Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 81%

 1012072200 Xt7.1-CAAO6560.3.5 - 79 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAO6560.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCCCCATGGATTCCTCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAATACAATTAAATATAAAAAAAA
                                                  Xt7.1-CHK-1008223983                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATGGATTCCTCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAxxAAATACAATTAAATATAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2    10    10    16    16    19    19    19    19    19    19    19    20    20    20    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    25    25    25    25    25    25    25    25    25    25    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    27    27    27    27    27    27    26    27    27    27    26    26    26    26    25    26    25    26    23    24    22    24    21    23    20    22    20    22    19    21    18    19    17    17    16    16    16    16    17    17    15    15    15    16    11    12    10    11    10    11    10    11    10    11    12    12    12    12    11    12    12    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    11    12    11    12    11    12    11    12    11    12    12    13    13    14    13    15    24    27    29    30    33    35    35    36    35    37    36    38    36    38    35    39    36    39    43    46    43    46    43    46    42    46    44    46    44    46    44    46    44    46    44    47    46    48    46    48    46    48    47    48    47    47    47    47    47    47    49    49    48    48    48    48    48    48    48    48    39    48    39    48    39    48    39    48    39    47    39    47    39    47    39    47    39    47    39    47    38    46    38    46    38    46    38    46    36    44    35    44    34    44    34    44    34    44    34    44    34    44    32    43    32    42    32    42    32    42    31    42    31    42    31    42    31    42    31    42    31    42    31    42    29    41    30    41     9    19     8    17     8    10
  5   1   2  SIG                                      Xt7.1-CAAO6560.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCATGGATTCCTCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAA
  5   1   2  SIG                                     Xt7.1-CBWN16631.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGGATTCCGCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGAAGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCCGTTCCTCTGGGGCGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAACACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTCTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTCGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGTGATTACCTGGAGATCTACAACGGAGACTCCACCTCTGCTCCACTTTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCAAGAAGTGTCCTACCCTGAGTGCTGCCATCTGCTGCCGGATCTTATGGGGCAGAGAGGAACATAACATTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCATGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACAGATAAGCTCCTTCTCTTTTGAGCTAACATTGAAGGCTTTTCCTTAATTCTTATTTGAAATTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCACATTGTTTCCTCTGCTGCAAGCAAATTAATTATCCTTCATTAACACCAGTGGAACAAAGCCCTACGGTGATCGAGATGAAACCTATTATGGTAGAATGTTGCCTTTATAGAACAAAGTAATTCCTCAACAGTATATTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCTGCCGGATCTTATGGGGCAGAGAGGAACATAACATTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCATGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACAGATAAGCTCCTTCTCTTTTGAGCTAACATTGAAGGCTTTTCCTTAATTCTTATTTGAAATTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCACATTGTTTCCTCTGCTGCAAGCAAATTAATTATCCTTCATTAACACCAGTGGAACAAAGCCCTACGGTGATCGAGATGAAACCTATTATGGTAGAATGTTGCCTTTATAGAACAAAGTAATTCCTCAACAGTATATTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------A-----
                                               BLH OVR       7      47                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI       7      28                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG       7       7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Bb ---- 4e-013     BAC75888.1 mannose-binding lectin associated serine protease-1 [Branchiostoma belcheri] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 3e-040     NP_498405.2 Nematode AStacin protease family member (nas-4) [Caenorhabditis elegans] -------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 7e-055     NP_476879.1 tolkin CG6863-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Mm ---- 5e-060     NP_036034.1 tolloid-like 2 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                             PROTEIN --- Ci ---- 3e-061     BAE06735.1 Tolloid [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 4e-062     NP_036596.3 tolloid-like 1 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dr ---- 1e-063     NP_571085.1 tolloid [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Sp ---- 5e-065     NP_999728.1 bone morphogenetic protein 1 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Gg ---- 1e-112     XP_426424.2 PREDICTED: hypothetical protein [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 1e-140     AAH82956.1 LOC494813 protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Xt ---- 2e-145     AAH93465.1 Unknown (protein for IMAGE:6989433) [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                                    Xt7.1-CAAO6560.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------ATG---------------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATGATG---------------------------ATG---------------------------------------------------------------------------------------TGA------------------------------ATG---------------------TAATGA---TAA---------------------------------------------------------------------------------------TGA---------------------------------------------------------------------TGA------------------------------TAA------TAA------------------------------ATG------------------------------------------------------------------------------------TAA---------------------------------TAA---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2  SIG                                      Xt7.1-CAAO6560.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCATGGATTCCTCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAA
                                                  Xt7.1-CHK-1008282486                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGATTCCTCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAA
  5   1   2       ext Te5       in                         CAAO8965.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCTACTAAAAACTTGAGGTGTCACCTAGGCACTTACCCAGCATGCTGTGGGGGTTACGGGCAAGTGCTTGCACTGACGCAAGGGCACCAGCGTGGCCATGGCAGAATCCTGTCACTGTAGTTACGTGCCTGTGGCTCAGATCTATATAAAGAGCCTGGACTCCCCCTCTACACTCAGAAGCTACAGCCCCATGGATTCCTCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGNGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATNCACTACCAAGAAATGGACACCAACACCCTTGGCATGNAGTATGACTACGTGT
  5   1   2       ext Te4  5g3  in                         CAAN4600.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCATGGATTCCTCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCG
  5   1   3        nb Te5  5g                             CAAO13042.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCATGGATTCCTCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGATCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCCAAT
  5   1   3        nb Te5       ?                          CAAO4854.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCATGGATTCCTCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGAC
  5   1   2       ext Te5       in                        CAAO10635.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGATTCCTCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACT
  5   1   2       ext Te3       in                        CAAM10200.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTCCTCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCA
  5   1   3        nb Te5       in                         CAAO2540.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCCTCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACA
  5   1   3        nb Te1       in                        CBWN12448.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGAAGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCCGTTCCTCTGGGGCGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAACACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTCTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTCGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCT
  5   1   2       ext Te1       in                        CBWN13100.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGGCGCTAAAGAGCTGACCAACCTG
  5   1   3        nb Te1       in                         CBWN2973.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGCGCTAAAGAGCTGACCAACCTGGATTACAGTAAGA
  5   1   2       ext Te5       in                        CAAO10960.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGT
  5   1   4      seed Te5       in                         CAAO4593.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAA
  5   1   3        nb Te5       in                         CAAO7699.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCT
  5   1   2       ext Te5       in                         CAAO4432.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAAATGAGAGCGTGNGACCCTGAAGTCGGCCAATTACC
  5   1   3        nb Te1       in                        CBWN11856.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGA
  5   1   3        nb Te1       in                        CBWN13405.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTATTTCAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGGCGGCTAAGGATGGATCCTAGCAGACGTTTAGGTGGGCGCTAAAGAGCTTGACCAACCCTGGGATTACAA
  5   1   3        nb Te5       in                         CAAO4239.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTTGAGGCTTTTGATATTCAATCTTCCC
  5   1   3        nb Te1       in                         CBWN2733.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGCGCTAAAGAGCTGACCA
  5   1   3        nb Te5       in                         CAAO4352.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCACCGCTAATGAAACGAATCCCGTGTTTGGGGACGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCCTGAAACAGACATCGCTGTTCCTCTGGGACGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAGCACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGNGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCC
  5   1   2       add Te5       in                        CAAO12025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTTTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGATCTCTCTGAGAGTAGTCACCATGGACATCGA
  5   1   3        nb Te5       in                        CAAO11943.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTTGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAAGCGCCAGTGCCGCCGGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCCTATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTG
  5   1   2       ext Te5       in                         CAAO7845.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTTCTTA
  5   1   3        nb Te5       in                         CAAO5909.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGGTGTTCTACCCTTTCCTTGCACTGATAG
  5   1   3        nb Te1                                 CBWN16954.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATCCTGAAGTCGGCCAATTACCCTTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCGCTGATAGCTTCGGGCCGAGCCCTCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCATGGCTTTATATTGAAACAGTGGAA
  5   1   3        nb Te5       in                         CAAO8625.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGNGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTT
  5   1   3        nb Te3       in                         CAAM9074.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCTTTTTTGGGATTTATG
  5   1   2       ext Te5       in                         CAAO6560.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTAT
  5   1   3        nb Te3       in                        CAAM15078.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATAATTATCCTTCATTAACG
  3   1   3        nb Te3       in                        CAAM15078.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCAAACCGCTACTGATTTCAAGGCTTTATATGAAACAGTGGATGTGGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   2       ext Te5       in                         CAAO4432.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCNCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  5   1   3        nb Te5       in                        CAAO10450.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACANATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGNGTGGAATAACCCTTTT
  5   1   3        nb Te3       ?                         CAAM14461.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACCATTAAA
  3   1   2       ext Te5       in                         CAAO6560.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   3        nb Te3       in                         CAAM9074.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTCCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGATAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   3        nb Te5       in                        CAAO11943.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   3        nb Te5       in                         CAAO4239.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   4      seed Te5       in                         CAAO4593.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   2       ext Te5       in                         CAAO7845.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGATAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   3        nb Te5       in                         CAAO4352.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACCTACACCACCNCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGATAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  5   1   3        nb Te5       in                        CAAO12237.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCNNACATAATAAATACAATTAAATATAAAAAAAAAAAA
  5   1   2       ext Te3       in                        CAAM16124.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACANAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAAAAAA
  3   1   3        nb Te1       in                        CBWN13405.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAACCACCCCATTAAGGGAACATCACATCTTCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACATCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAAAAAA
  3   1   3        nb Te1       in                        CBWN11856.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAAAAAA
  3   1   0       chi Te5       in                        CAAO12025.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAAACACCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   2       ext Te5       in                        CAAO10960.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   3        nb Te5       in                         CAAO8625.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGATAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   2       ext Te5       in                        CAAO10635.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGATAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   2       ext Te5       in                         CAAO8965.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   2       ext Te1       in                        CBWN13100.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAAAAAAGA
  3   1   2       ext Te3       in                        CAAM16124.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   3        nb Te5       in                        CAAO12237.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   2       ext Te3       in                        CAAM10200.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACATCACATCTCCAAATTACCCAAAAGACTATCCACCTCCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   3        nb Te5       in                         CAAO5909.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGATAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   3        nb Te5       in                         CAAO7699.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   3        nb Te5       in                        CAAO10450.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   3        nb Te5       in                         CAAO2540.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  3   1   3        nb Te1       in                         CBWN2973.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGGGATTACCTGGAGATCTACAACGGAGACTCTACCTCTGCTCCACTCTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAAAAAA
  3   1   3        nb Te1       in                        CBWN12448.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGCCGTGATTACCTGGAGATCTACAACGGAGACTCCACCTCTGCTCCACTTTTGGGGAGATTTTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTTTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGG
  3   1   3        nb Te1       in                         CBWN2733.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTTGGGGAGTTTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGAAAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTGGCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAGAAAA
  3   1   2       ext Te4  5g3  in                         CAAN4600.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGATAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATATTTAATAGTTGTTTAGTGTGACTACTGAAATAGGGTGCTTTGGGTGCTTAGATACTGGGAGGGGTGGGAATAAGTGGGGCTCAGGAAAAGGCACTCTGGGTGTACACGTGTGACACATGTTGACTTGCATTTATAGGTTTGTTACTATGTTTGAAGGTTCTGGGTCTTCTGTATGAACTGGGGGAATACATCTCATGTTACTCCC
  3   1   3        nb Te5       in                        CAAO12230.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGATAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATAT
  5   1   3        nb Te5       in                        CAAO12230.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCGAGAAGTGTCCTACCCTGAGTGCTGCCATCTGGGACAGAGAGAAACATAATGCTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCTTGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACTGATAAGCTCCTTCTCTTTTGAGCTAACACTGAAGGCTTTTTCTTAATTCCTTTTTGGGATTTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCATATTGTTTCCTCTGCTGTAAGCAAATTAATTATCCTTCATTAACGCCAGTGGAACAAATATGTTTGATCCAGATAAAACTAAATATGGCAGAATTTTGCCTTTATATAACAAAGTAATTCCTCAACAGTATCTTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAAAAAA
  5   1   2  SIG                                     Xt7.1-CBWN16631.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGGATTCCGCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGAAGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCCGTTCCTCTGGGGCGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAACACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTCTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTCGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGTGATTACCTGGAGATCTACAACGGAGACTCCACCTCTGCTCCACTTTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCAAGAAGTGTCCTACCCTGAGTGCTGCCATCTGCTGCCGGATCTTATGGGGCAGAGAGGAACATAACATTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCATGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACAGATAAGCTCCTTCTCTTTTGAGCTAACATTGAAGGCTTTTCCTTAATTCTTATTTGAAATTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCACATTGTTTCCTCTGCTGCAAGCAAATTAATTATCCTTCATTAACACCAGTGGAACAAAGCCCTACGGTGATCGAGATGAAACCTATTATGGTAGAATGTTGCCTTTATAGAACAAAGTAATTCCTCAACAGTATATTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAA
                                                  Xt7.1-CHK-1008282488                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCGCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGAAGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCCGTTCCTCTGGGGCGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAACACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTCTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTCGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGTGATTACCTGGAGATCTACAACGGAGACTCCACCTCTGCTCCACTTTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCAAGAAGTGTCCTACCCTGAGTGCTGCCATCTGCTGCCGGATCTTATGGGGCAGAGAGGAACATAACATTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCATGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACAGATAAGCTCCTTCTCTTTTGAGCTAACATTGAAGGCTTTTCCTTAATTCTTATTTGAAATTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCACATTGTTTCCTCTGCTGCAAGCAAATTAATTATCCTTCATTAACACCAGTGGAACAAAGCCCTACGGTGATCGAGATGAAACCTATTATGGTAGAATGTTGCCTTTATAGAACAAAGTAATTCCTCAACAGTATATTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAA
  5   1   4      seed Te1       in                        CBWN15978.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCCCCATGGATTCCGCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGAAGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCCGTTCCTCTGGGGCGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAACACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTCTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTCGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCCGGCTGTAT
  5   1   3        nb Te1       in                        CBWN12646.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGGATTCCGCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGAAGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCCGTTCCTCTGGGGCGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAACACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTCTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTCGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATC
  5   1   3        nb Te1       in                         CBWN2948.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGGATTCCGCTGCTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGAAGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCCGTTCCTCTGGGGCGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAACACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTCTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTCGGCATGNAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAG
  5   1   3        nb Te1       in                        CBWN16466.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCCCATCCTCCTCCTCCTCCCCTGGCTGCTCAGCGTGGCGCTCACTCTGCCCATAGAGGTTATCTTCCCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGAAGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCCGTTCCTCTGGGGCGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAACACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACC
  5   1   2       ext Te1       in                        CBWN16631.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCGAGCCACCGCTAATGAAACGAATCCCGTGTTTGGGGAAGATGTCTTCGGGGACATCCTGAGAGCCAATGAAGGAACCAACGTTCTGCTCCGTGAAACAGACATCGCCGTTCCTCTGGGGCGTAACTCCATTTCCTGCAAGACCTGCCTGTGGCCCAAATCGACCAATGGGAGAGTGAACGTGCCCTACGTCTTCGATGAAAAGTACTCTGAAGGGGAAAAGAACACCATTAGGGAAGCCATGAAGGATTTTGCAACCATGACCTGTGTGGAGTTTGTCCCTAAAACGGCGGAGCCCAACTATCTTTCTATCCACCCCGGGGACGGCTGCTGGTCATTTATGGGAGTGTTGGGTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTCTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTCGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGT
  5   1   3        nb Te1       in                         CBWN9426.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGGAGCCCAAGGGGTGTCGCTTGGCGGCGGCTGCCTGGGGTATCGCACCATACAACATGAACTGACCCATGCCTTGGGATTCTGGCACGAGCAGAACCGGAGCGACCGGAATAAATATATTGATGTATTCTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTCGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCANACCGCTACTGGATT
  5   1   3        nb Te1       in                         CBWN1381.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAACCGGAGCGACCGGAATAAATATATTGATGTATTCTGGCAGTACATCTCTCCAGATGCTTCTATCAACTACCAAGAAATGGACACCAACAACCTCGGCATGGAGTATGACTACGTGTCGGCAATGCATTATGAAAACTGGATGTTCAGTAACACGTCTGGGAAGATCACCATGGCGGCTAAGGATGATCCTAGCAGACGTTTAGGTGGAGCTAAAGAGCTGACCAACCTGGATTACAGTAAGATAAACCGGCTGTATGAATGCGATGTCGTTAGCACATTACTTAATGAAGAGCGTGGGACCCTGAAGTCGGCCAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAAGAACATCACATCTCCCAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAGCCGCCAGTGCCGCCGTGATTACCTGGAGAT
  5   1   2       ext Te1       in                        CBWN13747.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCTGAAGTCGGCTAATTACCCTTCGCCGTACCCCAATAACGCCAAGTCCTATTTCCTGATTAGGACGGGTTCTCAGCAGGTGTCCCTAAAATTTGAGGCTTTTGATATTCAATCTTCCCCTCAGTGTAGCGCTGACTACATTAAAATATATGATGGTTCCACTAAATCCTCCCCGGTCCTACTGGAGAAATCATGTGGGACAGGGAAACACCCCCCGCTGATAGCCTCGGGCCGAGCCCTCCTGCTAGAGTTCCTCAGTGACGGGGCTCAAACCGCTACTGGATTCAAGGCTTTATATGAAACAGTGGAATGTGGAGGCACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGTGATTACCTGGAGATCTACAACGGAGACTCCACCTCTGCTCCACTTTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCAAGAAGTGTCCTACCCTGAGTGCTGCCATCTGCTGCCGGATCTTATGGGGCAGAGAGGAACATAACATTTAATATATACCTGT
  3   1   2       ext Te1       in                        CBWN16631.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATGTGGAGGCACCTACACCCACCCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGTGATTACCTGGAGATCTACAACGGAGACTCCACCTCTGCTCCACTTTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCAAGAAGTGTCCTACCCTGAGTGCTGCCATCTGCTGCCGGATCTTATGGGGCAGAGAGGAACATAACATTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCATGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACAGATAAGCTCCTTCTCTTTTGAGCTAACATTGAAGGCTTTTCCTTAATTCTTATTTGAAATTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCACATTGTTTCCTCTGCTGCAAGCAAATTAATTATCCTTCATTAACACCAGTGGAACAAAGCCCTACGGTGATCGAGATGAAACCTATTATGGTAGAATGTTGCCTTTATAGAACAAAGTAATTCCTCAACAGTATATTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAAAAAA
  3   1   4      seed Te1       in                        CBWN15978.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCTACACCACCCCATTAAGGAACATCACATCTCCAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGTGATTACCTGGAGATCTACAACGGAGACTCCACCTCTGCTCCACTTTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCAAGAAGTGTCCTACCCTGAGTGCTGCCATCTGCTGCCGGATCTTATGGGGCAGAGAGGAACATAACATTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCATGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACAGATAAGCTCCTTCTCTTTTGAGCTAACATTGAAGGCTTTTCCTTAATTCTTATTTGAAATTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCACATTGTTTCCTCTGCTGCAAGCAAATTAATTATCCTTCATTAACACCAGTGGAACAAAGCCCTACGGTGATCGAGATGAAACCTATTATGGTAGAATGTTGCCTTTATAGAACAAAGTAATTCCTCAACAGTATATTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAAAAAA
  3   1   2       ext Te1       in                        CBWN13747.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAATTACCCAAAAGACTATCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGTGATTACCTGGAGATCTACAACGGAGACTCCACCTCTGCTCCACTTTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCAAGAAGTGTCCTACCCTGAGTGCTGCCATCTGCTGCCGGATCTTATGGGGCAGAGAGGAACATAACATTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCATGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACAGATAAGCTCCTTCTCTTTTGAGCTAACATTGAAGGCTTTTCCTTAATTCTTATTTGAAATTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTCTGCCACATTGTTTCCTCTGCTGCAAGCAAATTAATTATCCTTCATTAACACCAGTGGAACAAAGCCCTACGGTGATCGAGATGAAACCTATTATGGTAGAATGTTGCCTTTATAGAACAAAGTAATTCCTCAACAGTATATTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAAAAAA
  3   1   3        nb Te1                                 CBWN16352.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCACCTTCCAAAGTCTGCCTGTACCTCATATCTGCTCCCCCCATCCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGTGATTACCTGGAGATCTACAACGGAGACTCCACCTCTGCTCCACTTTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACCAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCAAGAAGTGTCCTACCCTGAGTGCTGCCATCTGCTGCCGGATCTTATGGGGCAGAGAGGAACATAACATTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCATGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACAGATAAGCTCCTTCTCTTTTGAGCTAACATTGAAGGCTTTTCCTTAATTCTTATTTGAAATTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCACATTGTTTCCTCTGCTGCAAGCAAATTAATTATCCTTCATTAACACCAGTGGAACAAAGCCCTACGGTGATCGAGATGAAACCTATTATGGTAGAATGTTGCCTTTATAGAACAAAGTAATTCCTCAACAGTATATTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAAAAAA
  3   1   3        nb Te1       in                         CBWN1381.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTGCTCCCCCATCTACACGATCTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGTGATTACTGGAGATCTACAACGGAGACTCCACCTCTGCTCCACTTTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCAAGAAGTGTCCTACCCTGAGTGCTGCCATCTGCTGCCGGATCTTATGGGGCAGAGAGGAACATAACATTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCATGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACAGATAAGCTCCTTCTCTTTTGAGCTAACATTGAAGGCTTTTCCTTAATTCTTATTTGAAATTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCACATTGTTTCCTCTGCTGCAAGCAAATTAATTATCCTTCATTAACACCAGTGGAACAAAGCCCTACGGTGATCGAGATGAAACCTATTATGGTAGAATGTTGCCTTTATAGAACAAAGTAATTCCTCAACAGTATATTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAAAAAA
  3   1   3        nb Te1       in                        CBWN12646.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCTCTGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGTGATTACCTGGAGATCTACAACGGAGACTCCACCTCTGCTCCACTTTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCAAGAAGTGTCCTACCCTGAGTGCTGCCATCTGCTGCCGGATCTTATGGGCCAGAGAGGAACATAACATTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCATGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACAGATAAGCTCCTTCTCTTTTGAGCTAACATTGAAGGCTTTTCCTTAATTCTTATTTGAAATTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCACATTGTTTCCTCTGCTGCAAGCAAATTAATTATCCTTCATTAACACCAGTGGAACAAAGCCCTACGGTGATCGAGATGAAACCTATTATGGTAGAATGTTGCCTTTATAGAACAAAGTAATTCCTCAACAGTATATTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAAAAAA
  3   1   3        nb Te1       in                         CBWN2948.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGTGATTACCTGGAGATCTACAACGGAGACTCCACCTCTGCTCCACTTTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCAAGAAGTGTCCTACCCTGAGTGCTGCCATCTGCTGCCGGATCTTATGGGGCAGAGAGGAACATAACATTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCATGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACAGATAAGCTCCTTCTCTTTTGAGCTAACATTGAAGGCTTTTCCTTAATTCTTATTTGAAATTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCACATTGTTTCCTCTGCTGCAAGCAAATTAATTATCCTTCATTAACACCAGTGGAACAAAGCCCTACGGTGATCGAGATGAAACCTATTATGGTAGAATGTTGCCTTTATAGAACAAAGTAATTCCTCAACAGTATATTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAAAAAA
  3   1   3        nb Te1       in                         CBWN9426.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGAGTAGTCACCATGGACATCGAGAAAAGCCGCCAGTGCCGCCGTGATTACCTGGAGATCTACAACGGAGACTCCACCTCTGCTCCACTTTTGGGGAGATTCTGCGGCTCCCTAATGATGTGCTCGCCGAGGAGCAATGGGAACAGCATGCTTCTGAGATTCGTCACGAATGGGGACACGCAAGGCAAAGGCTTCCTGCTGAGATACAGCTGGGTTGCACCAAGAAGTGTCCTACCCTGAGTGCTGCCATCTGCTGCCGGATCTTATGGGGCAGAGAGGAACATAACATTTAATATATACCTGTGTGCCTAATGAACATAAGGGCCACTAGGTGTCACTACAGCTCTGCTTGCTCATGGGTCTCCTGTTGTTCTACCCTTTCCTTGCACAGATAAGCTCCTTCTCTTTTGAGCTAACATTGAAGGCTTTTCCTTAATTCTTATTTGAAATTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCACATTGTTTCCTCTGCTGCAAGCAAATTAATTATCCTTCATTAACACCAGTGGAACAAAGCCCTACGGTGATCGAGATGAAACCTATTATGGTAGAATGTTGCCTTTATAGAACAAAGTAATTCCTCAACAGTATATTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAAAAAA
  3   1   3        nb Te1       in                        CBWN16466.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGCTTTTCTTAATTCTTATTTGAAATTATGTTTTAGAAATGGGGGTGCCTTTGCCTGAGTGGGTGCTGCCACATTGTTTCCTCTGCTGCAAGCAAATTAATTATCCTTCATTAACACCAGTGGAACAAAGCCCTACGGTGATCGAGATGAAACCTATTATGGTAGAATGTTGCCTTTATAGAACAAAGTAATTCCTCAACAGTATATTTTATGGTTGGAATAACCCTTTTTACCGAGCAACAATAATAAATACAATTAAATATAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)