Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 436.0    0Xt7.1-CABC1437.3.5                        145 PI      75       1044     1938                Fzd2-prov protein [Xenopus tropicalis]
     2 179.0    0Xt7.1-CBSU1622.3                            2 PI      98       4028     4124                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012072186 Xt7.1-TNeu106l13.3.5 - 142 ESTs
                                                                       .......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TNeu106l13.3.5                                                                                                                                                                                                                                                                                                                                                            GGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCGGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGAGCGGGGGAGATCTGCGTGGGGCAGAACACTTCGGATAACAGCCCGTCCGGCCCCACCGCCCGGCCCACCCCTTACCTGCCGGACAGTATCACCTTCCACCCTCACCCCAACCGGGACTTCACCTGCCCGCGGCAGCTCAAGGTGCCCCCCTACCTGGGCTACCGCTTTCTGGGCGAGAAGGACTGCGGCGCCCCCTGCGAGCCGGGCAAGGCCAATGGGCTCATGTACTTTAAGGAGGAAGAAGTGCGCTTCGCCCGGCTGTGGGTGGGCATCTGGGCCATCCTGTGCGGCATCTCCACACTCTTCACCGTGCTCACCTACCTGGTGGATATGCGGCGTTTCAGCTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGCTACTTCATGGTGGCCGTGGCTTACACCGCGGGGTTCCTGCTGGAGGAGCGGGGGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACTGTGGCGCAGGGCACCAAGAAGGAGGGCTGCACCATCCTCTTCATGATCCTCTACTTCTTTGGCATGGCCAGCTCCATCTGGTGGGTTATACTGTCCCTTACCTGGTTCCTGGCGGCGGGCATGAAGTGGGGGCACGAAGCCATCGAGGCCAACTCGCAATACTTCCACTTGGCAGCCTGGGCAGTGCCCGCAGTGAAGACCATCACCATCCTGGCTATGGGGCAGGTGGATGGGGACATACTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCCCTGAGGGGCTTCGTACTCGCCCCCCTCTTCGTGTACCTGTTCATCGGCACCTCCTTCCTGCTGGCCGGCTTCGTGTCCCTGTTCCGCATCAGGACCATTATGAAACACGATGGCACCAAAACGGAGAAGCTGGAGAAACTGATGGTGCGCATCGGGGTGTTCAGCGTCATGTACACTGTGCCGGCCACCATCGTGCTGGCTTGTTACTTCTACGAGCAGGCCTTCAGGGACACATGGGAAAAGACCTGGCTGGTACAGACCTGCAAAGGCTTTGCTGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTCTTTATGATCAAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222427                                                                                                                                                                                                                                                                                                                                                                  TACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAAAACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCGGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGAGCGGGGGAGATCTGCGTGGGGCAGAACACTTCGGATAACAGTCCGTCCGGCCCCACCGCCCGGCCCACCCCTTACCTGCCGGACAGTATCACCTTCCACCCTCACCCCAACCGGGACTTCACCTGCCCGCGGCAGCTCAAGGTGCCCCCCTACCTGGGCTACCGCTTTCTGGGCGAGAAGGACTGCGGCGCCCCCTGCGAGCCGGGCAAGGCCAATGGGCTCATGTACTTTAAGGAGGAAGAAGTGCGCTTCGCCCGGCTGTGGGTGGGCATCTGGGCCATCCTGTGCGGCATCTCCACACTCTTCACCGTGCTCACCTACCTGGTGGATATGCGGCGTTTCAGCTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGCTACTTCATGGTGGCCGTGGCTTACACCGCGGGGTTCCTGCTGGAGGAGCGGGGGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACTGTGGCGCAGGGCACCAAGAAGGAGGGCTGCACCATCCTCTTCATGATCCTCTACTTCTTTGGCATGGCCAGCTCCATCTGGTGGGTTATACTGTCCCTTACCTGGTTCCTGGCGGCGGGCATGAAGTGGGGGCACGAAGCCATCGAGGCCAACTCGCAATACTTCCACTTGGCAGCCTGGGCAGTGCCCGCAGTGAAGACCATCACCATCCTGGCTATGGGGCAGGTGGATGGGGACATACTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCCCTGAGGGGCTTCGTACTCGCCCCCCTCTTCGTGTACCTGTTCATCGGCACCTCCTTCCTGCTGGCCGGCTTCGTGTCCCTGTTCCGCATCAGGACCATTATGAAACACGATGGCACCAAAACGGAGAAGCTGGAGAAACTGATGGTGCGCATCGGGGTGTTCAGCGTCATGTACACTGTGCCGGCCACCATCGTGCTGGCTTGTTACTTCTACGAGCAGGCCTTCAGGGACACATGGGAAAAGACCTGGCTGGTACAGACCTGCAAAGGCTTTGCTGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTCTTTATGATCAAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                 5     7     7    10     7    11     7    11     8    14     8    14     9    14     9    14     9    14     9    14     9    14     9    15    10    15    10    15    13    15    13    15    14    15    14    15    14    15    14    15    13    14    14    14    14    14    14    14    14    14    14    14    14    14    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    13    14    14    14    14    14    15    15    13    13    14    14    15    15    13    14    13    13    13    13    13    13    13    13    13    13    12    12    11    11    11    11     9     9     7     7     7     7     7     7     5     5     5     5     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     4     3     4     3     4     4     5     4     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     5     5     4     5     5     5     4     5     4     5     5     5     5     5     6     7     6     7     7     7     6     7     7     7     8     8     8     8     8     8     8     8     7     8     8     8     8     8     7     8     8     8     8     8     7     8     9     9     8     9     8     9     7     8     8     9     7     9     8     9     8     9     8    10     9    10     8    10     9    10    10    11     9    11     9    11    11    13    11    13    11    13    13    16    13    16    13    16    14    16    14    16    14    16    14    16    14    16    15    17    15    17    13    15    13    15    14    16    14    14    14    14    14    14    14    14    13    13    12    13    11    14    12    15    15    16    11    15    11    15    11    15    10    15    11    14    11    14    11    14    11    14    11    15    11    15    11    15    13    16    13    17    13    17    13    17    14    18    15    18    17    19    17    19    18    20    18    20    17    21    19    22    19    22    19    22    18    21    18    22    19    22    21    24    18    22    19    24    17    20    18    20    19    21    16    21    19    21    17    21    17    20    16    19    15    19    14    18    14    18    14    18    12    16    13    17    13    18    14    18    16    18    17    19    17    18    16    16    16    16    17    17    18    18    18    18    18    18    18    18    18    18    18    18    17    17    18    18    18    18    17    17    18    18    18    18    18    18    18    18    18    18    16    17    16    17    18    19    19    19    19    19    19    19    19    19    21    21    21    21    20    20    20    20    20    20    20    20    20    21    20    20    19    20    19    20    20    23    24    26    28    28    29    29    29    29    30    30    31    31    29    29    31    32    35    35    34    34    35    38    39    40    39    40    39    40    39    41    40    42    40    44    40    45    40    45    42    50    42    50    42    51    42    52    42    53    42    56    39    55    35    55    37    56    36    56    39    60    36    60    37    60    37    61    38    63    34    63    36    63    37    63    35    63    37    66    37    66    37    65    42    65    41    65    38    64    42    63    38    63    40    63    40    63    43    63    43    63    43    63    41    63    42    63    45    62    43    60    43    60    43    60    44    59    39    59    43    58    43    58    42    57    39    57    42    57    39    57    38    56    37    56    38    55    40    55    33    53    37    52    35    52    31    47    16    23     9    12     5     6
  5   1   2  SIG                                    Xt7.1-TNeu106l13.3                                                                                                                                                                                                                                                                                                                                                                AGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGAGGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCGGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGAGCGGGGGAGATCTGCGTGGGGCAGAACACTTCGGATAACAGTCCGTCCGGCCCCACCGCCCGGCCCACCCCTTACCTGCCGGACAGTATCACCTTCCACCCTCACCCCAACCGGGACTTCACCTGCCCGCGGCAGCTCAAGGTGCCCCCCTACCTGGGCTACCGCTTTCTGGGCGAGAAGGACTGCGGCGCCCCCTGCGAGCCGGGCAAGGCCAATGGGCTCATGTACTTTAAGGAGGAAGAAGTGCGCTTCGCCCGGCTGTGGGTGGGCATCTGGGCCATCCTGTGCGGCATCTCCACACTCTTCACCGTGCTCACCTACCTGGAGGATATGCGGCGTTTCAGCTACCCCGAGCGGGCCATCATCTTCCTGTCCGGCTGCTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTGGGTACCCGGGTCCGGGAATTCCCGGGGATCGAAGCCATCGAGGCCAACTCGCAATACTTCCACTTGGCAGCCTGGGCAGTGCCCGCAGTGAAGACCATCACCATCCTGGCTATGGGGCAGGTGGATGGGGACATACTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCCCTGAGGGGCTTCGTACTCGCCCCCCTCTTCGTGTACCTGTTCATCGGCACCTCCTTCCTGCTGGCCGGCTTCGTGTCCCTGTTCCGCATCAGGACCATTATGAAACACGATGGCACCAAAACGGAGAAGCTGGAGAAACTGATGGTGCGCATCGGGGTGTTCAGCGTCATGTACACTGTGCCGGCCACCATCGTGCTGGCTTGTTACTTCTACGAGCAGGCCTTCAGGGACACATGGGAAAAGACCTGGCTGGTACAGACCTGCAAAGGCTTTGCTGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTCTTTATGATCAAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2                                         Xt7.1-TEgg072h19.3                                                                                                                                                                                                                                                                                                                                                                  TGGATTGGGAACAGTTTATGATAGGCTGTGGAGGTGGGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTGTGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTCCCCTCCATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTCCCTTTTCTTTAGCGGATTAACTTTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTAATCACCCCTAATGTATTGTCTGCCCAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCCCAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTCCATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAACCCTCACTTTATCTTGTGTACAGATCACTCAATAAACCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TGas101b10.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCGCCTAACGGCTGTTAAAGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAAGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAAACAAAAGTGCATGGTTTCTTTGTCTCAGAGTGATGTATTCTGTTTTCCCTGCCTTTTTTAAGCTTTTCAAACAGGAAGTCTGATAAAGGCAAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                            TACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGAGTTAATCTGCTAAATAAACC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAACTTCCAGGG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                        -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                    -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----------C-
                                               BLH ATG     323     476                                                                                                                                                                                                                                                                                                                                                            
                                               BLH MIN     302     290                                                                                                                                                                                                                                                                                                                                                            
                                               BLH MPR     272     290                                                                                                                                                                                                                                                                                                                                                            
                                               BLH OVR     323     693                                                                                                                                                                                                                                                                                                                                                            
                                               EST CLI      -8      38                                                                                                                                                                                                                                                                                                                                                            
                                               ORF LNG     323     119                                                                                                                                                                                                                                                                                                                                                            
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Cs ---= 5e-103     BAB68350.1 Cs-frizzled3 [Ciona savignyi] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 3e-112     NP_492635.1 More Of MS MOM-5, Frizzled homolog (62.9 kD) (mom-5) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 8e-153     NP_524812.1 CG17697-PA [Drosophila melanogaster] ----------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ci ---- 1e-158     BAE06612.1 frizzled receptor [Ciona intestinalis] ---===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 2e-179     XP_781961.1 PREDICTED: similar to frizzled homolog 7b [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dr ---- 0          NP_571214.1 frizzled homolog 7a; frizzled homolog 7 [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Gg ---- 0          NP_989552.1 frizzled homolog 7 [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN -== Hs ==== 0          NP_003498.1 frizzled 7; frizzled (Drosophila) homolog 7; Frizzled, drosophila, homolog of, 7[Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Mm ---- 0          NP_032083.2 frizzled 7 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 0          AAF63152.1 transmembrane receptor frizzled-7 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === ?? ==== 0          NP_001079354.1 frizzled homolog 7 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 0          AAZ06130.1 frz7 [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu106l13.3.5                                                                                                                                                                                                                                                                                                                                                                       TGA---------------------------------------------------------------------------------TGA---------------------TAG---------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------ATG---ATG------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------TAA---------------------------------------------------------------------TAATGA------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------TGA------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------ATG---ATG------------------TAG------------------------ATG---------------------------------------------TAG---------------------------------------------------------------TAA------------------------------ATG---ATG---------------------------------TGA---------------------------------------------------------TAA---------------------------------------ATG------------------------------TAA------------------------------TAG---------------ATG------TAA---------------------TAA---------------TAA------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------TAG---------------------------------------------------TGA---------------------------TAA---------------------TGA------TAG------------------TAA---------------------------------------------------------------------------------------TAG------------ATGTAA------------------------------------------TAA---------TAA------ATG------------------------------------------------------------TAG------------------------TAG---------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------TAA------------------------------------TAA------------------------------------------TGA------------------------------------------------------------------------------------------TAA---------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2  SIG                                    Xt7.1-TNeu106l13.3                                                                                                                                                                                                                                                                                                                                                                AGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGAGGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCGGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGAGCGGGGGAGATCTGCGTGGGGCAGAACACTTCGGATAACAGTCCGTCCGGCCCCACCGCCCGGCCCACCCCTTACCTGCCGGACAGTATCACCTTCCACCCTCACCCCAACCGGGACTTCACCTGCCCGCGGCAGCTCAAGGTGCCCCCCTACCTGGGCTACCGCTTTCTGGGCGAGAAGGACTGCGGCGCCCCCTGCGAGCCGGGCAAGGCCAATGGGCTCATGTACTTTAAGGAGGAAGAAGTGCGCTTCGCCCGGCTGTGGGTGGGCATCTGGGCCATCCTGTGCGGCATCTCCACACTCTTCACCGTGCTCACCTACCTGGAGGATATGCGGCGTTTCAGCTACCCCGAGCGGGCCATCATCTTCCTGTCCGGCTGCTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTGGGTACCCGGGTCCGGGAATTCCCGGGGATCGAAGCCATCGAGGCCAACTCGCAATACTTCCACTTGGCAGCCTGGGCAGTGCCCGCAGTGAAGACCATCACCATCCTGGCTATGGGGCAGGTGGATGGGGACATACTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCCCTGAGGGGCTTCGTACTCGCCCCCCTCTTCGTGTACCTGTTCATCGGCACCTCCTTCCTGCTGGCCGGCTTCGTGTCCCTGTTCCGCATCAGGACCATTATGAAACACGATGGCACCAAAACGGAGAAGCTGGAGAAACTGATGGTGCGCATCGGGGTGTTCAGCGTCATGTACACTGTGCCGGCCACCATCGTGCTGGCTTGTTACTTCTACGAGCAGGCCTTCAGGGACACATGGGAAAAGACCTGGCTGGTACAGACCTGCAAAGGCTTTGCTGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTCTTTATGATCAAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008275178                                                                                                                                                                                                                                                                                                                                                                      TTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCGGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGAGCGGGGGAGATCTGCGTGGGGCAGAACACTTCGGATAACAGTCCGTCCGGCCCCACCGCCCGGCCCACCCCTTACCTGCCGGACAGTATCACCTTCCACCCTCACCCCAACCGGGACTTCACCTGCCCGCGGCAGCTCAAGGTGCCCCCCTACCTGGGCTACCGCTTTCTGGGCGAGAAGGACTGCGGCGCCCCCTGCGAGCCGGGCAAGGCCAATGGGCTCATGTACTTTAAGGAGGAAGAAGTGCGCTTCGCCCGGCTGTGGGTGGGCATCTGGGCCATCCTGTGCGGCATCTCCACACTCTTCACCGTGCTCACCTACCTGGAGGATATGCGGCGTTTCAGCTACCCCGAGCGGGCCATCATCTTCCTGTCCGGCTGCTACTTCAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGGGGCTTGGGTACCCGGGTCCGGGAATTCCCGGGGATCGAAGCCATCGAGGCCAACTCGCAATACTTCCACTTGGCAGCCTGGGCAGTGCCCGCAGTGAAGACCATCACCATCCTGGCTATGGGGCAGGTGGATGGGGACATACTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCCCTGAGGGGCTTCGTACTCGCCCCCCTCTTCGTGTACCTGTTCATCGGCACCTCCTTCCTGCTGGCCGGCTTCGTGTCCCTGTTCCGCATCAGGACCATTATGAAACACGATGGCACCAAAACGGAGAAGCTGGAGAAACTGATGGTGCGCATCGGGGTGTTCAGCGTCATGTACACTGTGCCGGCCACCATCGTGCTGGCTTGTTACTTCTACGAGCAGGCCTTCAGGGACACATGGGAAAAGACCTGGCTGGTACAGACCTGCAAAGGCTTTGCTGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTCTTTATGATCAAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1           Neu  FL                     TNeu065e03.FL-Sanger                                                                                                                                                                                                                                                                                                                                                          TGGGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAAAACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCGGAGCGGCTGCGCTGTGAGAATTTCCCGATACACGGAGCGGGGGAGATCTGCGTGGGGCAGAACACTTCGGATAACAGCCCGTCCGGCCCCACCGCCCGGCCCACCCCTTACCTGCCGGACAGTATCACCTTCCACCCTCACCTCAACCGGGACTTCACCTGCCCGCGGCAGCTCAAGGTGCCCCCCTACCTGGGCTACCGCTTTCTGGGCGAGAAGGACTGCGGCGCCCCCTGCGAGCCGGGCAAGGCCAATGGGCTCATGTACTTTAAGGAGGAAGAAGTGCGCTTCGCCCGGCTGTGGGTGGGCATCTGGGCCATCCTGTGCGGCATCTCCACACTCTTCACCGTGCTCACCTACCTGGTGGATATGCGGCGTTTCAGCTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGCTACTTCATGGTGGCCGTGGCTTACACCGCGGGGTTCCTGCTGGAGGAGCGGGGGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACTGTGGCGCAGGGCACCAAGAAGGAGGGCTGCACCATCCTCTTCATGATCCTCTACTTCTTCGGCATGGCCAGCTCCATCTGGTGGGTTATACTGTCCCTTACCTGGTTCCTGGCTGCGGGCATGAAGTGGGGGCACGAAGCCATCGAGGCCAACTCGCAATACTTCCACTTGGCAGCCTGGGCAGTGCCCGCAGTGAAGACCATCACCATCCTGGCTATGGGGCAGGTGGATGGGGACATACTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCCCTGAGGGGCTTCGTACTCGCCCCCCTCTTCGTGTACCTGTTCATCGGCACCTCCTTCCTGCTGGCCGGCTTCGTGTCCCTGTTCCGCATCAGGACCATTATGAAACACGATGGCACCAAAACGGAGAAGCTGGAGAAACTGATGGTGCGCATCGGGGTGTTCAGCGTCATGTACACTGTGCCGGCCACCATCGTGCTGGCTTGTTACTTCTACGAGCAGGCCTTCAGGGACACATGGGAAAAGACCTGGCTGGTACAGACCTGCAAAGGCTTTGCTGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTCTTTATGATCAAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGT
  5   1   0       chi Neu  5g                        TNeu021j16.p1kSP6 TTTTTTTTTTTTTTACAGGTATATACGGTTTTTAATATTACCCTTCCATATGCATTTTTACACAAGTGTTTTGCATTAAATGTAAGGAATGTATGCCTTACAGAGCACAATCTCACAGTAACAGGAGCACAAAACATTAAAGAACATCTTACACCTACCACTTCTAGGCATTACATACATTTAATGAAATTCTTATAGAAACACAGGCAGGGTTAGTTTTATACAGCAAGGTGCTCTTTTTCTTGGGGTCTTTAAATATGAGGGGAACACAATATGGCTCATGTGACAGAAAATCATGTCACTGTTATGGGCACTAAAACTGACTCCCGGGAATCCCCGGGGAGGTGGGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAAAACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTA
  5   1   2       ext Gas  5g                        TGas024l11.p1kSP6                                                                                                                                                                                                                                                                                                                                                GCTGTGGAGGTGGGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGAGGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGC
  5   1   4      seed Neu       in                   TNeu078k11.p1cSP6                                                                                                                                                                                                                                                                                                                                                    GGAGGTGGGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAAAAACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAAGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTT
  5   1   3        nb TbA  5g3  in                   TTbA058e10.p1kSP6                                                                                                                                                                                                                                                                                                                                                      TGGGAAATACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGAGGCGCCGTAAGGAATCGGTGCGCCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCCTACGGAGAAGGAGCGGACTCCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTG
  5   1   3        nb HdA  5g                        THdA006k16.p1kSP6                                                                                                                                                                                                                                                                                                                                                      GAGGTGGGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCGGAGCGGCTGCGCTGTGAGAATTTCCCGATACACGGAGCGGGGGAGATCTGCGTGGGGCAGAACACTTCGGATAACAGCCCGT
  5   1   3        nb Gas  5g                        TGas055e22.p1cSP6                                                                                                                                                                                                                                                                                                                                                       AGGTGGGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAAAACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCT
  5   1   3        nb Egg  5g                        TEgg142a10.p1kSP6                                                                                                                                                                                                                                                                                                                                                            GGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGAGGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCC
  5   1   3        nb Gas8 5g3  in                          st22c16.5p                                                                                                                                                                                                                                                                                                                                                               AAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGAGGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCG
  5   1   2       add TpA  5g3  in                   TTpA001c16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                  TACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCGGAGCGGCTGCGCTGTGAGAATTTCCCGA
  5   1   2   22  add Gas7 5g                              XZG57769.5p ..................................................................................................................................................................................................................................................................................................................................................................................GTTGTGGATTGGGAACAGTTTATGATAGGCTGTGGAGGTGGGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGAGGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGC
  5   1   2       ext Neu  FL   in                   TNeu065e03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                            GTGCATGTAAGAGCGTGAAAACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACGGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATC
  5   1   2   12  ext Tad5 5g3  in                         XZT65357.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGGACGCGTGGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTATGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCGGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGAGCGGGGGAGATCTGCGTGGGGCAGAACACTTCGGATAACAGCCCGTCCGGCCCCACCGCCCGGCCCACCCCTTACCTGCCGGACAGTATCACCTTCCACCCTCACCCCAACCGGGACTTCACCTGCCCGCGGCAGCT
  5   1   0       chi Hrt1 PIPE                            CAAQ8721.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCGATTCAATTCGGCCGAGGCACACACAGACTTGTATGAGTGAGAGAGCCCAAGCCGCCGCCGCCGCTGTGTGAGGCTTCATGCTGCAAGCACTTAACTCCCATGGCAAGGGATCCGAGAGGGGCAGCGGGCAGCATGGCAGCCTTCCCCCAGCGCTGCTCCGAGCAACTTTGCCTCCGGGGCTCCGCTCTCATCCCCTGGCTGCTGCTGCTTAGCGCCTCCCTGGCAGTGCAAGGGCAGTATAACGGCGAGAAGGGCATCTCCATTCCGGACCACGGCTACTGCCAGCCCATCTCCATCCCGCTCTGCACGGATATCGCCTACAACCAGACGATCATGCCCAATCTGCTCGGGCACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTACCCGCTGGTGAAGGTGCAGTGCTCGGCCGAGCTGAAGTTCTTCCTGTGCTCCATATACGCGCCGGTGTGCACGGTGCTGGAGCAGGCGCTGCCCCCATGCAGGTCGCTGTGTGACCGAGCCCGACAGGGCTGCGAGGCGCTAATGAACAAGTTCGGCTTCCAGTGGCCGGAGAGTCTGCGCTGCGAGAAGTTTCCCATCAATGGGGCCGGGGAGCTGTGTGTGGGGCAGAACACTACGGAGAGCGGCACCCCCCCCCCCCTTTTCCAGACAATTATGCCTTTATTTCTGTTTGCTTTCACAAGATTGTTTATATTTATAGATAAATAGTTTATATATATAAATATATATACCTTTATCATTTTTAATTTTTTTTGCAATAAATACAAAATGCTGGACTGTTAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas0                                 dad16d07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTCCAGCAGTACCACGGAGAAAAGGGCATATACGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTTTATGCACGGACATCTCATACAATTAGACCATCATGCCCAATCTGTTTCGACACACCCACCAGGATGACGCGGGGCTTGATGTGCACCCATTCTATCCTCTTGTGTAAGGTCAGTGTTCCCCGGAGCTGGGTTTTTTCTTGTGCTCCATGTTCGCCCCCGTT
  5   1   2       ext Egg                            TEgg110k24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACGCGGGGCTGGAGGTGCACCACTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCGGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGAGCGGGGGAGATCTGCGTGGGGCAGAACACTTCGGATAACAGTCCGTCCGGCCCCACCGCCCGGCCCACCCCTTACCTGCCGGACAGTATCACCTTCCACCCTCACCCCAACCGGGACTTCACCTGCCCGCGGCAGCTCAAGGTGCCCCCCTACCTGGGCTACCGCTTTCTGGGCGAGAAGGACTGCGGCGCCCCCTGCGAGCCGGGCAAGGCCAATGGGCTCATGTACTTTAAGGAGGAAGAAGTGCGCTTCGCCCGGCTGTGGGTGGGCATCTGGGCCATCCTGTGCGGCATCTCCACACTCTTCACCGTGCTCACCTACCTGGAGGATATGCGGCGTTTCAGCTACCCCGAGCGGGCCATCATCTTCCTGTCCGGCTGCTACTTCAT
  5   1   0       add Gas                            TGas048h11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCGTCCGGCCCCACCGCCCGGCCCACCCCTTACCTGCCGGGCAGTATCACCTTCCACCCTCACCCCAACCGGGACTTCACCTGCCCGCGGCAGCTCAAGTGCCCCCCTACCTGGGCTACCGCTTTCTGGGCGAGAAGGACTGCGGCGCCCCCTGCGAGCCGGGCAAGGCCAATGGGCTCATGTACTTTAAGGAGGAAGAAGTGCGCTTCGCCCGGCTGTGGGTGGGCATCTGGGCCATCCTGTGCGGCATCTCCACACTCTTCACCGTGCTCACCTACCTGGTGGATATGCGGCGTTTCAGCTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGCTACTTCATGGTGGCCGTGGCTTACACCGCGGGGTTCCTGCTGGAGGAGCGGGGGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGA
  5   1   1       add Egg                            TEgg117m06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCCGGGCAAGGCCAATGGGCTCATGTACTTTAAGGAGGAAGAAGTGCGCTTCGCCCGGCTGTGGGTGGGCATCTGGGCCATCCTGTGCGGCATCTCCACACTCTTCACCGTGCTCACCTACCTGGTGGATATGCGGCGTTTCAGCTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGCTACTTCATGGTGGCCGTGGCTTACACCGCGGGGTTCCTGCTGGAGGAGCGGGGGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACTGTGGCGCAGGGCACCAAGAAGGAGGGCTGCACCATCCTCTTCATGATCCTCTACTTCTTTGGCATGGCCAGCTCCATCTGGTGGGTTATACTGTCCCTTACCTGGTTCCTGGCGGCGGGCATGAAGTGGGGGCACGAAGCCATCGAGGCCAACTCGCAATACTTCCACTTGGCAGCCTGGGCAGTGCCCGCAGTGAAGACCATCACCATCCTGGCTAT
  5   1   2       add Gas8      in                          st78n24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACCCCGAAGCGGCCCATCATCTTCCTGTCCGGCTGCTACTTCATGGTGGCCGTGGCTTACACCGCGGGGTTCCTGCTGGAGGAGCGGGGGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACTGTGGCGCAGGGCACCAAGAAGGAGGGCTGCACCATCCTCTTCATGATCCTCTACTTCTTTGGCATGGCCAGCTCCATCTGGTGGGTTATACTGTCCCTTACCTGGTTCCTGGCGGCGGGCATGAAGTGGGGGCACGAAGCCATCGAGGCCAACTCGCAATACTTCCACTTGGCAGCCTGGGCAGTGCCCGCAGTGAAGACCATCACCATCCTGGCTATGGGGCAGGTGGATGGGGACATACTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCCCTGAGGGGCTTCGTACTCGCCCCCCTCTTCGTGTACCTGTTCATCGGCACCTCCTTCCTGCTGGCCGGCTTCGTGTCCCTGTTCCGCATCAGGACCATTATGAAACACGATGGCACCAAAACGGAGAAGCTGGAGAAACTGATGGTGCGCATCGGGGTGTTCAGCGTCATGTACACTGTGCCGGCCACCATCGTGCTGGCTTGTTACTTCTACGAGCAGGCCTTCAGGGACACATGGGAAAAGACCTGGCTGGTACAGACCTGCAAAGGCTTTGCTGTGCC
  3  -1   2       add Spl1      out                        CABK2226.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAAGATGGCTACAAAACTGTGGCCCAGGGCACCAAGAAGGAGGGCTGCACCTTCCTCTTCATGATGCTCTACTTCTTCAGCATGGCCAGCTCCATCTGGTGGGTTATCCTGTCCTTGACTTGGTTTTTGGCTGCTGGCATGAAGTGGGGGCATGAGGCCATAGAAGCTAATTCCCAATATTTTCACCTGGCAGCCTGGGCAGTGCCAGCCATCAAGACTATTACCATCTTGGCTGTGGGGCAGGTGGATGGAGATATCCTGAGTGGAGTTTGCTTTGTTGGGATCAATAATGTGGATGCCCTGCGTGGATTTGTCCTGGCTCCTCTATTCGTCTACCTGTTTATTGGCACTTCTTTCCTCTTGGCCGGCTTCGTGTCCCTCTTTCGGATTAGAACCATCATGAAACACGACGGCACCAAAACTGAAAAGTTGGAGAAGCTGATGGTGAGGATAGGAATCTTCAGCGTCCTTTACACTGTGCCGGCCACTATTGTGATCGCCTGTTATTTCTATGAGCAAGCGTTTAGGGAACAGTGGGAAAAAAGTTGGATTAGCCAAAGCTGTAAGACCTATGCCATTCCCTGTCCCAGCACCAGTCACCCACCAATGAGTCCAGATTTTACTGTCTTCATGATCAAGTACCTCATGACCTTGATAGTGGGAATAACATCTGGCTTTTGGATCTGGTCTGGGAAAACTCTTAACTCTTGGAGAAAGTTCTACACCAGGCTCACCAACAGTAAACAAGGGGAAACGACTGTGTGAGCCCCAAAGTGAACTGGTGGGGAGAGAGAGGACAGACTCTTGGGTTTTGTTGTAAATAGCAACTGTAACATTTTGTAAGTATATTTTGTATTTAAATGACAACAGATCATACCCTTTTATTGCAGGATGTTCTAACTATTTCTG
  5   1   2       ext Gas1                               IMAGE:6986881                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGGGCTTGGGTACCCGGGTCCGGGAATTCCCGGGGATCGAAGCCATCGAGGCCAACTCGCAATACTTCCACTTGGCAGCCTGGGCAGTGCCCGCAGTGAAGACCATCACCATCCTGGCTATGGGGCAGGTGGATGGGGACATACTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCCCTGAGGGGCTTCGTACTCGCCCCCCTCTTCGTGTACCTGTTCATCGGCACCTCCTTCCTGCTGGCCGGCTTCGTGTCCCTGTTCCGCATCAGGACCATTATGAAACACGATGGCACCAAAACGGAGAAGCTGGAGAAACTGATGGTGCGCATCGGGGTGTTCAGCGTCATGTACACTGTGCCGGCCACCATCGTGCTGGCTTGTTACTTCTACGAGCAGGCCTTCAGGGACACATGGGAAAAGACCTGGCTGGTACAGACCTGCAAAGGCTTTGCTGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTCTTTATGATCAAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCAC
  5   1   2       ext Brn3      in                         CAAK4711.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCACGAAGCCATCGAGGCCAACTCGCAATACTTCCACTTGGCAGCCTGGGCAGTGCCCGCAGTGAAGACCATCACCATCCTGGCTATGGGGCAGGTGGATGGGGACATACTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCCCTGAGGGGCTTCGTACTCGCCCCCCTCTTCGTGTACCTGTTCATCGGCACCTCCTTCCTGCTGGCCGGCTTCGTGTCCCTGTTCCGCATCAGGACCATTATGAAACACGATGGCACCAAAACGGAGAAGCTGGAGAAACTGATGGTGCGCATCGGGGTGTTCAGCGTCATGTACACTGTGCCGGCCACCATCGTGCTGGCTTGTTACTTCTACGAGCAGGCCTTCAGGGACACATGGGAAAAGACCTGGCTGGTACAGACCTGCAAAGGCTTTGCTGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTCTTTATGATCAAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCANAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTA
  5   1   3        nb Gas                            TGas097b08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAATACTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCCCTGAGGGGCTTCGTACTCGCCCCCCTCTTCGTGTACCTGTTCATCGGCACCTCCTTCCTGCTGGCCGGCTTCGTGTCCCTGTTCCGCATCAGGACCATTATGAAACACGATGGCACCAAAACGGAGAAGCTGGAGAAACTGATGGTGCGCATCGGGGTGTTCAGCGTCATGTACACTGTGCCGGCCACCATCGTGCTGGCTTGTTACTTCTACGAGCAGGCCTTCAGGGACACATGGGAAAAGACCTGGCTGGTACAGACCTGCAAAGGCTTTGCTGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTCTTTATGATCAAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAGGGACTTTTGTTTTACTGGTACTAGAGTTCACTGGGGACATCCCATGAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGA
  5   1   3        nb Egg                            TEgg098l01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTACCTGTTCATCGGCACCTCCTTCCTGCTGGCCGGCTTCGTGTCCCTGTTCCGCATCAGGACCATTATGAAACACGATGGCACCAAAACGGAGAAGCTGGAGAAACTGATGGTGCGCATCGGGGTGTTCAGCGTCATGTACACTGTGCCGGCCACCATCGTGCTGGCTTGTTACTTCTACGAGCAGGCCTTCAGGGACACATGGGAAAAGACCTGGCTGGTACAGACCTGCAAAGGCTTTGCTGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTCTTTATGATCAAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCC
  5   1   3        nb Gas7                                 XZG41454.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACTGCGGCGCCCCCTGCGAGCCGGCTTCGTGTCCCTGTTCCGCATCAGGACCATTATGAAACACGATGGCACCAAAACGGAGAAGCTGGAGAAACTGATGGTGCGCATCGGGGTGTTCAGCGTCATGTACACTGTGCCGGCCACCATCGTGCTGGCTTGTTACTTCTACGAGCAGGCCTTCAGGGACACATGGGAAAAGACCTGGCTGGTACAGACCTGCAAAGGCTTTGCTGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTCTTTATGATCAAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGT
  5   1   3        nb Egg                            TEgg134o08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAAACACGATGGCACCAAAACGGAGAAGCTGGAGAAACTGATGGTGCGCATCGGGGTGTTCAGCGTCATGTACACTGTGCCGGCCACCATCGTGCTGGCTTGTTACTTCTACGAGCAGGCCTTCAGGGACACATGGGAAAAGACCTGGCTGGTACAGACCTGCAAAGGCTTTGCTGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTCTTTATGATCAAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTT
  5   1   3        nb Gas       in                   TGas051h07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGACACATGGGAAAAGACCTGGCTGGTACAGACCTGCAAAGGCTTTGCTGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTCTTTATGATCAAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTG
  5   1   3        nb Neu       in                   TNeu131f23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATCCCCGGGCAACTTTGCCCCCATGAGCCCGGACTTCACGGTCTTTATGATCAAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCGCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAATTTACATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGC
  5   1   3        nb Gas7                                 XZG13652.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCACGGTCTTTATGATCAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCATTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAANAGGCCACTAATCCTAAATGCCTATAANATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACANCATGNCAGATAGCATGATATCTCAGAACAAAGTGCATGGTTTCTTTGTCTCG
  3  -1   2       ext Neu       in                    TNeu124o16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTCCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTNGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATNGTACATTTGTGTTTGCTACAGCTCTTTCAACATTGAC
  5   1   3        nb Gas7      in                         XZG19083.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCAGGATTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAA
  5   1   2       add Neu                            TNeu003o05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGNGAAATCTGCAGTATGAACATGGNNGGCAACACAGGGCCTCTACTGGNAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAATTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCANATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCGCCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCA
  5   1   3        nb Neu                            TNeu023e08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTNTGTCTCGGTGTGATGTATTCT
  5   1   3        nb Egg                            TEgg107f11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGGTTTCTTTGTCT
  5   1   3        nb Egg                            TEgg128c04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAAGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAAGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTC
  5   1   3        nb Egg                            TEgg080j04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTAGAGTGGGGGCCATTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCATATATATGTAAATGTGTAACGTTGGCATCTGGTATTCATTCCC
  5   1   3        nb Gas                            TGas048j07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGGGGTGCAGATTTAGCATTTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGGGTAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAAGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGT
  5   1   3        nb Gas       in                   TGas082m20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAACATTGACTTGTGTTAGTGCTCTTGTTGGGCCTTACATTTTTTTGCTGCCAGTCTGGCTTG
  5   1   3        nb Tbd1      in                        CBXT15212.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGGCTCAGGTTGGACATCTGATAGTTGGTTGTTGAGTGGGGGCCAGTTTAGCACAGGGTATAGTAGGAAATCAAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCCCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTGTGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTACATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCAC
  5   1   3        nb Egg                            TEgg096m08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAAC
  5   1   3        nb Gas0      in                         dad16h01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGGTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGCCACTAATNCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATNTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTG
  5   1   2       ext Gas       in                  TGas096f07.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTA
  5   1   3        nb HdA                            THdA025i08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTAACACAGGGTATAGTAGGAAATCCAATATGCGATGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTATGCTTTTCAGACAGGAGCTCTGATAAGGGCAACAAATGCTTCCCCCA
  5   1   3        nb Gas7                                 XZG28868.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGACGCGTGGGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGT
  5   1   0       add Egg                            TEgg056b05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTAATGTTTTTCTTGTGGCATCCGCTATTCTTTTCCTCGCTTGCTGTATGTCTCTTCATTTAACTCTAGGGGGTGTCTTCTCTTAGATCGCACTATAAAACTTACATGATTCTCTCTTTTGTGTACTTGTTTAATGACATCCCTTTCTGTCCGATAGCATGATATCTCAGAACAAAAGTGCGTGGTTTCTTTGTCTCAGTGTGATGTCTTCTGTTTTCCCT
  5   1   3        nb Gas7                                 XZG35809.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGTTATTCATTCCCTCACTTGCATTATGTTACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTAT
  5   1   3        nb Gas7                                 XZG21262.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGCGCACAAATGCTTCCCCCATTATCATATTTTGCTTTTAATGCATTTTCTCC
  5   1   3        nb Gas                            TGas018m23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGA
  5   1   3        nb Tbd1                                CBXT12869.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTGTGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTACATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTTATTCAAGAGTATTTGCACTGC
  5   1   3        nb Gas       ?                    TGas077d23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTG
  5   1   3        nb Gas       in                   TGas067e09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCATGTTAATGGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAA
  3   1   3        nb Gas       in                    TGas137l17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas7                                  XZG4450.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGG
  5   1   3        nb Tbd1                                 CBXT2812.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAA
  5   1   2       ext Gas7      in                         XZG21655.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATCCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAG
  5   1   3        nb Gas       in                   TGas137l17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTCCCTGCCTTTTTAAGGCTTTTCAAACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTG
  5   1   3        nb Tad5                                 XZT60628.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACCTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATGCCCTACATGCATAATAC
  5   1   2       ext Egg       in                   TEgg073k06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTTTCAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTAT
  5   1   3        nb Gas1      in                     NISC_mq11c06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTG
  5   1   2       ext Gas       in                   TGas118p04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTT
  5   1   3        nb Gas7      in                         XZG56486.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCACCTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTG
  5   1   3        nb Gas7      in                         XZG55082.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAAATTTC
  5   1   3        nb Tad5                                  XZT5157.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATAC
  5   1   3        nb Gas7                                 XZG31546.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCANAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTT
  5   1   2       ext Gas7      in                         XZG28696.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTC
  5   1   3        nb Gas7                                 XZG27387.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAA
  5   1   3        nb Gas7      in                         XZG38901.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAAGATATTT
  5   1   3        nb Tad5                                 XZT49702.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCA
  5   1   3        nb Gas7                                  XZG6875.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCCACATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGAATATT
  5   1   3        nb Egg                            TEgg140j18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAA
  3  -1   3        nb Gas                             TGas115d07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTTTTTTTCAGAGTATTTGCACTGCAGGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCANCATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTTAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCAT
  5   1   3        nb Gas7                                 XZG26241.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTTAATCAGCCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTG
  3   1   2       ext Gas       in                    TGas118p04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCATTCCTCAATGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGAAAAAAAAAAAAAAAAAA
  5   1   2       ext Tad5      in                         XZT67910.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACGNNCGTCCGGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGAC
  3   1   3        nb Gas       in                    TGas067e09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCAATTGTTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTA
  3   1   2       ext Gas       in                    TGas096f07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Neu       out                   TNeu106l13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas       in                    TGas082m20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCACATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTAATTAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTA
  5   1   3        nb Egg       in                   TEgg011e09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTC
  3   1   2       ext TpA       out                   TTpA034n22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAA
  3   1   4      seed Neu       in                    TNeu078k11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTA
  5   1   3        nb Gas7      in                         XZG25051.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATAT
  3   1   2       ext Egg       in                    TEgg073k06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAACCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTCCATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCAAGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTTTTTAGCGGATTAACTTTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCCCAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTGGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Brn3      in                         CAAK4711.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATATTGAAGATTTGAAATGAATTTGTGCCTGTATAGCCAGTAGCTGTAAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGT
  5   1   3        nb Neu                            TNeu003n07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCGGGGATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAA
  3   1   2       ext Neu  FL   in                    TNeu065e03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTCCATTAAATGCATAATACGGAGTTAATTTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTCCCTTTTCTTTAGCGGATTAACTTTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCCCAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCCCAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAACCCTCACTTTATCTTGTGTACAGATCACTCAATAAACCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Tad5      in                         XZT67910.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTATAGCCAGTAGCTTTTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAGG
  3   1   3        nb Tbd1      in                        CBXT15212.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATTTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCAGATTAACTTTGAACATTCCCCATAGCAAAAAACACTTTCAGATTTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGGTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATTTAGATTGTTTTACAGAAGGCTTTTTTTGTAATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAACAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG19083.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTATAGCCAGTAGCTGGTAAGTGATATATCTCTTTCAAATCTGAACGGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGT
  5   1   3        nb TbA                            TTbA077o02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGTAGCTTGTAGTGATATATCTCTTTCAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCAGCAAAAGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTAGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTAGTTTATAGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCANANAACACTTTCAGATCTGGGAATTAAGAATTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTA
  5   1   3        nb Tbd1                                 CBXT1235.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTTCTTTTTTTAGGTT
  5   1   3        nb Gas7                                 XZG64493.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCTCTTTCAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGT
  3   1   2       ext Gas7      in                         XZG21655.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGT
  5   1   3        nb Gas8      ?                           st36k18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTNAACCNCCCCNAAGG
  3   1   3        nb TbA                             TTbA052l02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCACATCAGTTATATGTAAATTTCTTGTTTATTGCCCTCCATTAAATGCATAATACGGAGTTAATTTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATTTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTAATTAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCTTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAAG
  3   1   3        nb Gas7      in                         XZG25051.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGT
  3   1   2       ext Gas7      in                         XZG28696.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTGGGT
  3   1   3        nb Egg       in                    TEgg011e09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu       in                    TNeu131f23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTTTTGTTTATTGCCCTCCATTAAATGCATAATACGGAGTTAATTTGCTAAATAAACCCCTATGTTTTCCCCATGTTCATTTTGTTGTATTATATGGGGAGGGTGTTATGCATTGCCTTTTTTTTAGGGGATTAATTTTGAACATTCCCCATAGCAAAAAACACTTTCAGATTTGGGAATTAAGATTTGGCAAACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTTTGCCCAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCCCAATAAACTTCCAGGGATTTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATTTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTTTACTTTTTGACTTAATGGCAAGACAACCCTCCCTTTATTTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   3        nb Gas7      in                         XZG38901.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTCCATTAAATGCATAATACGGAGTTAATTTGCTAAATAAACCCCTATGTTTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTTTGAACATTCCCCATAGCAAAAAACACTTTCAGATTTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATTTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCCCAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATTTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTGGGT
  3   1   3        nb TbA  5g3  in                    TTbA058e10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTAGGCAAGCGCTGCATAATATGTATTTTTTAAAGTCAGATACTGCGTATGGAACCAAGATTATTTTAATAATTTTTCTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTCATATTTTTTGTATAAAACTGTACTAATTTGTACTAAGATATATATATATGTAATTATATGTTTAATACTTTTTGAATTAATGGCAAGCCAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAGGAAAAAAAGGC
  3   1   2       ext Tad5 5g3  in                         XZT65357.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTCCATTAAATGCATAATACGGAGTTAATTTGCTAAATAAACCCCTATGTTTTCCCCATGTTCATTTTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTTTTTAGCGGATTAACTTTGAACATTCCCCATAGCAAAAAACACTTTCAGATTTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTTTGCACAACCCATTTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCCCAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTTTTTTGTGTACAGATCACTCAATAAAGCCTTTTTTTTTTAGGT
  5   1   3        nb Gas7      in                         XZG50736.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAA
  3   1   3        nb Gas7      in                         XZG50736.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTCCATTAAATGCATAATACGGAGTTATTTTGCTAAATAAACCCCTATGTTTTCCCCATGTTCATTCTGTTGTATTATAGGGGGGGGGTGTTATGCATTGCCTTTTTTTTAGCGGATTAACTTTGAACATTCCCCATAGCAAAAAACACTTTCAGATTTGGGAATTAAGATTTGGCATACAAGGGTTTTTTTGTTTTGTTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTTTGCCCAACCCATTTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCCCAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGGGCATGTCATCTTAAACAAATGAAGACTCCATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATAGGTATTTATATGTTTCTACTTTTTGACTTAAGGGCAAGACAAGCCTCACTTTTTTTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTGGGT
  3   1   2       add TpA  5g3  in                    TTpA001c16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAAAGATAGCAGACCCGTTATATGTAAATTTTTTGTTTATTGCCCTCCCTGCATAATACGGAGTTAATTTGTTAAATAAACCCCTATGTTTTCCCCAGGTTCATTTTGTTGTATTATATGGGGGGGCTGTTATGCATTCCCTTTTTTTTAGCGGATTAACTTTGAACATTCCCCCATAGCAAAAAACCCTTTCAGATTTGGGAATTAAGATTTGGCATCCAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCACCCCTAATGTATTGTTTGCCCACCCCCTTTAGATTGTTTTCCAGAAGGCTTTTTTTGTGATGGGGAAAGTGCCCCCAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGGGCAGGTCATTTTAAACAAATGAAGACTCCCTTGTTTATATTTTTTGTATAAAACGGTACTATTTTGTACTAAGAAATATATATAGGTATTTATATGTTTTTACTTTTTGACTTAATGGCAAGACAACCCCCCCTTTATTTTGTGTACAGATCCCTCAATAAACCCTTCTTTTTTTGGGTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   3        nb Gas                             TGas077a04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTCACATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Tbd1                                 CBXT8985.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Neu                            TNeu142d19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGAGATATATATAT
  5  -1   2       ext Neu       in                   TNeu124o16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas7                                 XZG45344.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTTAGGTNAAAA
  5   1   3        nb Tad5                                 XZT72832.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAA
  3   1   3        nb Gas7      in                         XZG55082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTGGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATTTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCCCAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGGGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAAGGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTGGGT
  3   1   3        nb Gas7      in                         XZG56486.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTAAATAAACCCCTATGTCTTCCCCAGGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATTTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCCCAATAAACTTCCAGGGATCTTGGCAATTGCGGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTGGGGCAGGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTGGTATATAACGGTACTATTTTGTACTAAGATATATATATAGGTATTTATAGGTTTCTACTTTTTGACTTAAGGGCAAGACAAGCCTCACTTTTTCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTGGGT
  3   1   3        nb Gas1      in                     NISC_mq11c06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTTTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTGGGTAAAAAAAAAAAAAAAAAAGAAAAAAAAAG
  3   1   3        nb Gas       in                    TGas051h07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAACCCCTATGTCTTCCCCATGTTCATTCTGTGGTATTAGATGGGGGGGCTGTTTCGCATTGCCTTTTTTTTAGCGGATTAATTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGATTTAAGATTTGGCATACAAGGTTTTTTTTGTTTCGTTTCTTTTTT
  3   1   3        nb Gas0      in                         dad16h01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGGTTTGTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCCCCCCCCCTTTTAGATTGTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAACA
  3   1   3        nb Neu       ?                     TNeu101k24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGGGGGTGTTATGCATTCCCTTTTTTTTAGGGGATTAACTTTGAACATTCCCCCATAGCAAAAAACACTTTCAGATTTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCCCAACCCACTTTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCCCAATAAACTTCCAGGGATTTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGGGCATGTCATTTTAAACAAATGAAGACTCCATTGTTTATATTTTTTGTAAAAAACTGTACTATTTTGTACTAAGAAAAATAAATAGGTATTTATAGGTTTTTACTTTTTGACTTAAGGGCAAGACAAGCCCCACTTTATTTTGTGTCCAGATCACTCAAAAAACCCTTCTTTTTTTGGGTAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg  5x3  out                   TEgg027e06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGGGGGGGTAGGCTTTCCCTTTTTTTTAGGGGAGAAACTTTGAGCATTCCCCTTAGCAAAAAACAATTTCGGTTTGGGGAATTAAGATTTGGCATACAAGGTTTTTTTTTTTTGGTTTTTTTTTTTTTAATCAGCCCAAAGGAATTGTTTGCCCAACCCATCTAGATTGTTTTCCAGAAGGCTTTTTTTTTGATGGGGAAGGGGACCCCAAAAAATTTCCGGGGATTTGGGCAATTGTGGCATAAAATGTTTTTTTTAAAGTCAGATCCAAGGTAGGGAATTAAGATTATTTTAATAATTTTTTTGTGCAGGCCTTTTTAAACAAAAGAAGACTACATTGTTTAGTTTTTTTGTATATAACGGTACTATTTTGTGTTAAGATAAATAAAAAGGTATTTATATGTTTGGGTTTTTTGACTGAAGGGCAAGACAAGCCTCACTTTATTTTGTGTACAGATCACTCAAAAAAGCCTTTTTTTTTTGGGTAAGGAGAAAAAAAGAAAAAAAACGTAAACATAAAAAGGGAAAAAAAAAAA
  3   1   2       add Gas8      in                          st78n24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCCNTTTNTTTAGNGGGNTAACTNTGNACCTTCCCCCNAGCNAAAAACCCNTTCNGATTTGGGNANTNAGNTTTGGCCNNCNAGGGTTTTTTTGNTTTGNTTTTTTTTTTACTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTNCAGAAGGCTTTTTNTGTGANGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCNGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTNTTTNGNGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTNGTATATAACTGTACTATTTTGTAGCTAAGATACTATATATANGTATTNATATGTNTCTACTNTTTGACNAATGGCAAGACAAGCCTCACTTATCTG
  5   1   3        nb Gas7                                 XZG24111.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTTGTTTTGTTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAA
  3   1   3        nb HdA       in                    THdA030g24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAAGATCACTCAATAAAGCCTTCTTTTTTTA
  5   1   3        nb Neu                            TNeu099e04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAAAAAACACTTTCAGATCTGGGAATTAACATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATAACCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAAGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAAGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCATATACTATGTATGGAATTAAGATTATTGTAATAATTTTTTTGTGCGTGTCATCTTAAACAAATGAAGACTACATTGTGTATATTCCTTGGATATAACTGTGCTATCTTGTACTGAGATATATATATATGCATCTATATGGTTCTACTTTTCGACTTAATGGCAAGACAAGCCTCACTTT
  5   1   3        nb Neu                            TNeu140j23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTC
  5   1   3        nb HdA       in                  THdA030g24.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGT
  3   1   3        nb Gas8 5g3  in                          st22c16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTTTTTTTGGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACT
  3   1   3        nb HeRe                             EC2CAA46AC06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTTTCAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTG
  5   1   2       ext Gas7                                  XZG6577.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCTAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTNaaaaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGG
  5   1   3        nb Egg                            TEgg096o20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGCTTTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGT
  3  -1   3        nb TpA  5g   out                  TTpA072h08.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGT
  5   1   3        nb Neu                            TNeu003d03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTG
  3   1   3        nb TpA                             TTpA053b07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAA
  5   1   2                                         Xt7.1-TEgg072h19.3                                                                                                                                                                                                                                                                                                                                                                  TGGATTGGGAACAGTTTATGATAGGCTGTGGAGGTGGGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTGTGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTCCCCTCCATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTCCCTTTTCTTTAGCGGATTAACTTTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTAATCACCCCTAATGTATTGTCTGCCCAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCCCAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTCCATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAACCCTCACTTTATCTTGTGTACAGATCACTCAATAAACCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008275174                                                                                                                                                                                                                                                                                                                                                                        GGGAACAGTTTATGATAGGCTGTGGAGGTGGGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTGTGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTCCCCTCCATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTCCCTTTTCTTTAGCGGATTAACTTTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTAATCACCCCTAATGTATTGTCTGCCCAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCCCAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTCCATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAACCCTCACTTTATCTTGTGTACAGATCACTCAATAAACCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAA
  5   1   1           Gas1 FL                     IMAGE:5308575.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                     GGGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTGTGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACAAGTTCGGCTTCCAGTGGCCGGAGCGGCTGCGCTGTGAGAATTTCCCGGTACACGGAGCGGGGGAGATCTGCGTGGGGCAGAACACTTCGGATAACAGCCCGTCCGGCCCCACCGCCCGGCCCACCCCTTACCTGCCGGACAGTATCACCTTCCACCCTCACCCCAACCGGGACTTCACCTGCCCGCGGCAGCTCAAGGTGCCCCCCTACCTGGGCTACCGCTTTCTGGGCGAGAAGGACTGCGGCGCCCCCTGCGAGCCGGGCAAGGCCAATGGGCTCATGTACTTTAAGGAGGAAGAAGTGCGCTTCGCCCGGCTGTGGGTGGGCATCTGGGCCATCCTGTGCGGCATCTCCACACTCTTCACCGTGCTCACCTACCTGGTGGATATGCGGCGTTTCAGCTACCCCGAGCGGCCCATCATCTTCCTGTCCGGCTGCTACTTCATGGTGGCCGTGGCTTACACCGCGGGGTTCCTGCTGGAGGAGCGGGGGGTGTGCGTGGAGCGCTTCTCGGAGGACAGTTACCGGACTGTGGCGCAGGGCACCAAGAAGGAGGGCTGCACCATCCTCTTCATGATCCTCTACTTCTTTGGCATGGCCAGCTCCATCTGGTGGGTTATACTGTCCCTTACCTGGTTCCTGGCGGCGGGCATGAAGTGGGGGCACGAAGCCATCGAGGCCAACTCGCAATACTTCCACTTGGCAGCCTGGGCAGTGCCCGCAGTGAAGACCATCACCATCCTGGCTATGGGGCAGGTGGATGGGGACATACTGAGCGGGGTGTGTTACGTGGGCATCAACAGCGTGGACTCCCTGAGGGGCTTCGTACTCGCCCCCCTCTTCGTGTACCTGTTCATCGGCACCTCCTTCCTGCTGGCCGGCTTCGTGTCCCTGTTCCGCATCAGGACCATTATGAAACACGATGGCACCAAAACGGAGAAGCTGGAGAAACTGATGGTGCGCATCGGGGTGTTCAGCGTCATGTACACTGTGCCGGCCACCATCGTGCTGGCTTGTTACTTCTACGAGCAGGCCTTCAGGGACACATGGGAAAAGACCTGGCTGGTACAGACCTGCAAAGGCTTTGCTGTGCCCTGTCCCAACTACAACTTTGCCCCCATGAGCCCGGACTTCACGGTCTTTATGATCAAATACTTAATGACCATGATTGTTGGCATCACCTCCAGCTTTTGGATTTGGTCTGGTAAAACCCTACAGTCCTGGCGCAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCACCTAACGGCTGTTAAGGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAGAACAAAAGTGCATGGTTTCTTTGTCTCGGTGTGATGTATTCTGTTTTCCCTGCCTTTTTTAGGCTTTTCAGACAGGAAGTCTGATAAGGGCAACAAATGCTTCCCCCATTATCATATTTTGGTTTTAATGCATTTTCTCCCAGCTCAAGTTCCTATGCATGTATATGTACATTTGTGTTTGCTACAGCTCTTTCAAACATTGACTTGTGTTAGTGCTCTTGTTGGCCCTTACATTTTTTTGCTGCCAGTCTGGCTTGCGGTAACAGCCACACTGCCTGCTAAATAGATTGCTATTACCAGTGATGGGTATACCATATGGAATAGATATCAGCCAGTAACATTCCTGCATCTGTCATTTACTCAGCTGCTAGGCACAGAGATTTTTTATGTTTACCTAACAGATCAAGGCTTGTGCATGGTAAATACTTTGTGTCCCTTAAGCACCCAGCAGGCAGTTAATTAAAGTTCCTCTGAATAGGGCTTCACCTAACCAGCAGCTGGGCAAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Egg  5g3  in                   TEgg050o03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                  TGGATTGGGAACAGTTTATGATAGGCTGTGGAGGTGGGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTGTGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGC
  5   1   4      seed Egg  5g3  in                   TEgg072h19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                     GGGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTGTGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCG
  5   1   2       ext Gas1 FL   ?                     IMAGE:5308575.y1                                                                                                                                                                                                                                                                                                                                                                                                     GGGAAAGTACGTTGAAGTTTCAGAGGAATAAGCGAAAGTTCCTCGGATTGTGCATGTAAGAGCGTGAATACGGACGCGCGTAAGGAATCGGTGCGCTGAGCTGCTCTCTGTATCCCGAGTTAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGACTCGTACAGAGAAGGAGCGGAGAAGTTCCGAAAGAGGAGAATTAGCTGGTTTGGCCTCACTCTCCAGCCCCCCCTGCTGTCTGCAGAGCCCCGCGAATCATCACCTGTTGCCGCCCGGGTCCCGGCATGTTCGCTACGGTCTCCCTGCTGTTCTGCCTACTCCTGCAGCCCTCCCCATCTGCCCAGCAGTACCACGGAGAAAAGGGCATCTCCGTGCCCGACCATGGATTCTGCCAGCCCATTTCCATACCTCTGTGCACGGACATCGCATACAATCAGACCATCATGCCCAATCTGCTCGGACACACCAACCAGGAGGACGCGGGGCTGGAGGTGCACCAGTTCTATCCGCTGGTGAAAGTGCAGTGTTCCCCGGAGCTGCGCTTCTTCTTGTGCTCCATGTACGCCCCGGTGTGCACCGTGCTGGAGCAGGCCATTCCCCCCTGCCGGTCCCTGTGCGAGAGAGCCAGGCAGGGCTGCGAGGCGCTCATGAACA
  3   1   2       ext Egg  5g3  in                    TEgg050o03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTCCCCTCCATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTCCCTTTTCTTTAGCGGATTAACTTTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTAATCACCCCTAATGTATTGTCTGCCCAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCCCAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTCCATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAACCCTCACTTTATCTTGTGTACAGATCACTCAATAAACCCTTCTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   4      seed Egg  5g3  in                    TEgg072h19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATTAAATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTA
  5   1   2  SIG                                    Xt7.1-TGas101b10.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCGCCTAACGGCTGTTAAAGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAAGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAAACAAAAGTGCATGGTTTCTTTGTCTCAGAGTGATGTATTCTGTTTTCCCTGCCTTTTTTAAGCTTTTCAAACAGGAAGTCTGATAAAGGCAAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008275176                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCGCCTAACGGCTGTTAAAGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAAGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACATGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAAACAAAAGTGCATGGTTTCTTTGTCTCAGAGTGATGTATTCTGTTTTCCCTGCCTTTTTTAAGCTTTTCAAACAGGAAGTCTGATAAAGGCAACAAATGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGAAAAAAA
  5   1   2       ext Gas       in                   TGas065g12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGTTTTATCACAGGCTCAGTAATGGCGGCAAGGGGGAAACTGCAGTATGAACATGGGGCAACACAGGGCCTCTACTGGAATTAAAGGGACTTTTGTTTTACTGGTACTAAAGTTCACTGGGGACATCCCATGAAAGCCCTCTTAATGCACATTATTTCTCCCCATCAAAGAATTCTTCATAATGAAGTGCTTGGGCTGACCCAGTCTGGACTATAGGGTTACTAGCTGGAAGTGGTTTGGGTCTAATGGGGTGGGTGTGGAAGCTGTGCAGATTTAGCATTGTTGAAACCAATTTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCGCCTAACGGCTGTTAAAGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAAGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCAGTTTAACACATGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAATGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGT
  5   1   4      seed Gas       in                   TGas101b10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTAGCATTGTTGAAACCAATTTTTTTTTATCCTGTAGCACTACAGCTGTTAAACTACAACTCCCAGTATCGCCTAACGGCTGTTAAAGGTGCCAGGGGTTGTTACACAACAAATGGAGGGCTCAGGTTAGACATCTGATAGTTGGTGGTTGAGTGGGGGCCACTTTAACACAGGGTATAGTAGGAAATCCAATATGGAAGCAGATATATGTTAATGTGTAACTTTGGCATCTGTTATTCATTCCCTCACTTGCATTATGTCACACAGCAGTAGTTAAAAGGCCACTAATCCTAAATGCCTATAAAATTCTGATCAAGCTCACAAATGTGTACATGTTAATGTCTTCACACAATGGCAGATAGCATGATATCTCAAACAAAAGTGCATGGTTTCTTTGTCTCAGAGTGATGTATTCTGTTTTCCCTGCCTTTTTTAAGCTTTTCAAACAGGAAGTCTGATAAAGGCAACAAATGCT
  5   1   2       ext Egg                            TEgg092g23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATAGTGCCTTTTGGTAGAGAGTGGCCCCCACTGTTATGTCAACAAGGCATCATACATAAAATATATTTTAATTCAGATTCTACCCAATGTTAGACAAACTTTCACCGTACTTTTTTTTTATTCAAGAGTATTTGCACTGCAGGGGGTATAATATTGCTCTCTCTCCTCCATTCCTCAATTGTTTTTTAAATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCCATAGCAAAA
  3   1   4      seed Gas       in                    TGas101b10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATTGGCATTATTGATCAGCTATCCTTTGTGGGATTAGGGTGTTTGCACTGGTTATCTGGGTCAGATCTACTATATTGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTAGGAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas       in                    TGas065g12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAAGAATTTGAATGAATTTGTGCCTGTATAGCCAGTAGCTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTCCATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTCCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCACCCCTAATGTATTGTCTGCCCAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCCCAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTCCATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAACCCTTCTTTTTTTAGGTTAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Neu       in                   TNeu119b05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTT
  3   1   3        nb Neu       in                    TNeu119b05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTGTAAGTGATATATCTCTTTCAAATCTGAACTGTATAGTTTCTTCTGTATAATGTCTAATTAACATTTCATATTAGACCAGTCCCTGCAAATGTATCCTATAATGCAAAGCCATGCAGTGTTGGAAACGCCTCTTGTAATGAAAGATAGCAGATCAGTTATATGTAAATTTCTTGTTTATTGCCCTACATGCATAATACGGAGTTAATCTGCTAAATAAACCCCTATGTCTTCCCCATGTTCATTCTGTTGTATTATATGGGGAGGCTGTTATGCATTGCCTTTTCTTTAGCGGATTAACTCTGAACATTCCCCCATAGCAAAAAACACTTTCAGATCTGGGAATTAAGATTTGGCATACAAGGTTTTTTTTGTTTTGTTTTTTTTTTTTAATCAGCCCTAATGTATTGTCTGCACAACCCATCTAGATTGTTTTACAGAAGGCTTTTTTTGTGATGGGGAAAGTGACCACAATAAACTTCCAGGGATCTTGGCAATTGCTGCATAATATGTATTTTTTAAAGTCAGATACTATGTATGGAATTAAGATTATTTTAATAATTTTTTTGTGCATGTCATCTTAAACAAATGAAGACTACATTGTTTATATTTTTTGTATATAACTGTACTATTTTGTACTAAGATATATATATATGTATTTATATGTTTCTACTTTTTGACTTAATGGCAAGACAAGCCTCACTTTATCTTGTGTACAGATCACTCAATAAAGCCTTCTTTTTTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)