Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012072162 Xt7.1-TTbA004h14.3 - 114 ESTs
                                                                       .-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA004h14.3                                                                                                                                                                  TGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTAAAAAAAAAAAAAAAAAAAAAAAGAATGTTAACCATTTTCCCTGTGTTTTATGTGATGCCCTCTTTCCATACACACAAAATATATATTTAACACGGGTCTTTCAGCCCATAGCGCCATCTCGAGGCGGCCAGTGGAACGATGCACCCTGCCACTTTGGTTTTTAGTTTTAAAGGTTGGACACTCTCTACACTAGAAGAGCCGAAATTCCAATTTAAAAATCAGAATCCTAGCTCTTGAAATTACCAGAGGCGGCTTTTTGTTGCCCCTGGTAACTTCAGGGTCTCCGCCGACTGAGGCAGGTTTCTTAACATACTGCATGGCAGTGCCCCTGATTTAACATAATTAACTTTGCCTATTATAAGTAGCTTGAACAGTCCTGCACAAGGATACATATATAATAATTAGATATTCAAAAAGTAGAACTTTTTGTACAAGACCTTTTAAAGATTAAAATTCTGCTGACTTTACCAGCACATGTTGTCACAAACTACATGCAGTAGAAGTTGGTTCTAAAATTTTGAAAACCATTTCATGCTATACAGTAGGTATGTGACCTCTTGTACAGAATGCTTGGGACCTAGGGTTTTCTGGATAAGGGATCTTTCCTTAATTTTGATTACTATGCCTTAAGTCTAATAAAAGCA
                                                  Xt7.1-CHK-1008222874                                                                                                                                                                        GCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTAAAAAAAAAAAAAAAAxxxAAAAGAATGTTAACCATTTTCCCTGTGTTTTATGTGATGCCCTCTTTCCATACACACAAAATATATATTTAACACGGGTCTTTCAGCCCATAGCGCCATCTCGAGGCGGCCAGTGGAACGATGCACCCTGCCACTTTGGTTTTTAGTTTTAAAGGTTGGACACTCTCTACACTAGAAGAGCCGAAATTCCAATTTAAAAATCAGAATCCTAGCTCTTGAAATTACCAGAGGCGGCTTTTTGTTGCCCCTGGTAACTTCAGGGTCTCCGCCGACTGAGGCAGGTTTCTTAACATACTGCATGGCAGTGCCCCTGATTTAACATAATTAACTTTGCCTATTATAAGTAGCTTGAACAGTCCTGCACAAGGATACATATATAATAATTAGATATTCAAAAAGTAGAACTTTTTGTACAAGACCTTTTAAAGATTAAAATTCTGCTGACTTTACCAGCACATGTTGTCACAAACTACATGCAGTAGAAGTTGGTTCTAAAATTTTGAAAACCATTTCATGCTATACAGTAGGTATGTGACCTCTTGTACAGAATGCTTGGGACCTAGGGTTTTCTGGATAAGGGATCTTTCCTTAATTTTGATTACTATGCCTTAAGTCTAATAAAAGCATATAAA
                                                      consensus depths                                                                                                                                                                      16    17    28    29    30    30    31    31    31    31    31    32    31    32    32    33    32    33    33    33    34    34    34    34    34    34    34    34    34    34    34    34    36    36    36    36    36    36    36    36    36    36    36    36    36    37    36    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    38    38    38    38    38    39    39    39    39    39    39    39    39    39    39    39    38    39    38    40    38    39    38    39    38    39    38    39    38    39    37    38    38    39    37    39    36    38    35    37    33    36    33    35    33    35    34    36    32    35    33    36    34    36    31    35    31    34    31    34    32    35    31    32    32    33    32    33    27    32    29    30    27    27    24    26    24    27    25    27    23    24    22    24    24    25    25    27    24    26    26    28    26    28    26    28    26    28    30    33    30    34    31    34    31    34    32    36    35    37    36    38    37    39    39    41    40    41    40    41    41    42    40    41    42    42    41    43    46    47    46    47    50    50    49    49    50    50    51    51    51    51    53    53    52    53    53    53    53    53    53    53    52    53    53    53    52    54    52    54    53    54    50    54    52    53    49    55    54    56    51    56    53    56    52    56    52    56    49    56    52    55    50    55    48    53    50    55    51    55    51    55    51    54    51    54    47    51    46    50    46    50    45    50    44    49    41    48    20    32    20    25    21    23    21    22    21    22    21    22    21    22    21    22    21    22    23    24    23    24    23    24    22    23    22    23    22    23    22    23    21    24    21    24    19    24    19    25     7    15     9    12     4     9     4     9     4     9     4     9     4     9     5     9     5     9     5     8     5     8     5     8     5     8     5     8     6     9     6     9     6     9     6     9     7     9     6     9     7     9     7     9     7     9     7     9     7     9     7     9     6     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     6     9     7     9     8    10     8    10     8     9     8     9     8     9     8     9     8     9     6     9     6     9     5     8     4     7     4     7     4     7     3     7
                                                                   SNP                                                                                                                                                                                                                                          --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------C-
                                               BLH ATG      -1    1538                                                                                                                                                                  
                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 1e-007     NP_499836.1 tyrosinase family member (77.8 kD) (3O835) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Br ==== 4e-018     AAO13798.1 TYROSINASE-RELATED PROTEIN 1 [Branchiostoma belcheri tsingtaunese] ====================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                        PROTEIN --- Bf ---- 3e-067     AAM18867.1 unknown [Branchiostoma floridae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                           PROTEIN --- ?? ---= 2e-149     NP_001080492.1 tyrosinase-related protein 1 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 0          NP_571630.1 dopachrome tautomerase [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 0          NP_034154.1 dopachrome tautomerase; tyrosinase-related protein-2 [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 0          NP_001913.2 dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2);Dopachrome tautomerase (dopachrome delta-isomerase; tyrosinase-related protein2) [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                              PROTEIN --- Gg ---- 0          NP_990266.1 tyrosinase-related protein-2 [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                             PROTEIN -== Xl ==== 0          AAH97647.1 Unknown (protein for IMAGE:5572665) [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                       PROTEIN === Xt ==== 0          CAJ83137.1 dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2) [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA004h14.3                                                                                                                                                                 ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------TGA------------------------TGA---------------------------------------ATG------------------------------------------TAA------------------TGA---------TAA------TAG---ATG------------TAA---TAA---------------------------TAA------------------ATGTGA---------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------ATG---------------TAA------TAA------------TAA------TGA------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------ATGTGA---------------------------------------TAA------------TAA---TGA
                                                                   ORF                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2       bld Te5       in                         CAAO7705.5p GGCATGAGTGGCCCCAGCCTGCGTGTTGGCAGATTAATTGCATGTAATTAGACATGAGACATTTGGCCTCCCAGTGAATGGCTGATTGTGAGTCCGTGTGCATGTGACACACACTAGCCGATAAGTAGCGGGGCCCGCCAGTGAGAGGAGCAGAGCGGAGATGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGC
  5   1   2       bld Egg  5g3  in                   TEgg004d07.p1kSP6                                                                                                                                                      CCGGGGCCCGGGGGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGCCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTT
  5   1   2       bld HeRe 5g3  in                     EC2CAA15CB11.g1                                                                                                                                                      GCAGAGCGGAGATGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGCCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACAATTCATCCTGACTAAGTGATTGCTACTC
  5   1   2       bld 1030 5g                         IMAGE:7091048.5p                                                                                                                                                       GAGAGCGGAGATGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGNCATTGACTTCTCCCACAGGGNACAGCGTTT
  5   1   2       bld 1030 5g                         IMAGE:7028892.5p                                                                                                                                                         GAGCGGAGATGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCCATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCCTTACTACTCCGTTAAGGACACATTGCTAGGACCAGGACGTTCCCTTCACTGCAATTGACTTCTCCCACAGGGGACCAGCGTTTTGAAACTTGGGCATCGTTTACACCCTGTTTCCTGCTGGAAAAAAAATCTTTCAAAAAAATGAACGGGCAAATAAATCCTTTTGCCTTTACCATATTTGGAACCTTTTGCACTGGGAA
  5   1   2       bld TbA  5g                        TTbA071h24.p1kSP6                                                                                                                                                          AGCGGAGATGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGCCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGA
  5   1   2   10  bld Te1  5g3  in                        CBWN16852.b1 ..............................................................................................................................................................AGATGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGCCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACAATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGATGACCCTAATCTGATAAGTGCTGGATCC
  5   1   2   22  bld Tad5 5g                              XZT34183.5p ...............................................................................................................................................................GATGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGCCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGAT
  5   1   2   10  bld Tbd1 PIPE in                          CBXT864.b1 ...............................................................................................................................................................GATGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGCCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTG
  5   1   2   10  bld Eye  5g3  in                         CCAX5907.b1 ...............................................................................................................................................................GATGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTA
  5   1   2      seed TpA  FL   in                   TTpA009b19.p1kSP6                                                                                                                                                                 ATGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGCCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATT
  5   1   2       bld TpA  5g3  in                   TTpA078e04.p1kSP6                                                                                                                                                                 ATGGAGTGCAAGGGTGTCAGGGCTGTGTTGTTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCCTATCTGATAAGTGCTGGATCCCGATC
  5   1   2   10  bld Te1  5g3  in                        CBWN14854.b1 ................................................................................................................................................................ATGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGCCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATG
  5   1   2       bld Gas                            TGas065n02.p1cSP6                                                                                                                                                                  TGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGCCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCT
  5   1   2       bld TbA       in                   TTbA004h14.p1kSP6                                                                                                                                                                  TGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTG
  5   1   2       bld HdA       in                  THdA036j17.p1kbSP6                                                                                                                                                                  TGGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGCCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGC
  5   1   2       bld Eye       in                         CCAX2876.b1                                                                                                                                                                  GGAGTGCAAGGGTGTCAGGCGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTT
  5   1   2       bld Tad0                               IMAGE:6984975                                                                                                                                                                   GGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTNNACATATGGAAACTTGCACTGGAANGATGAGTGTGATGTT
  5   1   2       bld Eye                                  CCAX6279.b1                                                                                                                                                                   GGAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCT
  5   1   2       bld TpA       in                   TTpA005e13.p1kSP6                                                                                                                                                                    GAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGNCACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAAT
  5   1   2       bld TpA       in                   TTpA057j16.p1kSP6                                                                                                                                                                    GAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGATGACCCNTATCTGATAAGTGCTGGATCCCGATTTCTCACGCTGGGGAATTGTGTGNCACAGTCTGAATG
  5   1   2       bld TpA       in                   TTpA072c05.p1kSP6                                                                                                                                                                    GAGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGCCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCNTATCTGATAAGTGCTGGATCCCGATTCTC
  5   1   2       bld TpA       in                   TTpA002i11.p1kSP6                                                                                                                                                                     AGTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGCCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGATGACCCTAATCTG
  5   1   2       bld Tad5      in                         XZT57662.5p                                                                                                                                                                      GTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGATGA
  5   1   2       bld Eye       in                         CCAX5358.b1                                                                                                                                                                      GTGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAAC
  5   1   2       bld HdA                            THdA011c18.p1kSP6                                                                                                                                                                       TGCAAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAAGACGTCTCCTTCACTGC
  5   1   2       bld Egg       in                   TEgg048d13.p1kSP6                                                                                                                                                                          AAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGCCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCA
  5   1   2       bld HdA       in                   THdA049m02.p1kSP6                                                                                                                                                                          CAGGGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGCCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGATGACCCTAATCTGATAAGTGCT
  5   1   2       bld TpA       in                   TTpA049m10.p1kSP6                                                                                                                                                                             GGTGTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGATACTGCTGGAAAGAGATNCTCAGAGAATGACTGGNCATGAGTCCCTTTGCTTACCATATTGGAAACTTTGCACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACNCCTATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAAATGTGTGNCACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTA
  5   1   2       bld Gas8      in                          st35n13.5p                                                                                                                                                                                GTCAGGGCTGTGTTGCTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTG
  5   1   2       bld Eye       in                         CCAX4500.b1                                                                                                                                                                                               CTCCTCGCTTGCTGCCTCCAGGCGGTTCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAAT
  5   1   2       bld Tad5      in                          XZT3477.5p                                                                                                                                                                                                                         GGCGCGCCCAATTCCCGCGGTCCTGTGTGACGGTGGAGGCGCTCACTTCCAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCCTGTGTATGGAACTAATGAAGGGTTTCTTCAGAGAAACTCTTTGGGTGGTGCAGAAG
  5   1   2       bld Te5       in                         CAAO3937.5p                                                                                                                                                                                                                                                 TGTGACGGTGGAGGCGCTCACTTCCAAGCGCTGCTGCCCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTC
  5   1   2       bld Tad0                               IMAGE:6985679                                                                                                                                                                                                                                                                                      CCCGCTCTGGGCTCCGACCTCAACAACGTATGCGGCTCCCTGGAGGGTCGGGGCCAGTGCACCCCTGTGGTTGTGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGNCACAGTCTGAA
  5   1   2       bld HeRe      in                     EC2CAA38CB02.g1                                                                                                                                                                                                                                                                                                                                                               TGGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACAATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAACATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGAC
  5   1   2       bld Gas7      in                         XZG42105.5p                                                                                                                                                                                                                                                                                                                                                                GGATGAGCGGCCCTGGAGCGGACCCTATACCCTGCGCAATGTGGATGATCGGGAGCGCTGGCCGCTGAAGTTCTTTAACTCCATCTGCAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAG
  5   1   2       bld Te1       in                         CBWN6959.b1                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGCATGCTGGGAGCGGCTGTTCTGTAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGA
  5   1   2       bld Ova1      in                         CABE8559.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              AATCGGCACGAGGTGCACAGGGAACTTTGCAGGATTTAATTGTGGAGAATGCAAATTTGGCTGGACGGGACCCACTTGTGAGCAGCGGAAGCCCCCGGTTGTGCGAAAAAATATCCATTCATTGACTGCACAGGAGAGAACTCAGTTTTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTNCACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTT
  5   1   2       add Eye       in                         CCAX4261.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAATATATCCATTCATTGACTGCACAGGAGAGGACTCAGTTTTTGGATGCTCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCTATG
  5   1   2       bld Eye       in                         CCAX6798.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGAATCTGGCCGCTTGGATGCGCTGGATCAAGCCAAGAATACGATTCATCCTGACTATGTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTC
  5   1   2       bld Eye       in                         CCAX2676.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGATTGCTACTCAGCATTGGCTAAGCATTCTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGA
  5   1   2       bld TbA                            TTbA018l20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGGGCCCAATGGAACAGAACCACAAGTGGCAAATACTAGCATCTACAACTATTTTGTGTGGCTTCATTACTACTCTGTTAGGGACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCANGAATTCTACTTTCAGCTTCCGGAATG
  5   1   2       bld Tbd1      in                        CBXT17366.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACACATTGCTAGGACCAGGACGTCCCTTCACTGCAATTGACTTCTCCCACCAGGGACCAGCGTTTGTAACTTGGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCC
  5   1   2       bld Tad5      in                         XZT18921.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCATCGTTACCACCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGGCTCTCCTAGTGCTCTTCATGCAAAAGAAACGTC
  5   1   2       bld HeRe                             EC2CAA26AH06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGCCACCTGTTACTGCTGGAAAGATATCTTCATAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAATGAATGACTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGATGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGCGACCCTGTGTAATGGAACTAATGAAGGGT
  5   1   2       bld Tad5      in                         XZT55944.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTGTTACTGCTGGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGATGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAGCCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAAC
  5   1   2       bld Tad5      in                         XZT61160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAAAGAGATCTTCAGAGAATGACTGGCAATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGATGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAGCCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGAT
  5   1   2       bld Tbd1      in                        CBXT22876.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATGAGTCCTTTGCTTTACCATATTGGAACTTTGCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGATGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCATACTTTTACTTCTG
  5   1   2       bld HeRe      in                     EC2CAA12CA09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAACTGGAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCT
  3   1   2       bld Ova1      in                         CABE8559.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGGAATGAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTAAAAA
  3   1   2       chi HdA       out                   THdA013a09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTGTGATGTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTATCGGATGGGTGCATGAGTGGTGACATTATCAGTGGGGTCCTGATAGTTGCCCATCTCTGGGTGTTACACATGCAAAGAAAATGTGAACTCGGATGTTCCCCTCCCATAAAACCCACAGGGGCCGACGGGAGTTGCACAAAATAGGCCAATCGTGTCAAAGGTTACTAATAAGGACCGGCGCCACAGGGGGAACCAATGTGAAAAAATGGAATTAAAGAGGAAATCAC
  5   1   2       bld Tad5      in                         XZT65571.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTATGTACTGACGAGTTATTTGGTGCACCCAGACTGGACGACCCTAATCTGATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAATCAGAGATACACAGAAGATGCATAACATAANCATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTA
  5   1   2       bld TbA       in                   TTbA080a16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATAAGTGCTGGATCCCGATTCTCACGCTGGGGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAGCCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGATTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTC
  3   1   2       bld Gas8      in                          st35n13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGCTGGGGAATTGGTGCANCAGTCTGAATGANTACCATCGGCTTGTGACCCTGTGTAATGGNACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGTAAGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCG
  3   1   2       bld Te1  5g3  in                        CBWN16852.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGAATTGTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTTCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCAGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACCAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT61160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGTGCAACAGTCTGAATGATTACAATCGGCTTGTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAGCCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCAGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACGTGGTTATCACT
  3   1   2       bld Tad5      in                         XZT65571.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCCCT
  5   1   2       bld Eye                                  CCAX9325.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACCCTGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACT
  3   1   2       bld Te1  5g3  in                        CBWN14854.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTGTAATGGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                        CBXT22876.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCATACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCAGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTAAAAAAAAAAAAAAA
  3   1   2       bld Te1       in                         CBWN6959.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTAATGAAGGGTTTCTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA004h14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGAAGGGTTTTTTCAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tad5      in                         XZT55944.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAGCCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATGGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTTTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCAGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACT
  3   1   2       bld HeRe      in                     EC2CAA12CA09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGAAACCCTTTGGGTGGTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAAC
  3   1   2       bld Tbd1 PIPE in                          CBXT864.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGCAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAGCCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCAGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTAAAAAAAAAAAAAAA
  3   1   2       bld Te5       in                         CAAO7705.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGAAGGAAGGCTTCCATCCATGGAAGATGTGCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTTTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTTTATCGACCTACCAGCTTCCATGGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTTTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCCCT
  3   1   2       bld Eye       in                         CCAX5358.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGAAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTA
  3   1   2       bld Eye       in                         CCAX2676.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTA
  5   1   2       bld Ova1      in                         CABE1630.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTAC
  3   1   2       bld Eye       in                         CCAX4500.g3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAAATGTCTCTCTTTGAATGAGTTTGATAAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTA
  3   1   2       bld HeRe      in                     EC2CAA38CB02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAAATGTCTCTCTTTGAATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCTGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTTCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAAC
  3   1   2       bld Eye       in                         CCAX2876.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTGAAATGAGTTTGATAATCCTCCCCTTCTTCCAGGAATTCTACTTTCAGCTTCCCGGAATGCCCTTGAAGGATTTGATGAACCCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTA
  3   1   2       bld Eye       in                         CCAX6798.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATGAGTTTGATAATCCTCCCTTCTTCAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTTCCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTA
  3   1   2       bld TpA  5g3  in                   TTpA078e04.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGAATTCTACTTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTTTTAAATGGAACTAGCGCACAGTCACATTTTTTTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTTTATCGACCTACCAGCTTCCATTGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTTTTCTTGCCGTACTTTTACTTTTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACGGGTTATCCCTNAAAAAAAAAAAAAAAAAAAAATAAAGAAAAAAAAA
  3   1   2       bld Eye  5g3  in                         CCAX5907.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAGGAATTCTACTTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTTTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTA
  3   1   2       bld TpA  FL   in                    TTpA009b19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTTTTAAATGGAACTAGCGCACAGTCACACTCTTTTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTTTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTTTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCCCCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCCCTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5  -1   2       bld TbA       out                  TTbA080c07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTTTTTATTAAATGGAACTAGCGCACAGTCACATTCTTTTGCCAATGACCCCATCTTTGTGGTGGTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGTTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTTCTCATGTTACCAATGAAGAGTTTTTCATACCAGCTGAACATGTTAGGATATGTTTATTGTATTGACGTACCAGCTTCCTTTGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTTCACTATGGATGGCATTGTTCTTGCGGTACTTTTACTTCTGTTTCTCCTAGTGCTGTTCATGCAAAGAAAACTTCAACAAGGATTTGAGCCAGTTAATGAATGCCACCTTTACCATACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTATCATTAAAAAAAATAAAAAAAAGCGG
  3   1   2       bld TpA       in                   TTpA049m10.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGCTTCCGGAATGCCCTTGAAGGATTTGATGAACCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTTTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATTTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATGGTTCTTTAATATTTAAAAAAAAAAAAAAA
  3   1   2       bld HdA       in                    THdA049m02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAATGCCCTTGAAGGATTTGATGAGCCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCAGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld TpA       in                    TTpA057j16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATGAGCCAGATGGACATAAAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCAGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTTAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg048d13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAGCCAGATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCAGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCGATAGGCCCATGTATTGGCTTCTTTAATATTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT18921.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGGAACATTAAATTCAACAGCAATGAGTCTACATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTTAAAAAAAAAAAAAAAGG
  5   1   2       bld Tbd1      in                        CBXT21581.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATAACCTTGTCCATTCTTTCTTAAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGG
  3   1   2       bld HdA       in                   THdA036j17.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATGGAACTAGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld TpA                             TTpA021h11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCGCACAGTCACACTCTTCTGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Lun1      in                         CABD3738.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATCGATTCAATTCGGCCGAGGGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                        CBXT21581.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTTTAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG42105.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAATACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATNTTT
  3   1   2       bld Tad5      in                         XZT57662.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCAATGACCCCATCTTTGTGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATGGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTTTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCAGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTTTCCCT
  3   1   2       bld HeRe                             EC2CAA39DD11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAATGACCCCATCTTTGTGGTGCTGCACTCTTTTAATGATGCTATCTTTGATGAGTGGATGAAACGTTATCAGCCATCAGATGTTGCTTGGCCTCATGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACTTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTTCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTAAGATTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAAAATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATAC
  3   1   2       bld Tad5      in                          XZT3477.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Lun1      in                         CABD3738.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATT
  3   1   2       bld Te5       in                         CAAO3937.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCTGCACTCTTTTACTGATGCTATCTTTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTTT
  3   1   2       bld TbA       ?                     TTbA042j10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGATGAGTGGATGAAACGTTTTCAGCCATCAGATGTTGATTGGCCTCAAGAATTGGCTCCAATAGGGCACAACAAAATGTACAACATGGTGGCATTTTTTCTTCTTGTTACCAATTAAGAGATTTTCGTACCAGCTGAACAGTTAGGCTATGTTTATTCTATAGACCTACCAGGTTTCTTTGAAGACACCCGGGCAGTGGTTGTCCCGGCAGGGTCCACTATTGGTGGCATTCTTCCCGCCGTACTTTTAATTTTGGATATCATAGTGCTCTTCACCCAAAGAAAAATTCTACAAGGATTGGAGCCATTAAAGAAAGCCACCTTTTCCAACAAGAGATACACTGAAGAAGCATAACATAACAATTGTCCCACAAATAAACCAGTTTTTCAGTGTGAACCATAATGTTAATATCTTATTAAAAAGGTTATCAATAATAGGTTTTTGGAAAAAGATAATGTTTAAAACCTTAAAGATTTTTTTTGTTTTTGTTAGAAAATCAAATCCGGTTTATCCTGTATGATATGATAAATATTTTTGCACAGGGACACAAACATTATTTATGTGGGTACAGACTGAGTACAATTCCTATCTCAATCAAACTGCCTAAGTTCATTTTAAATTTACGTGAAGAGGGAAATAATATCCATAGGACAAGTATTGGCTTCTTTAATATTAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld HeRe                              EC2CAA4BH04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGATGAAACGTTTTCAGCCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTTCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAAC
  3   1   2       bld Egg  5g3  in                    TEgg004d07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGCTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCAGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGTCCATGTATTGGCTTCTTTAATATTTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA080a16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCAGATGTTGCTTGGCCTCAAGAATTGGCTCCAATAGGGCACAACCGTATGTACAACATGGTGCCATTCTTTCCTCCTGTTACCAATGAAGAGCTTTTCCTACCAGTTGAACAGTTAGGCTATGTTTATTCTATCGACCTACCAGCTTCCATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTATGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCAGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Eye       in                         CCAX4261.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATGAAGAGCTTTTCCTACCAGCTAAACAGTTAGGCTATGTTTTTTTTATCGACCTACCAGCTTCCATCGAAGACCCCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCAGCAAAGAAAAAGTCAACAAGGATTTGAGCCATTAATGAAACCCCCTTTAACAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTA
  3   1   2       bld Tbd1      in                        CBXT17366.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACACCCCGTGCAGTGGCTGTCCCTGGGTTGGGTCCCACTATTGGTGGCATTCTTTCTTGCCCGTACTTTTACTTCTGCTTTCTCCCTAGTGCTCTTCATGCAAAGAAAAACGTCCAACCAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTAAAAAAAAAAAAAAA
  5   1   2       bld HdA       in                   THdA011c05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCGAAGACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCAGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTTAAAAAAAAAAAAAAAAAAAAATCTAAAAGAATGTTAACCATTTTCCCTGTGTTTTATGTGATGCCCTCTTTCCATACACACAAAATATATATTTAACACGGGTGTTTCAGCCC
  3   1   2       bld TpA       in                   TTpA072c05.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACACCCGTGCAGTGGCTGTCCTGGTTGGGTCCACTATTGGTGGCATTCTTCTTGCCGTACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA002i11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TACTTTTACTTCTGCTTCTCCTAGTGCTCTTCATGCAAAGAAAACGTCAACAAGGATTTGAGCCATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCAGTACTTCAGTGGTACCATTAGTAAAATTTTATTAACTGGTTTCACTAAAAAAAAAAAAAA
  5   1   2       bld TpA       in                   TTpA064c11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGGGGATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTTT
  3   1   2       bld TpA       in                    TTpA064c11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGGGGATTAATGAATGCCACCTTTACCAACAAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCGGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTATATTTAAAAAAAAAAAAAAAAA
  5   1   2       bld TbA       in                  TTbA008e14.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAACAGAGATACACAGAAGATGCATAACATAACAATTGTAACAAAATAAACCAGTACTTCAGTGTGTACCATTATGTAAATATCTTATTAAACTGGTTATCACTATTAGGTTTTTGGAAAAAGCTTTTGTTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTTAAAAAAAAAAAAAAAAAAAATCTAAAAGAATGTTAACCATTTTCCCTGTGTTTTATGTGATGCCCTCTTTCCATACACACAAAATATATATTTAACACGGGTGTTTCAGCCCATAGCGCCATCTCGAGGCGGCCAGTGGAACGATGCACCCTGCCACTTTGGTTTTTAGTTTTAAAGGTTGGAcactctctacactagaagagccgaaattccaatttaaaaatcagaatcctagctcttgaaattaccagaggcggctttttgttgcccctggtaacttcagggtctccgccgactgaggcaggtttcttaacATACTGCATGGCAGTGCCCCTGATTTAACATAATTAACTTTGCCTATTATAAGTAGCTTGAACAGTCCTGCACAAGGATACATATATAATAATTAGATATTCAAAAAGTAGAACTTTTTGTACAAGACCTTTTAAAGATTAAAATTCTGCTGACTTTACCAGCACATGTTGTCACAAACTACATGCA
  5   1   2       bld TpA       in                   TTpA074j21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTGTTAAAACCTTAAAGATTTTCTTTGTTATTGTTTGAAAATCATATCCGGTTTATCCTGTATGATATGATAAATATTTTCGCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTTTAAAAAAAAAAAAAATCTAAAAGAATGTTAACCATTTTCCCTGTGTTTTATGTGATGCCCTCTTTCCATACACACAAAATATATATTTAACACGGGTCTTTCAGCCCATAGCGCCATCTCGAGGCGGCCAGTGGAACGATGCACCCTGCCACTTTGGTTTTTAGTTTTAAAGGTTGGAcactctctacactagaagagccgaaattccaatttaaaaatcagaatcctagctcttgaaattaccagaggcggctttttgttgcccctggtaacttcagggtctccgccgactgaggcaggtttcttaacATACTGCATGGCAGTGCCCCTGATTTAACATAATTAACTTTGCCTATTATAAGTAGCTTGAACAGTCCTGCACAAGGATACATATATAATAATTAGATATTCAAAAAGTAGAACTTTTTGTACAAGACCTTTTAAAGATTAAAATTCTGCTGACTTTACCAGCACATGTTGTCACAAACTACATGCAGTAGAAGTTGGTTCTAAAATTTTGAAAACCATTTCATGCTATACAGTAGGTATGTGACCTCTTGTACAGAATGCTTGGGACCTAGGGTTTTCTGGA
  3   1   2       bld Ova1      in                         CABE1630.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCACAGGTACACAAACATTATTTATGTGGGTACAGACTGACTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTTTAAAAAAAAAAAAAATCTAAAAGAATGTTAACCATTTTCCCTGTGTTTTATGTGATGCCCTCTTTCCATACACACAAAATATATATTTAACACGGGTCTTTCAGCCCATAGCGCCATCTCGAGGCGGCCAGTGGAACGATGCACCCTGCCACTTTGGTTTTTAGTTTTAAAGGTTGGAcactctctacactagaagagccgaaattccaatttaaaaatcagaatcctagctcttgaaattaccagaggcggctttttgttgcccctggtaacttcagggtctccgccgactgaggcaggtttcttaacATACTGCATGGCAGTGCCCCTGATTTAACATAATTAACTTTGCCTATTATAAGTAGCTTGAACAGTCCTGCACAAGGATACATATATAATAATTAGATATTCAAAAAGTAGAACTTTTTGTACAAGACCTTTTAAAGATTAAAATTCTGCTGACTTTACCAGCACATGTTGTCACAAACTACATGCAGTAGAAGTTGGTTCTAAAATTTTGAAAACCATTTCATGCTATACAGTaggtatgtgacctcttgtacagaatgcttgggacctagggttttctggataagggatctttccttaattttgattactatgccttaagtctaataaaaGCATATAAACATG
  3   1   2       bld TbA       in                   TTbA008e14.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGGTACACAAACATTATTTATGTGGGTACAGACTGANTACAATTCCTATCTCAATCAAACTACCTAAGTTCATTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTTAAAAAAAAAAAAAAAAAAAATCTAAAAGAATGTTAACCATTTTCCCTGTGTTTTATGTGATGCCCTCTTTCCATACACACAAAATATATATTTAACACGGGTGTTTCAGCCCATAGCGCCATCTCGAGGCGGCCAGTGGAACGATGCACCCTGCCACTTTGGTTTTTAGTTTTAAAGGTTGGACActctctacactagaagagccgaaattccaatttaaaaatcagaatcctagctcttgaaattaccagaggcggctttttgttgcccctggtaactTCAGGGTTTCCGCCGACTGAGGCAGGTTTTTTAACATACTGCATGGCAGTGCCCCTGATTTAACATAATTAACTTTGCCTATTATAAGTAGCTTGAACAGTCCTGCACAAGGATACATATATAATAATTAGATATTCAAAAAGTAGAACTTTTTGTACAAGACCTTTTAAAGATTAAAATTTTGCTGACTTTACCAGCACATGTTGTCACAAACTACATGCAGTAGAAGTTGGTTTTAAAATTTTGAAAACCATTTCATGCTATACAGTAGGTATGTGACCTCCTTGTAcagaatgcttgggacctagggttttttggataagggatctttccttaattttgattactatgccttaagtctaataaaaggcatataaacattgaataaacccaGAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld HeRe 5g3  in                     EC2CAA15CB11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTTTTTTTATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAACATTCTTTTAGATTTTTTTTTTTTTTAAATATTAACCATTTTCCCTGTGTTTTATGTGATGCCCTCTTTCCATACACACAAAATATATGTTTAACACAGGGGTGTTTCAGCCCATAGCGCCATCTCGAGGCGGCCAGTGGAACGATGCACCCTGCCACTTTGGTTTTTAGTTTTGAAGGTTGGACACTCTCTACACTAGAAGAGCCGAAATTCAGAAATCAGAATCTTAGCTCTTGAAATTACCAGAGGCGGCTTTTTGTTGCCCCTGGTAACTTCAGGGTCTCCGCCGACTGAGGCAGGTTTCTTAACTTACTGCATGGCAGTGCCCCTGATTTAACATAATTAACTTTGCCTATTATAAGTAGCTTGAACAGTCCTGCACAAGGATACATATATATTAATTAGATATTCAAAAAGTAGAACTTTTTGTACAAGACCTTTTAAAGATTAAAATTCTGCTGACTTTACCAGCACATGTTGTCACAAACTACATGCAGTAGAAGTTGGTTCTAAAATTTTGAAAACCATTTCATGCTATACAGTAGGTATGTGACCTCTTGTACAGAATGCTTGGGACCTAGGGTTTTCTGGATAAG
  3   1   2       bld TpA       in                    TTpA005e13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTTGAAGAGGGAAATAATATCCATAGGCCATGTATTGGCTTCTTTAATATTTTAAAAAAAAAAAAAATCTAAAAGAATGTTAACCATTTTCCCTGTGTTTTATGTGATGCCCTCTTTCCATACACACAANAATATATATTTAACACGGGTCTTTCAGCCCATAGCGCCATCTCGAGGCGGCCAGTGGAACGATGCACCCTGCCACTTTGGTTTTTAGTTTTAAAGGTTGGAcactctctacactagaagagccgaaattccaatttaaaaatcagaatcctagctcttgaaattaccagaggcggctttttgttgcccctggtaacttcagggtctccgccgactgaggcaggtttcttaacATACTGCATGGCAGTGCCCCTGATTTAACATAATTAACTTTGCCTATTATAAGTAGCTTGAACAGTCCTGCACAAGGATACATATATAATAATTAGATATTCAAAAAGTAGAACTTTTTGTACAAGACCTTTTAAAGATTAAAATTCTGCTGACTTTACCAGCACATGTTGTCACAAACTACATGCAGTAGAAGTTGGTTCTAAAATTTTGAAAACCATTTCATGCTATACAGTaggtatgtgacctcttgtacagaatgcttgggacctagggttttctggataagggatctttccttaattttgattactatgccttaagtctaataaaaGCATATAAACATGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tad5                                 XZT19386.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGNNCGTCCGTTTAAAAAAAAAAAAAAAAAAAATCTAAAAGAATGTTAACCATTTTCCCTGTGTTTTATGTGATGCCCTCTTTCCATACACACAAAATATATATTTAACACGGGTGTTTCAGCCCATAGCGCCATCTCGAGGCGGCCAGTGGAACGATGCACCCTGCCACTTTGGTTTTTAGTTTTAAAGGTTGGAcactctctacactagaagagccgaaattccaatttaaaaatcagaatcctagctcttgaaattaccagaggcggctttttgttgcccctggtaacttcagggtctccgccgactgaggcaggtttcttaacATACTGCATGGCAGTGCCCCTGATTTAACATAATTAACTTTGCCTATTATAAGTAGCTTGAACAGTCCTGCACAAGGATACATATATAATAATTAGATATTCAAAAAGTAGAACTTTTTGTACAAGACCTTTTAAAGATTAAAATTCTGCTGACTTTACCAGCACATGTTGTCACAAACTACATGCAGTAGAAGTTGGTTCTAAAATTTTGAAAACCATTTCATGCTATACAGTAGGTATGTGACCTCCttgtacagaatgcttgggacctagggttttctggataagggatctttccttaattttgattactatgccttaagtctaataaaagcatataaacattgaataaacccagtaggattgttttgcctccaatTAATTATATCTTAAGTACAAGGTACTAATTTTAATATGGAGAACAAGGATATA
  3   1   2       bld HdA       in                    THdA011c05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAAAAAAAAAAAAAAAATCTAAAAGAATGTTAACCATTTTCCCTGTGTTTTATGTGATGCCCTCTTTCCATACACCCAAAATATATATTTAACACGGGTGTTTCAGCCCATAGCGCCATTTCGAGGCGGCCAGTGGAACGATGCACCCTGCCACTTTGGTTTTTAGTTTTAAAGGTTGGACActctctacactggaagagccgaaattccaatttaaaaatcagaatcttagttcttgaaattaccagagggggctttttgttgcccctggtaaTTTCAGGGTTTCCGCCGATTGAGGCAGGTTTTTTAACATATTGCATGGCAGTGCCCCTGATTTAACATAATTAACTTTGCCTATTATAAGTAGCTTGAACAGTCTTGCACAAGGATACATATATAATAATTAGATATTCAAAAAGTAGAACTTTTTGTACAAGCCCTTTTAAAGATTAAAATTTTGTTGACTTTACCAGCACATGTTGTCACAAACTACATGCAGTAGAAGTTGGTTTTAAAATTTTGAAAACCATTTCATGCTATACAGTAGGTATGTGACCTCCTTGTACAGAATGCTTGGGACTTAGGGTTTTTTGGATAAGGGATCTTTCCTTAATTTTGATTACTATGCCTTAAGTTTAATAAAAGCTTATAACCTTTGAATAAAAAAAACCAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld TpA       in                   TTpA074j21.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGTTTTTAGTTTTAAAGGTTGGAcactctctacactagaagagccgaaattccaatttaaaaatcagaatcctagctcttgaaattaccagaggcggctttttgttgcccctggtaacttcagggtctccgccgactgaggcaggtttcttaacATACTGCATGGCAGTGCCCCTGATTTAACATAATTAACTTTGCCTATTATAAGTAGCTTGAACAGTCCTGCACAAGGATACATATATAATAATTAGATATTCAAAAAGTAGAACTTTTTGTACAAGACCTTTTAAAGATTAAAATTTTGCTGACTTTACCAGCACATGTTGTCACAAACTACATGCAGTAGAAGTTGGTTTTAAAATTTTGAAAACCATTTCATGCTATACAGTaggtatgtgacctcttgtacagaatgcttgggacctagggttttctggataagggatctttccttaattttgatTACTATGCCAAAAGTGCTAATAAAAGCCATATAAACATTGAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg                            TEgg079d13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACATGTCACAAACTACATGCAGTAGAAGTTGGTTCTAAAATTTTGAAAACCATTTCATGCTATACAGTaggtatgtgacctcttgtacagaatgcttgggacctagggttttctggataagggatctttccttaattttgattactatgccttaagtctaataaaagcatataaacattgaataaacccagtaggattgttttgcctccaatTAATTATATCTTAAGTACAAGGTACTAATTTTAATATGGAGACAAAGGATATAATTTTAAAACATGAATTAACCTTATTCAGAGCTTTCTGTATAATGGGTTTCTGCATAACTGATCTCATACCTGTACAAATAACCCCTTTAAGGGGAAACGAGGGGCGGGGTCACTTGGGGGTGCCAGGGTGTTGGGCACCCCCGGGTGACTTTGACCGTACCCCGGGCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)