Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Oct 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAM664.5                            15 END     13          9       86                Similar to CREB binding protein (Rubinstein-Taybi syndrome) [Xenopus laevis]
     2   2.0    0Xt7.1-CABK5702.5                            8 END     7           5       87                LOC495689 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 789.0    0Xt7.1-TNeu125n18.3                         33 PI      77        465     1787                E1A binding protein p300 [Xenopus tropicalis]
     4 478.0    0Xt7.1-CAAK10746.5                           4 PI      77       1923     2704                E1A binding protein p300; E1A-binding protein, 300kD [Homo sapiens]

 This cluster: approximate FL confidence score = 0%

 1012072262 Xt7.1-TGas121f05.3 - 139 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960......4970......4980......4990......5000......5010......5020......5030......5040......5050......5060......5070......5080......5090......5100......5110......5120......5130......5140......5150......5160......5170......5180......5190......5200......5210......5220......5230......5240......5250......5260......5270......5280......5290......5300......5310......5320......5330......5340......5350......5360......5370......5380......5390......5400......5410......5420......5430......5440......5450......5460......5470......5480......5490......5500......5510......5520......5530......5540......5550......5560......5570......5580......5590......5600......5610......5620......5630......5640......5650......5660......5670......5680......5690......5700......5710......5720......5730......5740......5750......5760......5770......5780......5790......5800......5810......5820......5830......5840......5850......5860......5870......5880......5890......5900......5910......5920......5930......5940......5950......5960......5970......5980......5990......6000
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas121f05.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACAGGCAGCAGCAAGTGTAGATAATCATGTACGGACCCCAGCTTCCGTTGCCAGCACTGACAACCAGCCTGCGCCTGATCATTCTATGACGGAAGTGAAGGTAGAAGGCAAAACGGATGAACCAGAGGCGTGTGAAAACCAAGTAGAGCCCAAAACAGAGGTGGAACCAGATGCATCCTCTCAGGTGAAGGAGCCTGTGTGCGAGAGCACTGAGATCAAATCAGAGCCAATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTTGAGAAAAAGAAAAATGATATGCTTGATCCAGAGCCTTTTGTAGACTGCAAAGAGTGTGGGAGGAAGATGCATCAGATCTGTGTCCTGCATTTTGATATTATTTGGCCTTCTGGCTTTGTCTGTGATAACTGCTTGAAAAAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAGAAAAAAAATAATAAAAAGACCAACAAAAATAAAAGCAGTATGAGTCGCGCCAACAAGAAGAAAGCAAGCATGCCTAATGTTTGTAATGATCTCAGCCAGAAGCTCTATGCCACCATGGAGAAGCATAAAGAGGTGTTTTTTGTGATTCATTTCTATGCGGGGCCAGTTATTAATTCCCTCCCACCCATTGCGGATCCGGACCCGCTCTTGAGCTGTGACTTAATGGACGGAAGGGATGCGTTCCTGACTCTAGCCCGTGATAAGCATTGGGAGTTCTCATCACTGCGACGTTCCAAGTGGTCCACACTTTGCATGCTGGTGGAACTACACACGCAAGGCCAGGACCGCTTTGTCTACACCTGCAATGAATGCAAGCATCACGTGGAGACACGTTGGCACTGCACAGTGTGTGAGGATTATGATTTGTGTGTGAACTGCTACAATGCAAAGAGCCACGAGCACAAGATGGTGAAATGGGGTCTTGGGCTGGATGATGAAAGTAACAGCCAGGGTGAGGCACAGTCTAAGAGTCCCCAGGAGTCTCGCCGGCTTAGCATCCAGAGATGCATCCAGTCCTTGGTTCATGCCTGTCAGTGTCGCAATGCCAATTGTTCACTTCCCTCGTGCCAGAAGATGAAGAGGGTGGTACAGCACACCAAGGGTTGCAAGCGCAAGACCAATGGTGGTTGCCCTGTTTGCAAGCAGTTGATTGCCTTGTGTTGCTACCATGCTAAGCACTGCCAAGAGAACAAATGCCCAGTGCCCTTCTGTCTAAACATTAAGCAAAAGTTAAGACAGCAGCAGATTCAACACCGGCTGCAGCAGGCGCAACTTATGCGACGACGGATGGCAACTATGAATACCCGAGCAGTTCCGCAGCAGAGCCTCCCATCCCCTACCTCAGCAACACCTGGAACACCCACACAGCAGCCGAGCACCCCACAAACTCCACAGCCTGCTCCACAACCATCTCCAGTAAGCATAGCTTCACCTGGCTTTCCCAGTGTTCAAAGGACTCAGCCCCCAAATGTAGCATCACAGGGCAAGCCAACAAATCCAGTTCCACCCGTGCCTCCCTCTCAGCCCACTGTGCAGCCCCCACCAGCTGCTGTTGCAGCTGCCCGGCAAATAGAACTAGAGGCCCAACAACAGCAGCTTTACAGGGTCACCAGCATTGCAGAAGGGATAAATAGTGCACGTCCTGGCATGGTCAACCCATCTGTTGGGTCTGTGAACCCCATGCAGCAAATGGCTATGAATGTGCCACGTCCTGGTCCCATTGGTGCACCTCCTATCATGGCAGGAATGCAGCCAGGACAGTGGCCAGCGGCCCAACTCCCTCAGCAACCTCAAATGCAGCAGAGCATCCAGCGACCGGTGATGCAAATGGCCACGGCACAGCAGGCAGTTGCAGGACCTCGTCTGGCAGGCGTACCCCCACAGCAGGCACGTAATATAGCACCTGCCCCCAATGCCTTGCAGGATCTGCTGCGTACCCTCAAATCACCAAGCTCTCCGCAACAGCAGCAACAGGTGCTTAATATTTTGAAGTCCAATCCACACCTAATGGCAGCTTTTATTAAGCAAAGGACTGCTAAGTATGTGGCCAACCAGCCTGGAATGCAGCCCCAGCAAGCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCGGTCGGGGTGCCAAGGGCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATCGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCTATTCATTTGCTGGTCTGCACATCAGGGAAACAGGGCCTCAGTCTGGACTGAGACCGCTGCCCCATGCCCCCCTCCTTCCCCAGCCTAACCCATGCGCTGCCAGAGAAGTTTTATAGTGCGCTGCTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAAACAACAAACAACAAACAAAAAAAAAAAAACAAATTTCAAGCAATCACAATGTTTAAATCATGCAAGTTCTACCGGTATAAATAAGAAGAGCTTTGGGAAAGAGACTCTGAATCACTGTACAGAATGGTAGAAGGCGTGACGAGAAAAAAAAACAAACCAATGGGAGCATTTCTTAAAACTCAATGACATTGTTAACTCTTTGGCTGCCAGAGGGGCCAAGCGAGGCTTCATTGACCTCTCTGACAGCGGGGGGTGGAAATACTGTCTTGACAGCAGCTATTTTCTTGCTGAGTAAAAAGTGTACATGGTATTAAAACTTCAGTGTTCTGGGTTTTTTTCATTCTTTCTTATTTTATTTTTTTTTTGTTTTGTTTATGAAAATGCTGTTTTCAACATTGTACGCTGGACTATGCATGTTTTTTTTAATTGTATATAAAGTATTGCTTAAAAATTGATATAAATTACTGAA
                                                  Xt7.1-CHK-1008222467                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCAGCAAGTGTAGATAATCATGTACGGACCCCAGCTTCCGTTGCCAGCACTGACAACCAGCCTGCGCCTGATCATTCTATGACGGAAGTGAAGGTAGAAGGCAAAACGGATGAACCAGAGGCGTGTGAAAACCAAGTAGAGCCCAAAACAGAGGTGGAACCAGATGCATCCTCTCAGGTGAAGGAGCCTGTGTGCGAGAGCACTGAGATCAAATCAGAGCCAATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTTGAGAAAAAGAAAAATGATATGCTTGATCCAGAGCCTTTTGTAGACTGCAAAGAGTGTGGGAGGAAGATGCATCAGATCTGTGTCCTGCATTTTGATATTATTTGGCCTTCTGGCTTTGTCTGTGATAACTGCTTGAAAAAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAGAAAAAAAATAATAAAAAGACCAACAAAAATAAAAGCAGTATGAGTCGCGCCAACAAGAAGAAAGCAAGCATGCCTAATGTTTGTAATGATCTCAGCCAGAAGCTCTATGCCACCATGGAGAAGCATAAAGAGGTGTTTTTTGTGATTCATTTCTATGCGGGGCCAGTTATTAATTCCCTCCCACCCATTGCGGATCCGGACCCGCTCTTGAGCTGTGACTTAATGGACGGAAGGGATGCGTTCCTGACTCTAGCCCGTGATAAGCATTGGGAGTTCTCATCACTGCGACGTTCCAAGTGGTCCACACTTTGCATGCTGGTGGAACTACACACGCAAGGCCAGGACCGCTTTGTCTACACCTGCAATGAATGCAAGCATCACGTGGAGACACGTTGGCACTGCACAGTGTGTGAGGATTATGATTTGTGTGTGAACTGCTACAATGCAAAGAGCCACGAGCACAAGATGGTGAAATGGGGTCTTGGGCTGGATGATGAAAGTAACAGCCAGGGTGAGGCACAGTCTAAGAGTCCCCAGGAGTCTCGCCGGCTTAGCATCCAGAGATGCATCCAGTCCTTGGTTCATGCCTGTCAGTGTCGCAATGCCAATTGTTCACTTCCCTCGTGCCAGAAGATGAAGAGGGTGGTACAGCACACCAAGGGTTGCAAGCGCAAGACCAATGGTGGTTGCCCTGTTTGCAAGCAGTTGATTGCCTTGTGTTGCTACCATGCTAAGCACTGCCAAGAGAACAAATGCCCAGTGCCCTTCTGTCTAAACATTAAGCAAAAGTTAAGACAGCAGCAGATTCAACACCGGCTGCAGCAGGCGCAACTTATGCGACGACGGATGGCAACTATGAATACCCGAGCAGTTCCGCAGCAGAGCCTCCCATCCCCTACCTCAGCAACACCTGGAACACCCACACAGCAGCCGAGCACCCCACAAACTCCACAGCCTGCTCCACAACCATCTCCAGTAAGCATAGCTTCACCTGGCTTTCCCAGTGTTCAAAGGACTCAGCCCCCAAATGTAGCATCACAGGGCAAGCCAACAAATCCAGTTCCACCCGTGCCTCCCTCTCAGCCCACTGTGCAGCCCCCACCAGCTGCTGTTGCAGCTGCCCGGCAAATAGAACTAGAGGCCCAACAACAGCAGCTTTACAGGGTCACCAGCATTGCAGAAGGGATAAATAGTGCACGTCCTGGCATGGTCAACCCATCTGTTGGGTCTGTGAACCCCATGCAGCAAATGGCTATGAATGTGCCACGTCCTGGTCCCATTGGTGCACCTCCTATCATGGCAGGAATGCAGCCAGGACAGTGGCCAGCGGCCCAACTCCCTCAGCAACCTCAAATGCAGCAGAGCATCCAGCGACCGGTGATGCAAATGGCCACGGCACAGCAGGCAGTTGCAGGACCTCGTCTGGCAGGCGTACCCCCACAGCAGGCACGTAATATAGCACCTGCCCCCAATGCCTTGCAGGATCTGCTGCGTACCCTCAAATCACCAAGCTCTCCGCAACAGCAGCAACAGGTGCTTAATATTTTGAAGTCCAATCCACACCTAATGGCAGCTTTTATTAAGCAAAGGACTGCTAAGTATGTGGCCAACCAGCCTGGAATGCAGCCCCAGCAAGCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCGGTCGGGGTGCCAAGGGCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATCGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCTATTCATTTGCTGGTCTGCACATCAGGGAAACAGGGCCTCAGTCTGGACTGAGACCGCTGCCCCATGCCCCCCTCCTTCCCCAGCCTAACCCATGCGCTGCCAGAGAAGTTTTATAGTGCGCTGCTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAAACAACAAACAACAAACAAAAAAAAAAAAACAAATTTCAAGCAATCACAATGTTTAAATCATGCAAGTTCTACCGGTATAAATAAGAAGAGCTTTGGGAAAGAGACTCTGAATCACTGTACAGAATGGTAGAAGGCGTGACGAGAAAAAAAAACAAACCAATGGGAGCATTTCTTAAAACTCAATGACATTGTTAACTCTTTGGCTGCCAGAGGGGCCAAGCGAGGCTTCATTGACCTCTCTGACAGCGGGGGGTGGAAATACTGTCTTGACAGCAGCTATTTTCTTGCTGAGTAAAAAGTGTACATGGTATTAAAACTTCAGTGTTCTGGGTTTTTTTCATTCTTTCTTATTTTATTTTTTTTTTGTTTTGTTTATGAAAATGCTGTTTTCAACATTGTACGCTGGACTATGCATGTTTTTTTTAATTGTATATAAAGTATTGCTTAAAAATTGATATAAATTACTGAAATTTTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              4     5     4     5     4     5     4     5     4     5     4     5     6     7     6     7     8     9     8     9     8     9     9     9    11    11    11    11    11    11    12    12    12    12    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    17    17    17    18    18    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    16    17    17    18    17    17    17    17    17    17    16    16    16    16    17    17    17    17    17    17    17    17    18    18    17    18    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    18    18    10    10    11    11    11    11    11    12    11    12    11    12    12    12    12    12    11    11    11    12    12    13    12    13    13    13    16    17    21    23    24    25    24    25    25    26    26    27    28    29    27    28    31    32    31    33    31    33    32    33    32    33    33    34    33    34    33    34    33    34    33    34    33    34    33    34    33    34    33    34    35    35    35    35    35    35    35    35    34    34    34    34    34    34    34    35    34    35    35    35    35    35    35    35    35    35    35    35    35    35    34    34    35    35    35    35    35    35    35    36    36    36    35    35    35    35    35    35    35    35    35    35    35    35    35    35    36    36    35    36    35    37    35    36    34    36    34    36    32    33    32    33    32    33    31    32    29    32    27    29    27    29    27    29    27    29    27    29    26    28    10    12     8    11     7     9     7     9     6     8     7     9     7     9     7     9     8     9     8     9     8     9     6     9     7     9     7     9     7     9     7     9     7     8     7     8     7     8     7     8     7     8     6     8     7     8     7     8     6     7     6     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     3     4     4     4     4     4     4     4     4     4     4     4     4     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     6     6     7     7     7     7     7     7     6     7     7     7     8     8     8     8     8     8     8     8     9     9     8     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9    10    10     9     9     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9    10    10    10    10    10    10    10    10    11    11    11    11    14    14    14    14    14    14    14    14    14    14    14    14    13    14    13    14    13    14    14    15    14    16    15    16    15    16    14    15    14    15    14    15    13    14    13    14    14    15    17    18    18    19    19    21    18    20    18    21    20    23    22    23    21    23    22    23    22    23    23    24    23    24    22    24    22    23    25    28    27    28    27    28    27    28    27    28    27    28    26    28    27    29    28    30    28    30    28    30    28    30    28    30    28    30    28    30    26    29    26    28    24    26    24    25    23    24    23    24    23    24    23    23    22    22    22    22    22    22    23    23    23    23    23    23    23    23    24    24    23    23    23    23    23    23    23    23    22    23    23    23    22    23    22    22    22    23    22    23    24    24    23    24    23    23    23    23    20    21    20    21    19    21    18    21    17    21    17    21    18    21    16    18    16    17    14    15    13    14     8     9     8     9     8     8     8     8     9     9     9    11    12    12    14    14    13    13    14    14    14    14    14    14    14    14    16    16    17    18    17    18    17    19    17    19    16    18    17    19    17    19    17    19    16    19    17    19    17    19    17    19    17    19    17    20    17    20    16    20    17    20    17    20    17    20    18    21    16    20    18    20    19    25    20    26    20    26    20    26    22    24    22    24    15    23    15    23    16    23    16    24    17    24    16    24    17    24    16    23    16    23    16    23    16    21    16    21    16    21    15    21    15    21    17    22    17    22    17    22    13    18    18    19    15    21    15    21    15    21    15    21    16    21    17    22    19    22    19    22    16    22    18    23    18    23    17    23    17    23    18    22     8    12     9    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11    10    11     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     8    10     6    10     6    10     6     9     6     8     7     8     7     8     7     8     7     8     6     8     5     8     5     7     4     5     3     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 G-----------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Sc ---- 1e-014     NP_010213.1 bromodomain protein, homolog of BDF1; Bdf2p [Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PREDICTED - Bf ---- 4e-016     AAM18869.1 unknown [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 0          NP_499161.1 CBP/p300 homolog CBP-1 (cbp-1) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 0          CAJ82869.1 E1A binding protein p300 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ci ---- 0          FAA00132.1 TPA: zinc finger protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 0          NP_524642.2 nejire CG15319-PB [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 0          XP_782558.2 PREDICTED: similar to CREB binding protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Dr ---- 0          XP_695493.1 PREDICTED: similar to CREB-binding protein [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_004371.1 CREB binding protein [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_001020603.1 CREB binding protein [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_414964.2 PREDICTED: similar to CREB binding protein [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAH86282.1 LOC495689 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 0          NP_001088637.1 hypothetical protein LOC495689 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas121f05.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------ATG---ATG---------------------------------------ATG------ATG---------------------------------------------ATG------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------ATG------------------------ATG------ATG---------------------------------------------ATG---------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------------TAG---------------------------------------ATG---------------TAA------------------------------------------TAA------------------------------------TAA---------------------------------------------------------------------------------------------------TAA---ATG------------------------------TGA---------------------------------------------------------------------TAG---TGA---TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------TAA------------------------------------------------------------------------------------TAA---------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------TAA---------------------------------------ATG---------------------------------ATG---------------------TGA------TAA------------------------------------TGA------TGA------------------------TGA------------------TGA------------------------------------------------------------------------------------TGA---------------------------------------------TAA---------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  3  -1   2       bld Fat1      in                         CABC9552.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAGTGCAAGCGGCAGCCCAAGCTCAGCTCACTCCACAGCCGCCAACACCTGTGCCCATTCAATCTGTACCCACGCCGCAACCTGCCCAGCTGCAACCTACGTCTGTGCATGCACCAGCTCCTGGCACTCCGCTATCACAGGCAGCAGCAAGTGTAGATAATCATGTACGGACCCCAGCTTCCGTTGCCAGCACTGACAACCAGCCTGCGCCTGATCATTCTATGACGGAAGTGAAGGTAGAAGGCAAAACGGATGAACCAGAGGCGTGTGAAAACCAAGTAGAGCCCAAAACAGAGGTGGAACCAGATGCATCCTCTCAGGTGAAGGAGCCTGTGTGCGAGAGCACTGAGATCAAATCAGAGCCAATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGGCTGCCTACTTCAGCTATC
  5   1   2       bld Gas       in                   TGas097f23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     cggacgaaagggggccgcctctctcccggagcgcaccgcCAACACCTGTGCCCATTCAATCTGTACCCACGCCGCAACCTGCCCAGCTGCAACCTACGTCTGTGCATGCACCAGCTCCTGGCACTCCGCTATCACAGGCAGCAGCAAGTGTAGATAATCATGTACGGACCCCAGCTTCCGTTGCCAGCACTGACAACCAGCCTGCGCCTGATCATTCTATGACGGAAGTGAAGGTAGAAGGCAAAACGGATGAACCAGAGGCGTGTGAAAACCAAGTAGAGCCCAAAACAGAGGTGGAACCAGATGCATCCTCTCAGGTGAAGGAGCCTGTGTGCGAGAGCACTGAGATCAAATCAGAGCCAATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAATACTGCACTAAGCTTGCTGAAGTCTT
  5   1   2       bld Neu       in                   TNeu081g18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGGGCCCAGCTGCAACCTACGTCTGTGCATGCACCAGCTCCTGGCACTCCGCTATCACAGGCAGCAGCAAGTGTAGATAATCATGTACGGACCCCAGCTTCCGTTGCCAGCACTGACAACCAGCCTGCGCCTGATCATTCTATGACGGAAGTGAAGGTAGAAGGCAAAACGGATGAACCAAGGCGTGTGAAAACCAAGTATATCCCAAAACAGAGGTGGAACCAGATGCATCCTCTCAAGTGAAGGAGCCTGTGTGCGAGAGCACTGAGATCAAATCAGAGCCAATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTGCACCATTAAACGAAAGCTGGACACTGGACAGTAC
  3   1   2       bld Gas       in                    TGas097f23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACAGGCAGCAGCAAGTGTAGATAATCATGTACGGACCCCAGCTTCCGTTGCCAGCACTGACAACCAGCCTGCGCCTGATCATTCTATGACGGAAGTGAAGGTAGAAGGCAAAACGGATGAACCAGAGGCGTGTGAAAACCAAGTAGAGCCCAAAACAGAGGTGGAACCAGATGCATCCTCTCAGGTGAAGGAGCCTGTGTGCGAGAGCACTGAGATCAAATCAGAGCCAATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       out                   TGas119f09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACAGGCAGCAGCAAGTGTAGATAATCATGTACGGACCCCAGCTTCCGTTGCCAGCACTGACAACCAGCCTGCGCCTGATCATTCTATGACGGAAGTGAAGGTAGAAGGCAAAACGGATGAACCAGAGGCGTGTGAAAACCAAGTAGAGCCCAAAACAGAGGTGGAACCAGATGCATCCTCTCAGGTGAAGGAGCCTGTGTGCGAGAGCACTGAGATCAAATCAGAGCCAATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTGA
  5   1   2       bld Te3       in                        CAAM16328.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACCAGCCTGCGCCTGATCATTCTATGACGGAAGTGAAGGTAGAAGGCAAAACGGATGAACCAGAGGCGTGTGAAAACCAAGTAGAGCCCAAAACAGAGGTGGAACCAGATGCATCCTCTCAGGTGAAGGAGCCTGTGTGCGAGAGCACTGAGATCAAATCAGAGCCAATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCC
  3  -1   2       bld Ski1      in                         CABJ2309.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGCCTGCGCCTGATCATTCTATGACGGAAGTGAAGGTAGAAGGCAAAACGGATGAACCAGAGGCGTGTGAAAACCAAGTAGAGCCCAAAACAGAGGTGGAACCAGATGCATCCTCTCAGGTGAAGGAGCCTGTGTGCGAGAGCACTGAGATCAAATCAGAGCCAATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTTGAG
  3   1   2       bld Te3       out                        CAAM3922.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACGGAAGTGAAGGTAGAAGGCAAAACAGATGAACCAGAGGCGTGTGAAAACCAAGTAGAGCCCAAAACAGAGGTGGAACCAGATGCATCCTCTCAGGTGAAGGAGCCTGTGTGCGAGAGCACTGAGATCAAATCAGAGCCAATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTTG
  5   1   2       bld Neu       in                   TNeu064h20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGAAGTGAAGGTAGAAGGCAAAACGGATGAACCAGAGGCGTGTGAAAACCAAGTAGAGCCCAAAACAGAGGTGGAACCAGATGCATCCTCTCAGGTGAAGGAGCCTGTGTGCGAGAGCACTGAGATCAAATCAGAGCCAATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTG
  3   1   2       bld Te3       out                        CAAM7929.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAAAACCAAGTAGAGCCCAAAACAGAGGTGGAACCAGATGCATCCTCTCAGGTGAAGGAGCCTGTGTGCGAGAGCACTGAGATCAAATCAGAGCCAATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTGAG
  3   1   2       bld Brn3      out                        CAAK3148.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTAGAGCCCAAAACAGAGGTGGAACCAGATGCATCCTCTCAGGTGAAGGAGCCTGTGTGCGAGAGCACTGAGATCAAATCAGAGCCAATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTTGAG
  5   1   2       bld Lun1      in                        CABD10977.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCAGGTGAAGGAGCCTGTGTGCGAGAGCACTGAGATCAAATCAGAGCCAATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTTGAGAAAAAGAAAAATGATATGCTTGATCCAGAGCCTTTTGTAGACTGCAAAGAGTGTGGGAGGAAGATGCATCAGATCTGTGTCCTGCATTTTGATATTATTTGGCCTTCTGGCTTTGTCT
  5   1   2       bld Brn3      in                        CAAK12086.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAGAGCACTGAGATCAAATCAGAGCCAATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTTGAGAAAAAGAAAAATGATATGCTTGATCCAGAGCCTTTTGTAGACTGCAAAGAGTGTGGGAGGAAGATGCATCAGATCTGTGTCCTGCATTTTGATATTATTTGGCCTTCTGGCTTTGTCTGTGATAACTGCTTGAAAAAAACA
  3   1   2       bld Egg       ?                     TEgg002o12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGGAGGTGGAGGAGAAGAAAACTGAAATAAAAACGGAGAACAAAGAGGAGGAAGAAAATGGTGGCACCAACAGTTCCCTTCAGTCCACTTCACCTTCTCAGCCACGGAAGAAGATTTTTAAACCTGAAGAACTGCGGCAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tbd0      in                     NISC_nl04c10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGCTCTGATGCCCACACTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTTGAGAAAAAGAAAAATGATATGCTTGATCCAGAGCCTTTTGTAGACTGCAAAGAGTGTGGGAGGAAGATGCATCAGATCTGTGTCCTGCAT
  5   1   2       bld Te3       in                         CAAM7662.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTGAAGCCTTATATCGACAGGATCCAGAATCCTTACCCTTTCGCCAGCCTGTTGATCCTCAACTGCTGGGAATCCCAGATTACTTTGACATTGTGAAAAACCCTATGGACTTGTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTTGAGAAAAAGAAAAATGATATGCTTGATCCAGAGCCTTTTGTAGACTGCAAAGAGTGTGGGAGGAAGATGCATCAGATCTGTGTCCTGCATTTTGATATTATTTGGCCTTCTGGCTTTGTCTGTGATAACTGCTTGAAAAAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGT
  5   1   2       bld Gas       in                   TGas128i08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAACCTATGGATTTCTCCACCATTAAACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTTGAGAAAAAGAAAAATGATATGCTTGAT
  5   1   2       bld Gas7                                 XZG63346.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACGAAAGCTGGACACTGGACAGTACCAGGAGCCATGGCAGTATGTGGATGATGTCTGGCTAATGTTTAATAATGCCTGGCTGTACAACAGAAAGACCTCCCGGGTCTACAAATACTGCACTAAGCTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTTGAGAAAAAGAAAAATGATATGCTTGATCCAGAGCCTTTTGTAGACTGCAAAGAGTGTGGGAGGAAGATGCATCAGATCTGTGTCCTGCATTTTGATATTATTTGGCCTTCTGGCTTTGTCTGTGATAACTGCTTGAAAAAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCC
  5   1   2       bld Hrt1      in                         CAAQ4644.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTGCTGAAGTCTTTGAACAGGAGATTGATCCCGTCATGCAGTCTCTTGGCTATTGCTGTGGGCGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTTGAGAAAAAGAAAAATGATATGCTTGATCCAGAGCCTTTTGTAGACTGCAAAGAGTGTGGGAGGAAGATGCATCAGATCTGTGTCCTGCATTTTGATATTATTTGGCCTTCTGGCTTTGTCTGTGATAACTGCTTGAAAAAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTGNCTATGTCACA
  3   1   2       bld Neu       in                    TNeu064h20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCAAGTTTGAGTTCTCTCCTCAAACTCTATGCTGCTATGGGAAGCAGCTGTGTACCATTCCACGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTTGAGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Ova1      in                         CABE3190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCATTCCCGCGATGCTGCCTACTTCAGCTATCAGAATAGATACCACTTCTGTGAAAAGTGCTTCACAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTTGAGAAAAAGAAAAATGATATGCTTGATCCAGAGCCTTTTGTAGACTGCAAAGAGTGTGGGAGGAAGATGCATCAGATCTGTGTCCTGCATTTTGATATTATTTGGCCTTCTGGCTTTGTCTGTGATAACTGCTTGAAAAAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCCTGAC
  5   1   2       bld Brn2      in                        CAAJ15364.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAGATCCAGGGGGAGAATGTCACTTTAGGAGATGATCCTTCCCAACCTCAAACGACAATATCCAAGGAGCAATTTGAGAAAAAGAAAAATGATATGCTTGATCCAGAGCCTTTTGTAGACTGCAAAGAGTGTGGGAGGAAGATGCATCAGATCTGTGTCCTGCATTTTGATATTATTTGGCCTTCTGGCTTTGTCTGTGATAACTGCTTGAAAAAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAAGCAGCACCCGAGGATCGTCTCACT
  5   1   2       bld Te4       in                        CAAN10058.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAAACGACAATATCCAAGGAGCAATTTGAGAAAAAGAAAAATGATATGCTTGATCCAGAGCCTTTTGTAGACTGCAAAGAGTGTGGGAGGAAGATGCATCAGATCTGTGTCCTGCATTTTGATATTATTTGGCCTTCTGGCTTTGTCTGTGATAACTGCTTGAAAAAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGGCAGCAACCGAGGATCGTCTCACTAGTGCCCAAGGAACTTCCATACTTTT
  3   1   2       bld Gas       in                    TGas128i08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAAAAGAAAAATGATATGCTTGATCCAGAGCCTTTTGTAGACTGCAAAGAGTGTGGGAGGAAGATGCATCAGATCTGTGTCCTGCATTTTGATATTATTTGGCCTTCTGGCTTTGTCTGTGATAACTGCTTGAAAAAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTGAGCAGGAAGAAGAGGAAAAAAAAAAAAAAAAA
  5   1   2       bld Te4       in                         CAAN5934.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGATATGCTTGATCCAGAGCCTTTTGTAGACTGCAAAGAGTGTGGGAGGAAGATGCATCAGATCTGTGTCCTGCATTTTGATATTATTTGGCCTTCTGGCTTTGTCTGTGATAACTGCTTGAAAAAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGG
  5  -1   2       bld Ski1      in                         CABJ2309.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGATCCAGAGCCTTTTGTAGACTGCAAAGAGTGTGGAGGAAGATGCATCAGATCTGTGTCCTGCATTTTGATATTATTTGGCCTTCTGGCTTTGTCTGTGATAACTGCTTGAAAAAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTG
  5   1   2       bld Te4       in                         CAAN6504.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTGGCCTTCTGGCTTTGTCTGTGATAACTGGCTTGAAAAAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATC
  3   1   2       bld Gas                            TGas121f05.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGGCTTTGTCTGTGATAACTGCTTGAAAAAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAGAAAAAAAATAATAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Fat1      in                         CABC9552.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGCTTTGTCTGTGATAACTGCTGAAAAAAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAG
  3   1   2       bld Te4       in                        CAAN10058.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCTTGAAAAAACCAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAG
  3   1   2       bld Lun1      in                        CABD10977.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAAAAAA
  3   1   2       bld Spl1      out                        CABK5702.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACAGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAG
  3  -1   2       chi Brn2      in                        CAAJ13905.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTGGCATTTTTGCTATCTCCTTGGCAGCCCTCAGTGGTTTCACAAGCAGCCGTGTTCTCTTCCTTCTTTCTTTCCTCTTCTTCCTGCTCAAGTTCCTTGATGCTCTCTTCTAATACATTAGGCCAGAAATCTCCTTCAAAGTATGGAAGTTCCTTGGCACTAGTGAGACGATCCTCGGTTGCTTGCTTAAAGATATCCTTATAGTCATGAATGATGCGCTCAGCAAAAGCCTTGTCCAGCATCTTTTTATACCACTCCTGCAGACGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAG
  3   1   2      seed Hrt1      out                       CAAQ11766.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGGAGGACACGGAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAGAAAAAAAAA
  3   1   2       bld Brn2      in                        CAAJ15364.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAG
  3   1   2       bld Te3       in                        CAAM16328.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGG
  3   1   2       bld Te3       out                        CAAM6775.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTTGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGACAGCATCAAGGAACTTGAGCAGGAAGAAGAGG
  3   1   2       bld Te3       out                        CAAM7979.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAGAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATTAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGC
  3   1   2       bld Ova1      in                         CABE3190.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAAAGAAAACAAATTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAAAAAAAAAA
  3   1   2       bld Te3       out                        CAAM3971.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAAACAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAG
  3   1   2       bld Te3       in                         CAAM7662.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAATTTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTTGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAG
  3   1   2       bld Hrt1      in                         CAAQ4644.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTGCGCAAAGAGGCTCCAAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCA
  3   1   2       bld Te3       out                        CAAM1236.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAACCACACGCTTAGGAAATCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAG
  3   1   2       bld Te3       out                        CAAM1588.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCACCTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAG
  5   1   2       bld Te4       ?                         CAAN11002.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTAGAAGATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCANAAATGCCAAGAAAAAAAATAATAAAAAGACCCACAAAAATAAAAGCAGTATGAGTCGC
  3   1   2       bld Te3       out                         CAAM664.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATCGAGTGAATAAGTTCTTGCGGAGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAG
  3   1   2       bld Te3       out                       CAAM14767.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAG
  3   1   2       bld Te3       out                       CAAM16119.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAG
  3   1   2       bld Te4       out                        CAAN8283.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAG
  3   1   2       bld Te3       out                        CAAM5058.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAGAATCATCCAGAGGCAGGAGAAGTGTCCGTAAGGGTTGTGGCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAG
  3   1   2       bld Te4       out                        CAAN2300.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGCAGGAGAAAGTGTCCGTAAGGGGTGGTGCCCAGTTCGGATAAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAG
  5   1   2       bld Te4       in                        CAAN11281.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAATAGTGGAAGTGAGACCTGGAATGAAATCCAAGTTTGTGGACACAGGTGAAATGCCAGAATCCTTCCCATACCGTACAAAAGCTCTGTTCGCATTTGAGGAGATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAGAAAAAAAATAATAAAAAGACCAACAAAAATAAAAGCAGTATGAGTCGCGCCAACAAGAAGAAAGCAAGCATGCCTAATGTTTGTAATGATCTCAGCCAGAAGCTCTATGCCACCATGGAGAAACATAAAGAGGTACTGTACTATCCACTTTCATAATATGGGGGATAAGTAGCACTTATGGGGCTCCTGT
  5   1   2       bld Lun1      in                        CABD12147.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTGATGGTGTAGACGTGTGTTTCTTTGGCATGCACGTGCAGGAATATGGCTCTGACTGCCCTATGCCTAACACCAGACGGGTATACATCTCCTATCTGGACAGTATTCACTTCTTCAGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAGAAAAAAAATAATAAAAAGACCAACAAAAATAAAAGCAGTATGAGTCGCGCCAACAAGAAGAAAGCAAGCATGCCTAATGTTTGTAATGATCTCAGCCAGAAGCTCTATGCCACCATGGAGAAGCATAAAGAGGTGTTTTTTGTGATTCATTTCTATGCGGGGCCAGTTATTAATTCCCTCCCACCCATTGCGGATCCGGACCCGCTCTTGAGCTGTGACTTAATGGACGGAAGGGATGCGTTCCTGACTCTAGCCCGTGATAAGCATTGGGAGTTCTCATCACTGCGACGTT
  5   1   2       bld Te4       in                         CAAN6515.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCCGGATTCCCGGGATTCGTCGACCCCGCGTCCGGACCACGCAGCCTACGAACTGCTGTCTACCATGAAATACTCATTGGTTACTTGGAATATGTGAAAAAACTTGGCTATGTCACAGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAGAAAAAAAATAATAAAAAGACCAACAAAAATAAAAGCAGTATGAGTCGCGCCAACAAGAAGAAAGCAAGCATGCCTAATGTTTGTAATGATCTCAGCCAGAAGCTCTATGCCACCATGGAGAAGCATAAAGAGGTGTTTTTTGTGATTCATTTCTATGCGGGGCCAGTTATTAATTCCCTCCCACCCATTGCGGATCCGGACCCGCTCTTGAGCTGTGACTTAATGGACGGAAGGGATGCGTTCCTGACTCTAGCCCGTGATAAGCATTGGGAGTTCTCATCACTGCGACGTTCCAAGTGGTCCACACTTTGCATGCTGGTGGAACTACACACGCAAGGCCAGGACCGCTTTGTCTACACCTGCAATGAATGCAAGCATCACGTGGAGACACGTTGGCACTGCA
  3   1   2       bld Neu       in                    TNeu081g18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGCATATCTGGGCTTGCCCACCAAGTGAAGGCGACGACTACATATTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAGAAAAAAAAAAAAAAAAA
  3   1   2       bld Te3       out                        CAAM3768.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTACATATTTTCATTGCCACCCGCCTGACCAAAAAATCCCCAAGCCTAAACGTCTGCAGGAGTGGTATAAAAAGATGCTGGACAAGGCTTTTGCTGAGCGCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAGAAAAAAAATAATAAAAAGACCAAC
  5   1   2       chi Egg  5g3  out                  TEgg044j03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCATCATTCATGACTATAAGGATATCTTTAAGCAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAGAAAAAAAAAAAAAAAAAAGGGGAGGGAAGCCGGAAGATGCCCCAACGGAACCTCCTCATCCTCTATGGGAGTCAGACGGGGACAGCGGAGGATTTGGCTGGGAGACTCGGCAGGGAAGCCAAGCGCCACCACTTCCAATGTAGGATGGAATCGCTCGATGAGTACAGGGTGGCTGATCTTATTCACGAGCCCCTCGTGGTATTTGTCTGCGCCACTACAGGGCAGGGGGACCCCCCCGATAACATGAAGAACTTCTGGAGGTTTATATTCCGGAGGAATCTCCCCCACAATGCCCTTTGCCGGATGGATTATGCCGTTTTAGGCCTCGGTGATTCTTCCTACCCAAAGTTTAACTTCATAGCAAAGAAACTGCACAAGCGCCTGCAGCAGCTCGGAGCCTGCCCCCTCCTGCCCCCGGCGCT
  5   1   2       bld Te4       ?                          CAAN9003.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAGCAACCGAGGATCGTCTCACTAGTGCCAAGGAACTTCCATACTTTGAAGGAGATTTCTGGCCTAATGTATTAGAAGAGAGCATCAAGGAACTTGAGCAGGAAGAAGAGGAAAGAAAGAAGGAAGAGAACACGGCTGCTTGTGAAACCACTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAGAAAAAAAAATAATAAAAAGACCAACAAAAATAAAAGCAGTATGAGTCGCGCCAACAAGAAGAAAGCAAGCATGCCTAATGTTTGTAATGATCTCAGCCAGAAGCTCTATGCCACCATGGAGAAGCATAAAGAGGTGTTTTTTGTGATTCATTTCTATGCGGGGCCAGTTATTAATTCCCTCCCACCCATTGCGGATCCGGACCCGCTCTTGAGCTGTGACTTAATGGACGGAAGGGATGCGTTCCTGACTCTAGCCCGTGATAAGCATTGGGAGTTCTCATCACTGCGACGTTCCAAGTGGTCCACACTTTGCATGCTGGTGGAACTACACACGCAAGGCCAGGACCGCTTTGTCTACACCTGCAATGAATGCAAGCATCACGTGGAGACACGTTGGCACTGCACAGTGTGTGAGGATTATGATTTGTGTGTGAACTGCTACAATGCAAAGAGCCACGAGCACAAGATGGTGAAATGGGGTCTTGGGCTGGATGATGAAAGTAACAGCCAGGGTGAGGCACAGTCTAAGAGTCCCCAGGAGTCTCGCCGGCTTAGCATCCAGAGATGCATCCAGTCCTTGGTTCATGCTTGTCAGTGTCGCAATGCCAATTGTTCACTTCCCT
  3  -1   2       bld Egg                             TEgg004d13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             cctgcatcccatccattaaactgacctccccgtgcagaggcggggatattcccataaaagcgaaaagaccctatggagctttagactTACGGCAACTGCTAAGCAATCCAACCCCACACGGGAAAAACAGACAATTAAGCAACAAGAAGAAAGCAAGCATGCCTAATGTTTGTAATGATCTCAGCCAGAAGCTCTATGCCACCATGGAGAAGCATAAAGAGGCGTTTTTTGTGATTCATTTCTATGCGGGGCCAGTTATTAATTCCCTCCCACCCATTGCGGATCCGGACCCGCTCTTGAGCTGTGACTTAATGGACGGAAGGGATGCGTTCCTGACTCTAGCCCGAGATAAGCATTGGGAGTTCTCATCACTGCGACGTTCCAAGTGGTCCACACTTTGCATGCTGGTGGAACTACACACGCAAGGCCAGGACCGCTTTGTCTACACCTGCAATGAATGCAAGCATCACGTGGAGACACGTTGGCACTGCACAGTGTGTGAGGATTATGATTTGTGTGTGAACTGCTACAATGCAAAGAGCCACGAGCACAAGATGGTGAAATGGGGTCTTGGGCTGGATGATGAAAGTAACAGCCAGGGTGAGGCACAGTCTAAGAGTCCCCAGGAGTCTC
  5   1   2       bld Lun1      in                          CABD752.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGAGGGCTGCCAAGGAGATAGCAAAAATGCCAAGAAAAAAAATAATAAAAAGACCAACAAAAATAAAAGCAGTATGAGTCGCGCCAACAAGAAGAAAGCAAGCATGCCTAATGTTTGTAATGATCTCAGCCAGAAGCTCTATGCCACCATGGAGAAGCATAAAGAGGTGTTTTTTGTGATTCATTTCTATGCGGGGCCAGTTATTAATTCCCTCCCACCCATTGCGGATCCGGACCCGCTCTTGAGCTGTGACTTAATGGACGGAAGGGATGCGTTCCTGACTCTAGCCCGTGATAAGCATTGGGAGTTCTCATCACTGCGACGTTCCAAGTGGTCCACACTTTGCATGCTGGTGGAACTACACACGCAAGGCCAGGACCGCTTTGTCTACACCTGCAATGAATGCAAGCATCACGTGGAGACACGTTGGCACTGCACAGTGTGTGAGGATTATGATTTGTGTGTGAACTGCTACAATGCAAAGAGCCACGAGCACAAGATGGTGAAATGGGGTCTTGGGCTGGATGATGAAAGTAACAGCCAGGGTGAGGCACAGTCTAAGAGTCCCCAGGAGTCTCGCCGGCTTAGCATCCAGAGATGCATCCAGTCCTTGGTTCATGCCTGTCAGTGTCGCAATGCCAATTGTTCACTTCCCTCGTGCCAGAAGATGAAGAGGGTGGTACAGCACACCAAGGGTTGCAAGCGCAAGACCAATGGTGGTTGCCCTGTTTGCAAGCAGTTGATTGCCTTGTGTTGCTACCATGCTAAGCACTGCCAAGAGAACAAATGCCCAGTGCCCTTCTGTCTAAACATTAAGCAAAAGTTAAGACAGCAGCAGATTCAACACCGGCTGCAGCAGGCGCAACTTATGCGACGA
  5   1   2       bld Neu       in                   TNeu055f12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAAATATAAAAAGACCAACAAAAATAAAAGCAGTATGAGTCGCGCCAACAAGAAGAAAGCAAGCATGCCTAATGTTTGTAATGATCTCAGCCAGAAGCTCTATGCCACCATGGAGAAGCATAAAGAGGTGTTTTTTGTGATTCATTTCTATGCGGGGCCAGTTATTAATTCCCTCCCACCCATTGCGGATCCGGACCCGCTCTTGAGCTGTGACTTAATGGACGGAAGGGATGCGTTCCTGACTCTAGCCCGTGATAAGCATTGGGAGTTCTCATCACTGCGACGTTCCAAGTGGTCCACACTTTGCATGCTGGTGGAACTACACACGCAAGGCCAGGACCGCTTTGTCTACACCTGCAATGAATGCAAGCATCACGTGGAGACACGTTGGCACTGCACAGTGTGTGAGGATTATGATTTGTGTGTGAACTGCTACAATGCAAAGAGCCACGAGCACAAGATGGTGAAATGGGGTCTTGGGCTGGATGATGAAAGTAACAGCCAGGGTGAGGCACAGTCTAAGAGTCCCCAGGAGTCTCGCCGGCTTATCATCCAGAGATGCATCCAGTCCTTGGTTCATGCCTGTCAGTGTCGCAATGCCAATTGTTCACTTCCTCGTG
  5   1   2       bld Gas       in                   TGas101n11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGAAGAAAGCAAGCATGCCTAATGTTTGTAATGATGCTCAGCCAGAAGCTCTATGCCACCATGGAGAAGCATAAAGAGGTGTGTTTTGTGATTCATTTCTATGCGGGGCCAGGTATTAATTCCCTCCCACCCATTGCGGATCCGGACCCGCTCTTGAGCTGTGACTTAATGGACGGAAGGGATGCGTTCCTGAGGGGAGCCCGTGATAAGCATTGGGAGTTCTCATCACTGCGACGTTCCAAGTGGGCCACACTTTG
  5   1   2       bld Gas8      in                          st26i22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCACAGTCTAAGAGTCCCCAGGAGTTCTCGCCGGCTTAGCATCCAGAGATGCATCCAGTCCTTGGTTCATGCCTGTCAGTGTCGCAATGCCAATTGTTCACTTCCCTCGTGCCAGAAGATGAAGAGGGTGGTACAGCACACCAAGGGTTGCAAGCGCAAGACCAATGGTGGTTGCCCTGTTTGCAAGCAGTTGATTGCCTTGTGTTGCTACCATGCTAAGCACTGCCAAGAGAACAAATGCCCAGTGCCCTTCTGTCTAAACATTAAGCAAAAGTTAAGACAGCAGCAGATTCAACACCGGCTGCAGCAGGCGCAACTTATGCGACGACGGATGGCAACTATGAATACCCGAGCAGTTCCGCAGCAGAGCCTCCCATCCCCTACCTCAGCAACACCTGGAACACCCACACAGCAGCCGAGCACCCCACAAACTCCACAGCCTGCTCCACAACCATCTCCAGTAAGCATAGCTTCACCTGGCTTTCCCAGTGTTCAAAGGACTCAGCCCCCAAATGTAGCATCACAGGGCAAGCCAACAAATCCAGTTCCACCCGTGCCTCCCTCTCAGCCCACTGTGCAGCCCCCACCAGCTGCTGTTGCAGCTGCCCGGCAAATAGAACTAGAGGCCCAACAACAGCAGCTTTACAGGGTCACCAGCATTGCAGAAGGGATAAATAGTGCACGTCCTGGCATGGTCAACCCATCTGTTGGGTCTGTGAACCCCATG
  5   1   2       bld Gas8      in                         st108i04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACAGCAGCAGATTCAACACCGGCTGCAGCAGGCGCAACTTATGCGACGACGGATGGCAACTATGAATACCCGAGCAGTTCCGCAGCAGAGCCTCCCATCCCCTACCTCAGCAACACCTGGAACACCCACACAGCAGCCGAGCACCCCACAAACTCCACAGCCTGCTCCACAACCATCTCCAGTAAGCATAGCTTCACCTGGCTTTCCCAGTGTTCAAAGGACTCAGCCCCCAAATGTAGCATCACAGGGCAAGCCAACAAATCCAGTTCCACCCGTGCCTCCCTCTCAGCCCACTGTGCAGCCCCCACCAGCTGCTGTTGCAGCTGCCCGGCAAATAGAACTAGAGGCCCAACAACAGCAGCTTTACAGGGTCACCAGCATTGCAGAAGGGATAAATAGTGCACGTCCTGGCATGGTCAACCCATCTGTTGGGTCTGTGAACCCCATGCAGCAAATGGCTATGAATGTGCCACGTCCTGGTCCCATTGGTGCACCTCCTATCATGGCAGGAATGCAGCCAGGACAGTGGCCAGCGGCCCAACTCCCTCAGCAACCTCAAATGCAGCAGAGCATCCAGCGACCGGTGATGCAAATGGCCACGGCACAGCAGGCAGTTGCAGGACCTCGTCTGGCAGGCGTACCCCCACAGCAGGCACGTAATATAGCACCTGCCCC
  5   1   2       bld Fat1      in                         CABC5130.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAACACCCACACAGCAGCCGAGCACCCCACAAACTCCACAGCCTGCTCCACAACCATCTCCAGTAAGCATAGCTTCACCTGGCTTTCCCAGTGTTCAAAGGACTCAGCCCCCAAATGTAGCATCACAGGGCAAGCCAACAAATCCAGTTCCACCCGTGCCTCCCTCTCAGCCCACTGTGCAGCCCCCACCAGCTGCTGTTGCAGCTGCCCGGCAAATAGAACTAGAGGCCCAACAACAGCAGCTTTACAGGGTCACCAGCATTGCAGAAGGGATAAATAGTGCACGTCCTGGCATGGTCAACCCATCTGTTGGGTCTGTGAACCCCATGCAGCAAATGGCTATGAATGTGCCACGTCCTGGTCCCATTGGTGCACCCCCTATCATGGCAGGAATGCAGCCAGGACAGTGGCCAGCGGCCCAACTCCCTCAGCAACCTCAAATGCAGCAGAGCATCCAGCGACCGGTGATGCAAATGGCCACGGCACAGCAGGCAGTTGCAGGACCTCGTCTGGCAGGCGTACCCCCACAGCAGGCACGTAATATAGCACCTGCCCCCAATGCCTTGCAGGATCTGCTGCGTACCCTCAAATCACCAAGCTCTCCGCAACAGCAGCAACAGGTGCTTAATATTTTGAAGTCCAATCCACACCTAATGGCAGCTTTTATTAAGCAAAGGACTGCTAAGTATGTGGCCAACCAGCCTGGAATGCAGCCCCAGCAAGCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCGGTCGGGGTGCCAAGGGCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCCACAGGCCAAGGCATTGGCTTGATGAACACAGCTC
  5   1   2       bld Fat1      in                          CABC844.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCGATTCAATTGGCACGAGGGCCTGCTCCCAACCATCTCCAGTAAGCATAGCTTCACCTGGCTTTCCCAGTGTTCAAAGGACTCAGCCCCCAAATGTAGCATCACAGGGCAAGCCAACAAATCCAGTTCCACCCGTGCCTCCCTCTCAGCCCACTGTGCAGCCCCCACCAGCTGCTGTTGCAGCTGCCCGGCAAATAGAACTAGAGGCCCAACAACAGCAGCTTTACAGGGTCACCAGCATTGCAGAAGGGATAAATAGTGCACGTCCTGGCATGGTCAACCCATCTGTTGGGTCTGTGAACCCCATGCAGCAAATGGCTATGAATGTGCCACGTCCTGGTCCCATTGGTGCACCTCCTATCATGGCAGGAATGCAGCCAGGACAGTGGCCAGCGGCCCAACTCCCTCAGCAACCTCAAATGCAGCAGAGCATCCAGCGACCGGTGATGCAAATGGCCACGGCACAGCAGGCAGTTGCAGGACCTCGTCTGGCAGGCGTACCCCCACAGCAGGCACGTAATATAGCACCTGCCCCCAATGCCTTGCAGGATCTGCTGCGTACCCTCAAATCACCAAGCTCTCCGCAACAGCAGCAACAGGTGCTTAATATTTTGAAGTCCAATCCACACCTAATGGCAGCTTTTATTAAGCAAAGGACTGCTAAGTATGTGGCCAACCAGCCTGGAATGCAGCCCCAGCAAGCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCGGTCGGGGTGCCAAGGGCAGCTG
  5   1   2       bld Gas8      in                          st27p01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCCAGTTCCACCCGTGCCTCCCTCTCAGCCCACTGTGCAGCCCCCACCAGCTGCTGTTGCANCTGCCCGGCAAATANAACTANAGGCCCAACANCAGCAGCTTTACAGGGTCACCAGNATTGCAGAAGGGATAAATAGTGCACGTCCTGGNATGGTCAACCCATNTGTTGGGTCTGTGAACCCCATGCAGCAAATGGCTATGAATGTGCCACGTCCTGGTCCCATTGGTGCACCTCCTATCATGGNNGGAATGCAGCCAGGACAGTGGCCAGCGGCCCAACTCCCTCAGCAACCTCAAATGCAGCAGAGCATCCAGCGACCGGTGATGCAAATGGCCACGGCACAGCAGGCAGTTGCAGGACCTCGTCTGGCAGGCGTACCCCCACAGCAGGCACGTAATATAGCACCTGCCCCNA
  5   1   2       bld Bone      in                       CBTC11041.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGTTCCACCCGTGCCTCCCTCTCAGCCCACTGTGCAGCCCCCACCAGCTGCTGTGGCAGCTGCCCGGCAAATAGAACTAGAGGCCCAACAACAGCAGCTTTACAGGGTCACCAGCATTGCAGAAGGGATGAATAGTGCACGTCCTGGCATGGTCAACCCATCTGTTGGGTCTGTGAACCCCATGCAGCAAATGGCTATGAATGTGCCACGTCCTGGTCCCATTGGTGCACCCCCTATCATGGCAGGAATGCAGCCAGGACAGTGGCCAGCGGCCCAACTCCCTCAGCAACCTCAAATGCAGCAGAGCATCCAGCGACCGGTGATGCAAATGGCCACGGCACAGCAGGCAGTTGCAGGACCTCGTCTGGCAGGCGTACCCCCACAGCAGGCACGTAATATAGCACCTGCCCCCAATGCCTTGCAGGATCTGCTGCGTACCCTCAAATCACCAAGCTCTCCGCAACAGCAGCAACAGGTGCTTAATATTTTGAAGTCCAATCCACACCTAATGGCAGCTTTTATTAAGCAAAGGACTGCTAAGTATGTGGCCAACCAGCCTGGAATGCAGCCCCAGCAAGCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCGGTCGGGGTGCCAAGGGCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATG
  5   1   2       bld Hrt1      in                         CAAQ5640.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCGTGCCTCCCTCTCAGCCCACTGTGCAGCCCCCACCAGCTGCTGTTGCAGCTGCCCGGCAAATAGAACTAGAGGCCCAACAACAGCAGCTTTACAGGGTCACCAGCATTGCAGAAGGGATAAATAGTGCACGTCCTGGCATGGTCAACCCATCTGTTGGGTCTGTGAACCCCATGCAGCAAATGGCTATGAATGTGCCACGTCCTGGTCCCATTGGTGCACCTCCTATCATGGCAGGAATGCAGCCAGGACAGTGGCCAGCGGCCCAACTCCCTCAGCAACCTCAAATGCAGCAGAGCATCCAGCGACCGGTGATGCAAATGGCCACGGCACAGCAGGCAGTTGCAGGACCTCGTCTGGCAGGCGTACCCCCACAGCAGGCACGTAATATAGCACCTGCCCCCAATGCCTTGCAGGATCTGCTGCGTACCCTCAAATCACCAAGCTCTCCGCAACAGCAGCAACAGGTGCTTAATATTTTGAAGTCCAATCCACACCTAATGGCAGCTTTTATTAAGCAAAGGACTGCTAAGTATGTGGCCAACCAGCCTGGAATGCAGCCCCAGCAAGCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCGGTCGGGGTGCCAAGGGCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATCGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAAACACAGCAGCAGCAGAGTGCAGCGGGTAT
  5   1   2       bld Lun1      in                        CABD13870.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGAGGCCCAACAACAGCAGCTTTACAGGGTCACCAGCATTGCAGAAGGGATAAATAGTGCACGTCCTGGCATGGTCAACCCATCTGTTGGGTCTGTGAACCCCATGCAGCAAATGGCTATGAATGTGCCACGTCCTGGTCCCATTGGTGCACCTCCTATCATGGCAGGAATGCAGCCAGGACAGTGGCCAGCGGCCCAACTCCCTCAGCAACCTCAAATGCAGCAGAGCATCCAGCGACCGGTGATGCAAATGGCCACGGCACAGCAGGCAGTTGCAGGACCTCGTCTGGCAGGCGTACCCCCACAGCAGGCACGTAATATAGCACCTGCCCCCAATGCCTTGCAGGATCTGCTGCGTACCCTCAAATCACCAAGCTCTCCGCAACAGCAGCAACAGGTGCTTAATATTTTGAAGTCCAATCCACACCTAATGGCAGCTTTTATTAAGCAAAGGACTGCTAAGTATGTGGCCAACCAGCCTGGAATGCAGCCCCAGCAAGCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCGGTCGGGGTGCCAAGGGCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATCGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATG
  5   1   2       bld HdA       in                  THdA001p19.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTGCAGAAGGGATAAATAGTGCACGTCCTGACATGGTCAACCCATCTGTTGGGTCTGTGAACCCCATGCAGCAAATGGCTATGAATGTGCCACGTCCTGGTCCCATTGGTGCACCCCCTATCATGGCAGGAATGCAGCCAGGACAGTGGCCAGCGGCCCAACTCCCTCAGCAACCTCAAATGCAGCAGAGCATCCAGCGACCGGTGATGCAAATGGCCACGGCACAGCAGGCAGTTGCAGGACCTCGTCTGGCAGGCGTACCCCCACAGCAGGCACGTAATATAGCACCTGCCCCCAATGCCTTGCAGGATCTGCTGCGTACCCTCAAATCACCAAGCTCTCCGCAACAGCAGCAACAGGTGCTTAATATTTTGAAGTCCAATCCACACCTAATGGCAGCTTTTATTAAGCAAAGGACTGCTAAGTATGTGGCCAACCAGCCTGGAATGCAGCCCCAGCAAGCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCNGGTCGGGGTGCCAAGGGCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATCGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCT
  5   1   2       bld Hrt1      in                         CAAQ3893.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGTCTGGCAGGCGTACCCCCACAGCAGGCACGTAATATAGCACCTGCCCCCAATGCCTTGCAGGATCTGCTGCGTACCCTCAAATCACCAAGCTCTCCGCAACAGCAGCAACAGGTGCTTAATATTTTGAAGTCCAATCCACACCTAATGGCAGCTTTTATTAAGCAAAGGACTGCTAAGTATGTGGCCAACCAGCCTGGAATGCAGCCCCAGCAAGCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCGGTCGGGGTGCCAAGGGCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATCGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCTCAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAG
  5  -1   2       bld Brn2      in                        CAAJ13905.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGCAGGCACGTAATATAGCACCTGCCCCCAATGCCTTGCAGGATCTGCTGCGTACCCTCAAATCACCAAGCTCTCCGCAACAGCAGCAACAGGTGCTTAATATTTTGAAGTCCAATCCACACCTAATGGCAGCTTTTATTAAGCAAAGGACTGCTAAGTATGTGGCCAACCAGCCTGGAATGCAGCCCCAGCAAGCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCGGTCGGGGTGCCAAGGGCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATCGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGTGGGTAAAT
  5   1   2       bld Eye       in                         CCAX6399.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTTGAAGTCCAATCCACACCTAATGGCAGCTTTTATTAAGCAAAGGACTGCTAAGTATGTGGCCAACCAGCCTGGAATGCAGCCCCAGCAAGCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCGGTCGGGGTGCCAAGGGCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATCGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCC
  3   1   2       bld Neu       in                    TNeu055f12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAATGGCAGCTTTTATTAAGCAAAGGACTGCTAAGTATGTGGCCAACCAGCCTGGAATGCAGCCCCAGCAAGCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCGGTCGGGGTGCCAAGGGCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATTGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCCCAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGGGGTACCATGGGACAGATCCCTCAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATTAAACGTATCCAGCAGCAAGATCAAAGCAACAAAATTGCTTTCCGGACACGGCTAATTCCACTGAGCCCACCAAAAGGCACCTTTTGATCTGGCCAAACCCCCCATCAGCCCCTTTGGTGTAGGGGGCCAGGCCAATTGTAAAAAAAAAAAAGAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas8      in                         st100l17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCCTGGAATGCAGCCCCAGCAAGCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCGGTCGGGGTGCCAAGGGCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATCGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCNGGGTGGTACCATGGGACAGATCCCTCGGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACC
  5   1   2       bld Gas8      in                         st115d11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCGGTCGGGGTGCCAAGGGCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATCGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCTCAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTG
  5   1   2       bld Gas8      in                         st116d11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCGGTCGGGGTGCCAAGGGCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATCGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCTCAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCNGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAA
  5   1   2       bld Gas8      in                         st114d11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCACCCCAACAGCAGCAGCAGCCACAACAGCCTGGTATGCATCCACAAGCCGGCCTGCAGAACATGAGCCCCATGCCGGTCGGGGTGCCAAGGGCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATCGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCNGGGTGGTACCATGGGACAGATCCCTCAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCNGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCC
  5   1   2       bld Te4       in                         CAAN9208.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAGCTGTTCCCCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATCGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACT
  5   1   2       bld Gas8                                   st3a04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGCAGCAGCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATCGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACC
  5   1   2       bld Limb      in                        CBSU6580.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCAGGTATGGCTCCACAGGGCCAAGGCATTGGCTTGATGAACACAGCTCATAATACTAACCTCGCAAATATAAACCCGCAGTACCGAGAGATGTATCGACGACAACAACTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCTCAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACANATGACTTGTCCCTTGTTGGAGACACTTCAGGNGACACCTTGGAAAAATTTGTTGAAGGGGTGT
  3   1   2       bld Lun1      in                        CABD12147.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAACAATTTTTACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACGNCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCTCAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCTATTC
  3   1   2       bld Te4       in                         CAAN5934.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACAGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTTAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCT
  3   1   2       bld Te4       in                         CAAN6515.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCACAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTTAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACATTATTTT
  5   1   2       bld Gas                            TGas023f04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTTAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCC
  3   1   2       bld Fat1      in                         CABC5130.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAGCAGCAACAACAACAACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATGGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTTAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCG
  3   1   2       bld Gas8      in                         st114d11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACAGCAGCAGCAGAGTGCAGCGGGTATGGCCGGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCTCAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCC
  3   1   2       bld Gas8      in                          st26i22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACAGCAGCAGCAGAGTGCAGCGGTATGGCCGGGGATTGCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTNTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCANCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTTAANCCGCCCAATCGTAGTGCCNTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCCTATTTTGTTATATATAAATATAAATATATAAATATCT
  3   1   2       bld Gas8      in                         st108i04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCCGGGGGATTGCCAGCACATGGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCTCAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACAT
  3   1   2       bld Te4       in                         CAAN9208.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCAGCACATGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCTATTC
  5   1   2       bld Ovi1      in                         CABI8983.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCATCGATTCGGGCAGTTCCAGCAACCGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCTCAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCTATTCATTTGCTGGTCTGCACATCAGGGAAACAGGGCCTCAGTCTGGACTGAGACCGCTGCCCCATGCCCCCCTCCTTCCCCAGCCTAACCCATGCGCTGCCAG
  3   1   2       bld Bone      in                       CBTC11041.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCT
  3   1   2       chi Neu       out                   TNeu114a02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTAATCTGTTCTCTCTATTAGGGAGAGCCCCCCCTTATATTTGGAGAGAGGTTGGGTCCTACAGGTGCATCGGGGCAATAGGGGGGCTCTGTCCGCAGGGTCCCCCCAAAAATATAAGGCATGCAGGGAGCATACCCACAACCGCAAGCCTTGCAGCAGCAACGCATGCAGCAGCATCTGTCTATCCAGGGTGGTACCATGGGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTTAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCAGGACATTATTTTAAAATAAATTTTTTT
  3   1   2       bld Gas8      in                         st116d11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACCATGGGACAGATCCNTCAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTNTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATC
  3   1   2       bld Limb      in                        CBSU6580.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGGGACAGATCCCTCAGATGGCACAGCCGGGGCTGGCAAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCTATTC
  5   1   2       bld Gas       in                   TGas071n10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACT
  5   1   2       bld Gas       in                   TGas082g19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGACAGATCCCACAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCC
  3   1   2       bld Gas8      in                         st115d11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGATCCCTCAGATGGCACAGCCGGGGCTTGGCAATGAAGGTTCACAGGCAAGCCTTCAGCAAGCTTTGCATCAACGTATCCAGCAGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAAGCTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATC
  5   1   2       bld Te4       in                        CAAN10589.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCAGATCAAGCAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTTAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCTATTCATTTGCTGGTCTGCACATCAGGGAAACAGGGCCTCAGTCTGGACTGAGACCGCTGCCCCATGCCCCCCTCCTTCCCCAGCCTAACCCATGCGCTGCCAGAGAAGTTTTATAGTGCGCTGCTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGNGATAATATAGCAGTGAAAATGAACAGTTC
  5   1   2       bld Gas       in                   TGas124c11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAACAAATTGCTTCCGGACAGGCTAATCCCATGAGCCCACAGCAACACCTTCTGACTGGCCAACCCCCCTCAGCCCATTTACCCACTGGCCAGCAAATTGCAACTGCTCTAAGTAATCAGGTGCGGTCACCAGCCCCTGTCCAATCACCTCGGCCTCAGTCACAGCCTCCACATTCCAGCCCTTCACCCCGTGTACAGCCACAGCCTTCCCCGCACCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGTTTGGGGGGTTTTATAAACCCCATACATCTCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCTATTCATTTGCTGGTCTGCACAT
  3   1   2       bld Ovi1      in                         CABI8983.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CANCACGTTTCACCCCAGACAGGCTCTCCCCACCCAGGCTTGGCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTCAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCTATTCATTTGCTGGTCTGCACATCAGGGAAACAGGGCCTCAGTCTGGACTGAGACCGCTGCCCCATGCCCCCCTCCTTCCCCAGCCTAACCCATGCGCTGCCAGAGAAGTTTTATAGTGCGCTGCTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAAC
  3   1   2       bld Gas       in                    TGas101n11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAGCCTCTATGGGTAACTCCCTAGACCAGGGTCATTTGGGAAATCCAGAGCAGAGCGCCATGCTTCCGCAGCTTAACCCGCCCAATCGTAGTGCCCTAACAAATGACTTGTCCCTTGTTGGAGACACTTCAGGGGACACCTTGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCTATTCATTTGCTGGTCTGCACATCAGGGAAACAGGGCCTCAGTCTGGACTGAGACCGCTGCCCCATGCCCCCCTCCTTCCCCAGCCTAACCCATGCGCTGCCAGAGAAGTTTTATAGTGCGCTGCTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg017l06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGCCCCGGGCTTCAAGGGACACCTTGGAAAAATTTGTTGAAAGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAAGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCTATTCATTTGCTGGTCTGCACATCAAGGAAACAGGGCCTCAGTCTGGACTGAGACCGCTGCCCCATGCCCCCCTCCTTCCCCAGCCTAACCCATGCGCTGCCAGAGAAGTTTTATAGTGCGCTGCTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAAGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCA
  3   1   2       bld Gas       in                    TGas124c11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGAAAAATTTGTTGAAGGGTTGTAGCATCTGCAAGAACAGCAGCGAACTGGAGGAACTGCATTAATGGAGGTTGGGGTTTTATAACCCCATACATCTCCTATTTTGTTATATATAAATATAAATATATAAATATCTTATCTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCTATTCATTTGCTGGTCTGCACATCAGGGAAACAGGGCCTCAGTCTGGACTGAGACCGCTGCCCCATGCCCCCCTCCTTCCCCAGCCTAACCCATGCGCTGCCAGAGAAGTTTTATAGTGCGCTGCTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTACATAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Fat1      in                          CABC844.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCTATTCATTTGCTGGTCTGCACATCAGGGAAACAGGGCCTCAGTCTGGACTGAGACCGCTGCCCCATGCCCCCCTCCTTCCCCAGCCTAACCCATGCGCTGCCAGAGAAGTTTTATAGTGCGCTGCTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAACCTC
  3   1   2       bld Lun1      in                        CABD13870.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTACCCCCTCTGGACATTATTTTAAAATAAATTTTTGTTTGCCTATTCATTTGCTGGTCTGCACATCAGGGAAACAGGGCCTCAGTCTGGACTGAGACCGCTGCCCCATGCCCCCCTCCTTCCCCAGCCTAACCCATGCGCTGCCAGAGAAGTTTTATAGTGCGCTGCTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTTACATT
  5   1   2       bld Neu       in                   TNeu095a17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCAGTCTGGACTGAGACCGCTGCCCCATGCCCCCCTCCTTCCCCAGCCTAACCCATGCGCTGCCAGAGAAGTTTTATAGTGCGCTGCTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGT
  3   1   2       bld Te4       in                         CAAN6504.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGAGACCGCTGCCCCATGCCCCCCCTCCTTCCCCAGCCTAACCCATGCGCTGCCAGAGAAGTTTTATAGTGCGCTGCTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTTACATT
  3   1   2       bld Eye       in                         CCAX6399.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTGCCCCATGCCCCCCTCCTTTCCCCAGCCTAACCCATGCGCTGCCAGAGAAGTTTTATAGTGCGCTGCTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTTTTATCTGTCAGCTGTGGGCACTTTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTTACATTA
  3   1   2       bld Gas8      in                         st100l17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCCCATGCCCCCCTCCTTCCCCAGCCTAACCCATGCGNTGCCAGAGAAGTTTTATAGTGCGCTGCTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGNCAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCNCGGCCGGGGCGGTGGGTNTGGCNCCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCNCTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTNTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATNT
  3   1   2       bld Gas       in                    TGas071n10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCAGCCTAACCCATGCGCTGCCAGAGAAGTTTTATAGTGCGCTGNTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTTCCATTAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTGGGATGGTGTATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas082g19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCAGCCTAACCCATGCGCTGCCAGAGAAGTTTTATAGTGCGCTGNTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGGGTAACCCCCCCTCCCCTCTGTTTCCATTAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu095a17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCAGAGAAGTTTTATAGTGCGCTGNTGAGCATCGCCATGCCCCTTCTCTTGCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTTTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTTTTCCCCCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTTCCATTAAAAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGGATGAGACAGAGAACAGTTCCTGCAAACCTTGGGATGGTGTATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4       in                        CAAN10589.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGGGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTT
  3   1   2       bld Hrt1      in                         CAAQ5640.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGTGGTTGCTATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTGGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAAACAACAAACAAC
  3   1   2       bld Brn3      in                        CAAK12086.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGGGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTT
  3   1   2       bld Lun1      in                          CABD752.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACAACTGGACAGATTTGTGTTTGGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGGGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAAACAACAAACAAC
  3   1   2       bld HdA       in                    THdA001p19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGATAATATAGCAGTGAAAATGACCAGTTCCTTGGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTNTCANTTTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTTTTTTGGCAGAGAAGGGGCAAAGTATAATTAGGGTGATAAAGGGGAAAATGGTTCATACTCTTCCCCTTCGGAGGACGGTCTTACTTGGGTGTTTTTTTTCTTTTTGCAGCTGCGGGGCGTAAAACAAAACAAAAAAAATGGGAAGGGGGGGGGGTTGTCTTCCCACTTGTAACTATATCATATCTTCCACCGCAGAAAAATTCACATTTCCATGGGACTTCTAAAATAAAAAAGTGGGTTGGGGGGGGGCAGGTGCGCTCAAAAAAAACACATTTTGGGGGTTTTTCATTTTTTTCTCCTCCCACGTAGGGGGGCGGAAAAGTTTTTCCACCAAATCCTCCCAAGGGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATTTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGATGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTaaaaaaaaaacaacaaacaacaaacaaaaaaaaaaaaaaaaaaGCG
  3   1   2       bld Hrt1      in                         CAAQ3893.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGTCATTTTGGATTTTTTGTCTGCACGGCCGGGGCGGTGGGTCTGGCACCAATGGTGGTTAACTTGCCCTTGTTTTATTCTCACTCTGGCCTCTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTCCGCTGATATATGTGTAATTTGTTTATATTTCTCCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTTCCATTAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAAACAACAAACAAC
  5   1   2       bld Tbd1                                CBXT10264.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTATCTGTCAGCTGTGGGCACTCTCCTTTGTTCTGGCAGAGAAGGGGCAAAGTATAATTACGCTGATATATGTGTAATTTGTTTATATTTCTTCATTTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAAAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAACAACAAACAACAAACAAAAAAAAAAAAACAAATTTCAAGCAATCACAATGTTTAAATCATGCAAGTTCTACCGGTATAAATAAGAAGAGCTTTGGGAAAGAGACTCTGAATCACTGTACAGAATGGTAGAAGGCGTGACGAGAAAAAAAAAAACAAACCAA
  5   1   2       bld Egg       in                   TEgg027f17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGTTTATATTTCTTCATTTTTTGAGGACTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTAC
  3   1   2       bld Gas6      in                          ANBT627.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTTTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTTTTCCACCAAATCCTCCCAAGGGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAAACAACAAACAAC
  5   1   2       bld Gas6      in                          ANBT627.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTaaaaaaaaaaacaacaaacaacaaaaaaaaaaaaaaaaaa
  3   1   2       bld Gas6      in                          ANBT723.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTTTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGGGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAAACAACAAACAAC
  5   1   2       bld Gas6      in                          ANBT723.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTaaaaaaaaaaacaacaaacaacaaaaaaaaaaaaaaaaaa
  5   1   2       bld Tad5                                 XZT39105.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCTTACTTGGGTGTTTTTTTTCATCTTGCAGCTGCAGAGCCTAAAACAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCTTACCACTTGTAACTATATCATATACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAACAACAAACAACAAACAAAAAAAAAAAAACAAATTTCAAGCAATCACAATGTTTAAATCATGCAAGTTCTACCGGTATAAATAAAAAGAGCTTTGGGAAAGAGACTCTGAATCACTGTACAGAATGGTAGAAGGCGTGACGAGAAAAAAAAAACAAACCAATGG
  3   1   2       bld Gas8      in                          st27p01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTCATCANGCAGNTGCAGAGCCTAAANCAAAACAAAAAAAATGGGAAAGGGGGGGGGTTGTCNTACCACTTGTAANCTATATCATATACTTCAAATGCAGAAAAACTCACATTTCCANTGGACTTCNAAAATAAAAAAGTGGAGNGGGGGGGTGCAGGTCCGCTGTAAAGANACACATTTT
  5   1   2       bld Tad5                                  XZT6943.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACTTCAAATGCAGAAAAATTCACATTTCCATTGGACTTCTAAAATAAAAAAGTGGGGTGGGGGGGTGCAGGTGCGCTGTAAAGAAACACATTTTGTGGGTTTTTCATTTTTTTCTGCTCTCACGTACGACTACAGAAAAGCTCTTCCACCAAATCCTCCCAAGCGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAACAACAAACAACAAACAAAAAAAAAAAAAAACAAATTTCAAGCAATCACAATGTTTAAATCATGCAAGTTCTACCGGTATAAATAAGAAGAGCTTTGGGAAAGAGACTCTGAATCACTGTACAGAATGGTAGAAGGCGTGACGAGAAAAAAAAACAAACCAATGGGAGCATTTCTTAAAACTCAATGACATTGTTAACTCTTTGGCTGCCAGAGGGGCCAAGCGAGGCTTCATTGACCTCTCTGACAGCGGGGGGTGGAAATACTGTCTTGACAGCAGCTATTTTCTTGCTGAGTAAAAAGTGTACATGGTATTAAAAAAAAAAAAAAAAAANAAAAA
  3   1   2       bld Te4       in                        CAAN11281.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTCCACCAAATCCTCCCAAGGGTAACCCCCCCTCCCCTCTGTTTACATTAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAAACAACAAACAACAAACAAAAAAAAAAAAAACAAATTTCAAGCAATCACAATGTTTAAATCATGCAAGTTCTACCGGTATAAATAAGAAGAGCTTTGGGAAAGAGACTCTGAATCACTGTACAGAATGGTAGAAGGCGTGACGAGAAAAAAAAACAAACCAATGGGAGCATTTCTTAAAACTCAATGACATTGTTAACTCTTTGGCTGCCAGAGGGGCCAAGCGAGGCTTCATTGACCTCTCTGACAGCGGGGGGTGGAAATACTGTCTTGACAGCAGCTATTTTCTTGCTGAGTAAAAAGTGTACATGGTATTAAAACTTCAGTGTTCTGGGTTTTTTTCATTCTTTCTTATTTTATTTTTTTTTTGTTTTGTTTATGAAAATGCTGTTTTCAACATTGTACGCTGGACTATGCATGTTTTTTTTAATTGTATATAAAGTATTGCTTAAAAATTGATATAAATTACTGAAATTT
  3   1   2       bld Egg       in                    TEgg017l06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAAAAAAAAAAAAAAAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAACCCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTAGGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAACCCTTTGGGATGGTTGTATTTAAAAAAAAAACCACCAACCACCAACCAAAAAAAAAAAAACAAATTTCAAGCAATCACAATGTTTAAATCATGCAAGTTCTACCGGTATAAATAAGAAGAGCTTTGGGAAAGAGACTCTGAATCACTGTACAGAATGGTAGAAGGCGTGACGAGAAAAAAAAACAAACCAATGGGAGCATTTCTTAAAACTCAATGACATTGTTAACTCTTTGGCTGCCAGAGGGGCCAAGCGAGGCTTCATTGACCTCTCTGACAGCGGGGGGTGGAAATACTGTCTTGACAGCAGCTATTTTCTTGCTGAGTAAAAAGTGTACATGGTATTAAAACTTCAGTGTTCTGGGTTTTTTTCATTCTTTCTTATTTTATTTTTTTTTTGTTTTGTTTATGAAAATGCTGTTTTCAACATTGTACGCTGGACTATGCATTTTTTTTTAATTGTATATAAAGTATTGCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG57311.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACGCGTCCGAAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAAACAACAAACAACAAACAAAAAAAAAAAAACAAATTTCAAGCAATCACAATGTTTAAATCATGCAAGTTCTACCGGTATAAATAAGAAGAGCTTTGGGAAAGAGACTCTGAATCACTGTACAGAATGGTAGAAGGCGTGACGAGAAAAAAAAACAAACCAATGGGAGCATTTCTTAAAACTCAATGACATTGTTAACTCTTTGGCTGCCAGAGGGGCCAAGCGAGGCTTCATTGACCTCTCTGACAGCGGGGGGTGGAAATACTGTCTTGACAGCAGCTATTTTCTTGCTGAGTAAAAAGTGTACATGGTATTAAACAATGACATCTAATT
  5   1   2       bld Gas7      in                         XZG57311.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAAAAGGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAAACAACAAACAACAAACAAAAAAAAAAAAACAAATTTCAAGCAATCACAATGTTTAAATCATGCAAGTTCTACCGGTATAAATAAGAAGAGCTTTGGGAAAGAGACTCTGAATCACTGTACAGAATGGTAGAAGGCGTGACGAGAAAAAAAAACAAACCAATGGGAGCATTTCTTAAAACTCAATGACATTGTTAACTCTTTGGCTGCCAGAGGGGCCAAGCGAGGCTTCATTGACCTCTCTGACAGCGGGGGGTGGAAATACTGTCTTGACAGCAGCTATTTTCTTGCTGAGTAAAAAGTGTACATGGTATTAAACAATGACATCTAATTAAATGAAAAAAAAAAAAAAAGG
  3   1   2       bld Egg       in                    TEgg027f17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGTCAGAGGGAAAGTCGTGCAATCTGATTTCAGCCTCAAACCGAAAACTCCTAATTATTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAAACAACAAACAACAAACAAAAAAAAAAAAACAAATTTCAAGCAATCACAATGTTTAAATCATGCAAGTTCTACCGGTATAAATAAGAAGAGCTTTGGGAAAGAGACTCTGAATCACTGTACAGAATGGTAGAAGGCGTGACGAGAAAAAAAAACAAACCAATGGGAGCATTTCTTAAAACTCAATGACATTGTTAACTCTTTGGCTGCCAGAGGGGCCAAGCGAGGCTTCATTGACCTCTCTGACAGCGGGGGGTGGAAATACTGTCTTGACAGCAGCTATTTTCTTGCTGAGTAAAAAGTGTACATGGTATTAAAACTTCAGTGTTCTGGGTTTTTTTCATTCTTTCTTATTTTATTTTTTTTTTGTTTTGTTTATGAAAATGCTGTTTTCAACATTGTACGCTGGACTATGCATGTTTTTTTTAATTGTATATAAAGTATTGCTTAAAAATTGATATAAATTACTGAAATTTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Hrt1      in                        CAAQ10610.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTCTATTTTATTATAATTATTATTATTTTTTTTTTGTTTTTATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAAACAACAAACAACAAACAAAAAAAAAAAAACAAATTTCAAGCAATCACAATGTTTAAATCATGCAAGTTCTACCGGTATAAATAAGAAGAGCTTTGGGAAAGAGACTCTGAATCACTGTACAGAATGGTAGAAGGCGTGACGAGAAAAAAAAACAAACCAATGGGAGCATTTCTTAAAACTCAATGACATTGTTAACTCTTTGGCTGCCAGAGGGGCCAAGCGAGGCTTCATTGACCTCTCTGACAGCGGGGGGTGGAAATACTGTCTTGACAGCAGCTATTTTCTTGCTGAGTAAAAAGTGTACATGGTATTAAAACTTCAGTGTTCTGGGTTTTTTTCATTCTTTCTTATTTTATTTTTTTTTTGTTTTGTTTATGAAAATGCTGTTTTCAACATTGTACGCTGGACTATGCATGTTTTTTTTAATTGTATATAAAGTATTGCTTAAAAATTGATATAAATTACTGAAATTTAAAAAAAA
  5   1   2       bld Hrt1      in                        CAAQ10610.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGGCTGGGGCATGAGACAGAGAACAGTTCCTGCAAACCTTTGGGATGGTTGTATTTAAAAAAAAAAACAACAAACAACAAACAAAAAAAAAAAAACAAATTTCAAGCAATCACAATGTTTAAATCATGCAAGTTCTACCGGTATAAATAAGAAGAGCTTTGGGAAAGAGACTCTGAATCACTGTACAGAATGGTAGAAGGCGTGACGAGAAAAAAAAACAAACCAATGGGAGCATTTCTTAAAACTCAATGACATTGTTAACTCTTTGGCTGCCAGAGGGGCCAAGCGAGGCTTCATTGACCTCTCTGACAGCGGGGGGTGGAAATACTGTCTTGACAGCAGCTATTTTCTTGCTGAGTAAAAAGTGTACATGGTATTAAAACTTCAGTGTTCTGGGTTTTTTTCATTCTTTCTTATTTTATTTTTTTTTTGTTTTGTTTATGAAAATGCTGTTTTCAACATTGTACGCTGGACTATGCATGTTTTTTTTAATTGTATATAAAGTATTGCTTAAAAATTGATATAAATTACTGAAATTTTAAAAAAAA
  3   1   2       bld Tbd0      in                     NISC_nl04c10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTAAAAAAAAAACCCCCACCCCCCAACCAAAAAAAAAAAAACCAATTTCAAGCCATCCCAATGTTTTAATCATGCAAGTTTTTCCGGTATAAATAAGAAGAGCTTTGGGAAAGAGACTTTGAATCCCTGTTCAGAATGGTAGAAGGGGTGGCGGGAAAAAAAAACAAACCCATGGGGGCCTTTTTTAAAACTCAAAGACCTTGTTAACTTTTTGGCTGCCCGAGGGGCCAAACGAGGGTTCATTGACCTTTTTGACAGCGGGGGGGGGAAATACTGTTTTGACAGCAGCTATTTTTTTTGTGAGTAAAAAGGGTTCATGGTTTTAAAACTTCAGGGTTTTGGGGTTTTTTCATTCTTTTTTATTTTAATTTTTTTTTGGTTTGGTTAAGAAAAAGCTGTTTTCAACCTTGTACGCTGGGCTAAGCAAGTTTTTTTTAATTGGAAATAAAGGATTGCTTAAAAATTGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  5   1   2       add Tad5                                 XZT28169.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAAGTGTACATGGTATTAAAACTTCAGTGTTCTGGGTTTTTTTCATTCTTTCTTATTTTATTTTTTTTTTGTTTTGTTTATGAAAATGCTGTTTTCAACATTGTACGCTGGACTATGCATGTTTTTTTTAATTGTATATAAAGTATTGCTTAAAAATTGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGG
  5   1   2       add BrSp                            EC1CBA002ZF06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGCCGACATGTTTTTTTCATTCTTTCTTTTATTTTTTTTTGTTTTGTTTATGAAAATGCTGTTTTCAACATTGTACGCTGGACTATGCATGTTTTTTTAATTGTATATAAAGTATTGCTTAAAAATTGAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)