      in                         CABA4721.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCAAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCCTGAGAATCTTA
  3   1   3        nb Eye       in                          CCAX708.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCAAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   3        nb Te4       in                         CAAN4903.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   2       ext Te5       in                         CAAO4304.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  5   1   2       add TbA       in                   TTbA027m08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACGTACCAAGTTTATCAGACCGGTTGGTCCTCCAGCCGTCCGATAAACTCGGTACGTGGGATCGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCCGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCACGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATG
  3   1   3        nb Tail      in                         CBSW6124.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGCAAAAAAAAAAAAAAA
  3   1   2       ext TbA       in                    TTbA051j04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCAGGGTCCTGTTTTTTTACTTCAACGTACGGCATTTTTTATAATATAATTCACAGGGTCTGGATTTGGTTTATTGCCATCACTCTAAATACAATTTAATTGGCTTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTTTGTGTAATGGGGATGGAGTGGATAAACCATAGTTTGGCAGCCAAAAGCTTTTCCACTTATTGATCTTTACCTCCCATCAGATTAAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGTTGCAGGCTGTTGGATTAAGCACCCCTTGTGCTTGGTAACCCTGCTCCTTTGTTTCCATTGGAAGTATTTTTGGGACCCTCTGCCCTGTAGTAGCCCACCTTGAAACAGTGCATATCTTGCGTACAAATATTTCTTATATTAAGCGTTGCTGTAATTAAAGTTTAACAACCCTGAGAATCCTTAATAAACCCATTAAAATGCACAAAAAAAAAAAAAAAAA
  3   1   3        nb Eye       in                         CCAX6393.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   2       add TbA       in                    TTbA027m08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGATTGATTTTTTTAAGCTCTGAAAATATTGGGGGCGGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATGGGTTAATTTCCAGGGTCCGGTTTTTTTACTTCAACCTAGGGCATTTTTTATAATAAAATTCACAGGGTTGGGATTTTGTTTATTGCCATCACTCTAAAAACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCGGGGATCCCCCATCAGCACCAAGATATTTTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTTTTGACTTAAGATCAAAAAAGGGGACATTCCATTTAGGGGTTTTTGTGTAAGGGGGATTGAGTTGATAAACCATAGTTTGGCAGCCAAAAGTTTTTCCACTTATTGATTTTTACCTCCCATAAGTTTCAGCAAGCGGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCGGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTTTGCCCTGTAGTAGCCCCCCTTGAACAGGGAATATCCGGGGTAAAAAAATTTTTTATATTAATGGTGGGGGAAATTAAGGTTTACAACCGGGGAATTTTAATAACCCATTAAATTGCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       ext Te4  5g3  in                         CAAN1818.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCAGAAAGCTCTATAAAAGGTATGGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   2       ext BrSp      in                    EC0CBA001BH07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTTTTTTTACCTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGCAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Tbd1      in                         CBXT8630.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGCAAAAAAAAAAAAAAA
  3   1   2       ext Tbd1      in                         CBXT8630.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGCAAAAAAAAAAAAAAA
  3   1   2       add Te5       in                         CAAO5543.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATTTGGGTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGCACATTGCTCCTG
  3   1   2       ext TpA       in                   TTpA068k08.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAGCACCAAGATATATTGTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAA
  3   1   3        nb Brn3                                CAAK11136.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGTTCTTGACTTTAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   3        nb Te1       in                         CBWN6645.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCTAAAGTTTTTCCACTTATTGATTTTTACCTCCCATCAGTTTCAGCAAGCTGGTCCCAGGCAGGTTTTGGCAGGGGCAGAGAGCTCCAGGCTTTTGGATTAAGCCCCCCTTGTGCCGGGTAACCCGGCTCCTTTGTTTCCATTTGAAGTATTTTTGGGACCCTTTGCCCGGTAGTAGCCCCCCTTGAACAGGGCATTTCCGGGGTACAAATATTTTTTATATTAATTGTGGCGGTAATTAAGGTTTCCA
  5   1   2  SIG                                      Xt7.1-CAAN7990.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATTAATGTGCATTGCTTTACCGTTTAGGATCTGCTTTTATTCCATTGCAACTCCATTTACTGACTTTGCTCTCTTTGTCTCACAGCAAATTGACTCAAGATAATAGGATAGAAAGTCCAATACCCATCCTGCCACTGCCAACCCCAGATGCTGAGACAGAAAAACTGATTAAAATGAAAGATGAGGAGTTGCGACGGATGCAGGAAATGTTGCAGAAAATGCAGCAGCAAATACAGGAACAGTGAATATCCTGTCAGAACGGCACTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAAAAAAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTGTTTCTTCCACTGTCTCTGACCCTAATGCAGAAAGAGGGATATTTCTTGGAGAAAGGATTCCAAATCAGTTTTCTACCAACTCCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGA------------------------------------------------------------------------------------------------------------------------------------------------CCCGGGGATGTGTTTTTGTGTGCGAATACTTGGGCCTGGCTTTTAAAAAACACATGGCTTTAGACCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATGGCTATTTAAGAAAAATCCAATGTTTACACCAAAACCAAGTCAGGATTTTCTTATCTTTATCCTTATCTGATCAGAAGTTGCTGATAAATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGCCGTGATTGTACTGAAACTCAATAAAAGAAGCAGACAAATCATAGTCCAGTAGGGTAACGTCAAGTGCAAGTGACAAGCTATGCCCTGTGTTAGTTTAATAACCAGTTCAAAGACGTCACCTAGAGTCTCTCTTTTATCCGTAAGGATGCTGGGCAGCTCAAACTGTCTTGCTAACTATTGCTTGTGTGTCTAGCAGCCTAATACTGACCTTGAGTTATATCATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGAGGAAACTGAAGTAACAGGAAGAAAACCCCCACAAATAGGAGAAGAATATACCTACTCCTTGCTGAGAGTGCCCTGACTGTAATTCAACCTTGAAGCCTCAGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTTTTCTGTTGAGTGGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGTAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCTCAGTTTAATCAGGGAAGGACACAATCCCAGTTTTTTATTTCTGTTCTTTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAAGAACTGACATTCCCAGGCATTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAA
                                                  Xt7.1-CHK-1008282468                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTGCATTGCTTTACCGTTTAGGATCTGCTTTTATTCCATTGCAACTCCATTTACTGACTTTGCTCTCTTTGTCTCACAGCAAATTGACTCAAGATAATAGGATAGAAAGTCCAATACCCATCCTGCCACTGCCAACCCCAGATGCTGAGACAGAAAAACTGATTAAAATGAAAGATGAGGAGTTGCGACGGATGCAGGAAATGTTGCAGAAAATGCAGCAGCAAATACAGGAACAGTGAATATCCTGTCAGAACGGCACTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAAAAAAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTGTTTCTTCCACTGTCTCTGACCCTAATGCAGAAAGAGGGATATTTCTTGGAGAAAGGATTCCAAATCAGTTTTCTACCAACTCCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGACTCAGG------------------------------------------------------------------------------------------------------------------------------------------------GATGTGTTTTTGTGTGCGAATACTTGGGCCTGGCTTTTAAAAAACACATGGCTTTAGACCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATGGCTATTTAAGAAAAATCCAATGTTTACACCAAAACCAAGTCAGGATTTTCTTATCTTTATCCTTATCTGATCAGAAGTTGCTGATAAATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGCCGTGATTGTACTGAAACTCAATAAAAGAAGCAGACAAATCATAGTCCAGTAGGGTAACGTCAAGTGCAAGTGACAAGCTATGCCCTGTGTTAGTTTAATAACCAGTTCAAAGACGTCACCTAGAGTCTCTCTTTTATCCGTAAGGATGCTGGGCAGCTCAAACTGTCTTGCTAACTATTGCTTGTGTGTCTAGCAGCCTAATACTGACCTTGAGTTATATCATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGAGGAAACTGAAGTAACAGGAAGAAAACCCCCACAAATAGGAGAAGAATATACCTACTCCTTGCTGAGAGTGCCCTGACTGTAATTCAACCTTGAAGCCTCAGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTTTTCTGTTGAGTGGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGTAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCTCAGTTTAATCAGGGAAGGACACAATCCCAGTTTTTTATTTCTGTTCTTTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAxxAACTGACATTCCxxGxxxTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTA
  5   1   2       ext Te4       in                          CAAN404.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTACATAAATGAAAAAGGAAAAAAAAAACGCTAGAACCCAAATGTTTGCTTTCAACCAGCAGACCTATAAATGCTGGCTGCTTATTGATTGCTTTCGGTTATTCAAACTGGTGCTAACCTGCACCTCACAATCATACATTTGTGCTTCTAATAGAATTGAGCTGTTACAGAACAAGTAGCTTCATCAGTACTCAACTCTGCCCTCTGCTGGAATACTGGAGGCTTGTGCCTAATCCAAATTTAGAAAATATTTATGGGTAGTGCACAATAAAAAGATGGATTAATGTGCATTGCTTTACCGTTTAGGATCTGCTTTTATTCCATTGCAACTCCATTTACTGACTTTGCTCTCTTTGTCTCACAGCAAATTGACTCAAGATAATAGGATAGAAAGTCCAATACCCATCCTGCCACTGCCAACCCCAGATGCTGAGACAGAAAAACTGATTAAAATGAAAGATGAGGAGTTGCGACGGATGCAGGAAATGTTGCAGAAAATGCAGCAGCAAATACAGGAACAGTGAATATCCTGTCAGAACGGCACTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACT
  5   1   4      seed Te4       in                         CAAN7990.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATTAATGTGCATTGCTTTACCGTTTAGGATCTGCTTTTATTCCATTGCAACTCCATTTACTGACTTTGCTCTCTTTGTCTCACAGCAAATTGACTCAAGATAATAGGATAGAAAGTCCAATACCCATCCTGCCACTGCCAACCCCAGATGCTGAGACAGAAAAACTGATTAAAATGAAAGATGAGGAGTTGCGACGGATGCAGGAAATGTTGCAGAAAATGCAGCAGCAAATACAGGAACAGTGAATATCCTGTCAGAACGGCACTTACCCTTCACATTTTCAAACATACCTGACACAGCACCTCTAAGATGAGTACGGAGTTGGATGTGGTACCCGTGGACTCATTGCAGCATCTTATTTATTGTTATAATCACCCGTCCTATATGAACGTCTCTCTCTCTATGTCAATGTTTAATGACCTGTCCTATTCCTCCACAACATCCTAATAATGGAACCAAGCACTTCACCTAAAGGCTAATCTTTTGTCAAAAATGAGCTTAATCACAGCATCTTTCATGTCACTAGAAGAAAATAACCGTAAGTGCAAAGCATTCTGGGAATTGCGCAGGATAACTGCACAGCCTTATGAGAAAAAAAAAACAAGTTACCCAGTGCACTCTGGGAACTATCGTATCACATTTAGACAGCCTATCCTGTTTCTTCCACTGTCTCTGACCCTAATGCAGAAAGAGGGATATTTCTTGGAGAAAGGATTCCAAATCAGTTTTCTACCAACTCCCGCTGCCACTCTGAGACAAGCTTGTGTTCTTTTTTTATTTGTACAGTGTTGCAGTTTATTGGACTCAGGAC
  5   1   2       ext TpA       in                   TTpA055l14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGGGGATGTGTTTTTGTGTGCGAATACTTGGGCCTGGCTTTTAAAAAACACATGGCTTTAGACCAAATTTATGACAGTAGATATGAGAAACCTCTGAAGCACAACTGGACCCACTGATACAAATGGCTATTTAAGAAAAATCCAATGTTTACACCAAAACCAAGTCAGGATTTTCTTATCTTTATCCTTATCTGATCAGAAGTTGCTGATAAATAAGGAGTACATTTGCAGCTGCCATATTTTGGTGCCGTGATTGTACTGAAACTCAATAAAAGAAGCAGACAAATCATAGTCCAGTAGGGTAACGTCAAGTGCAAGTGACAAGCTATGCCCTGTGTTAGTTTAATAACCAGTTCAAAGACGTCACCTAGAGTCTCTCTTTTATCCGTAAGGATGCTGGGCAGCTCAAACTGTCTTGCTAACTATTGCTTGTGTGTCTAGCAGCCTAATACTGACCTTGAGTTATATCATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGA
  5   1   2       ext BrSp      in                     EC2BBA24CC02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCAAGTGACAAGCTATGCCCTGTGTTAGTTTAATAACCAGTTCAAAGACGTCACCTAGAGTCTCTCTTTTATCCGTAAGGATGCTGGGCAGCTCAAACTGTCTTGCTAACTATTGCTTGTGTGTCTAGCAGCCTAATACTGACCTTGAGTTATATCATTATTATTATTTATTCCATAGAGCTTAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGAGGAAACTGAAGTAACAGGAAGAAAACCCCCACAAATAGGAGAAGAATATACCTACTCCTTGCTGAGAGTGCCCTGACTGTAATTCAACCTTGAAGCCTCAGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTTTTCTGTTGAGTGGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGTAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCTCAGTTTAATCAGGGAAGGACACAATCCCAGTTTTTTA
  5   1   2       ext Te5       in                         CAAO6127.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAATCATCATACACATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGAGGAAACTGAAGTAACAGGAAGAAAACCCCCACAAATAGGAGAAGAATATACCTACTCCTTGCTGAGAGTGCCCTGACTGTAATTCAACCTTGAAGCCTCAGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTTTTCTGTTGAGTGGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGTAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCTCAGTTTAATCAGGGAAGGACACAATCCCAGTTTTTTATTTCTGTTCTTTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTACTAAGGGTCATGCTTCTGCACCCCTTAGTCTGCTTCCACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTA
  5   1   3        nb HdA       out                  THdA040d14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATTAATTCCTTGCCCAGAAAAGATTACAATTAAAGTCCCTATTACATTTACAAAACACTCTGTCAGTTGTATCACAAACCCAAGCCCCAAGCCGGCTTGTATGTCTTTGGAATGTGTGAGGAAACTGAAGTAACAGGAAGAAAACCCCCACAAATAGGAGAAGAATATACCTACTCCTTGCTGAGAGTGCCCTGACTGTAATTCAACCTTGAAGCCTCAGCACTACAAGGCAGCAATGCCAACGGCTGTGCTATTAGTGTTGCGTTGTAAATGGGGATTATTCTGCTTTTTGCAAAATAATTATTTTTCTGTTTTTCTGTTGAGTGGAAGCCCATTACTGATCGGACATTAGCTACCTCCCACTAGTCACAAACAGTAGTCTGGGCTTACTTTATGGCTGCATTTAAATGATGGAATATTGTCAGGGTAGGACAAGAAAATGAAGCCTCAGTTTAATCAGGGAAGGACACAATCCCAGTTTTTTATTTCTGTTCTTTAGATCCATGATCCATTTTCAAAAATGGGACCTTGCAGAATAAATCTAAATTAAATCTAAATGAAGCACTACCTTGATTACCCTTAATTAATATTTTTTTTTGGTGATACACTAAAGGCGTCATTTATCTTGAAATGCGGACTAC
  3   1   4      seed Te4       in                         CAAN7990.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACATGAGTCCAGGGGCATAGTAAATTACCCCTACTATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   2       ext Te4       in                          CAAN404.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATATTTTATTCATCAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCCAGGCATTTTTGTGAGTGTTTATAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   2       ext TpA       in                    TTpA055l14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGAAATAGTTTTTATACTGTAGTAAAAGAACTGACATTCCTCAGGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCCTGAGAATCTTAATAAACCATTAAA
  3   1   2       ext Te5       in                         CAAO6127.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGCATTTTTGTGAGTGTTTATTAAGGATCTCAGATCTATCTGAGAACTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATGGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTTGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGTAATTAATGTTTACAACCTGAGAATCTTAATAAACCATTAAAATGC
  3   1   2       ext BrSp      in                     EC2BBA24CC02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGAAATTCATGACAGCTGGAGGACCACCGGTCTGATAAACTTGGTACGTGGGATTGATTTTCTTAAGCTCTGAAAATATTTGGTGCTGAATTATTTAGCTGCTTATGGACCAGAAAGCTCTATAAAAGGTATTGGTTAATTTCCATAGTCCTGTTTTTTTACTTCAACCTACGGCATTTTCTATAATATAATTCACAGGGTCTGGATTTTGTTTATTGCCATCACTCTAAATACAATTTAATTGGCCTCCACCAACACACACTATTTGGGTTGCAGGGATCCACCATCAGCACCAAGATATATTGTCGACAAAAGGCACTGAAAGGTTCATTTGAGGCTACCAATAGTTCTTGACTTAAGATCAAATAAGGGGACATTCCATTTAGGTGTTTCTGTGTAATGGGGATTGAGTTGATAAACCATAGCTTGGCAGCCTAAAGCTCTTCCACTTATTGATCTTTACCTCCCATCAGCTTCAGCAAGCTGGTGCCAGGCAGGTTATGGCAGGGGCAGAGAGCTGCAGGCTGTTGGATTAAGCACCCCTTGTGCCTGGTAACCCTGCTCCTTTGTTTCCATTTGAAGTATTTTTGTGACCCTCTGCCCTGTAGTAGCCCACCTTGAACAGTGCATATCCTGCGTACAAATATTTCTTATATTAATTGTTGCTGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)