Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 436.0    0Xt7.1-TNeu106l13.3.5                      144 PI      75       1145     2039                frz7 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012072300 Xt7.1-CABC1437.3.5 - 144 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                  7     8     8     9    11    15    14    18    14    20    16    24    18    26    21    29    27    29    28    30    29    31    29    31    29    31    29    31    29    31    29    31    29    31    29    31    29    31    29    31    29    31    29    30    29    30    29    31    29    31    29    31    28    31    30    32    30    32    30    32    30    32    30    32    30    32    31    32    31    32    31    32    31    32    31    32    30    31    30    31    30    31    30    31    30    32    30    31    30    30    30    30    30    30    30    30    30    30    30    30    30    30    29    30    26    28    27    28    26    27    24    27    26    28    25    27    24    25    22    24    20    21    18    19    18    19    17    18    16    17    15    16    14    15    13    13    13    13    11    13     8     8     8     9     8     9     9    10     8    10     8    10     8    10     8    10     8    10     7     9     7     7     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     7     7     7     7     7     8     8     8     8     8     8     8     9     8     9     8     9     8     9     8     8     8     8     8     9    10    10    10    10    13    13    13    13    13    14    15    16    15    16    16    16    16    16    17    17    17    17    17    17    17    17    16    17    15    16    15    16    15    15    15    15    15    15    16    16    14    14    15    15    17    17    17    18    18    19    18    19    18    19    18    19    18    19    18    21    22    22    23    23    22    23    24    24    24    24    24    24    24    24    24    24    23    24    25    25    25    25    25    25    29    29    30    30    29    30    30    30    30    30    29    30    29    30    29    30    29    30    29    30    30    31    30    31    31    32    31    32    33    34    34    35    33    35    34    36    33    35    32    34    32    35    32    35    31    35    32    35    31    34    30    34    30    34    30    34    29    33    28    32    27    28    28    30    28    30    28    30    28    30    28    30    29    34    29    36    30    38    30    38    30    40    30    42    29    43    26    40    24    39    20    39    20    40    19    48    44    61    49    67    54    69    53    69    55    70    56    69    54    70    56    71    55    71    55    73    56    72    55    72    54    72    59    73    54    69    57    69    53    67    54    66    56    66    57    66    57    66    57    66    54    66    57    67    55    68    56    67    56    67    56    68    57    67    52    66    57    66    56    66    55    66    52    65    55    62    54    60    52    60    56    61    54    60    55    59    46    58    54    58    53    57    51    57    50    57    51    57    52    58    39    58    40    56    35    55    28    51    41    50     5    18
                                                                   VAR                                                                                             TCAGAACCACAGGGAAAGCGGCCGAGGCAGCCCGATCCGACACAACCC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                             ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------T---A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------G-G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-T-----
                                               BLH ATG     409    1996                                             
                                               BLH MIN     409     288                                             
                                               BLH MPR     370     288                                             
                                               BLH OVR     409     867                                             
                                               CDS MIN     409     288                                             
                                               EST CLI      11      10                                             
                                               ORF LNG     409     129                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Cs ---- 9e-109     BAB68350.1 Cs-frizzled3 [Ciona savignyi] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Ce ==== 1e-109     NP_492635.1 More Of MS MOM-5, Frizzled homolog (62.9 kD) (mom-5) [Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---- 3e-146     NP_524812.1 CG17697-PA [Drosophila melanogaster] ----------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ci ---- 6e-158     BAE06612.1 frizzled receptor [Ciona intestinalis] ---==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Sp ==== 4e-179     XP_781961.1 PREDICTED: similar to frizzled homolog 7b [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dr ---= 0          NP_571215.1 frizzled 2 [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Gg ---- 0          NP_989553.1 frizzled homolog 2 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 0          NP_001457.1 frizzled 2; Frizzled (Drosophila) human homolog of, 2; frizzled (Drosophila)homolog 2 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Mm ---- 0          NP_065256.1 frizzled homolog 2 (Drosophila); frizzled homolog 10 (Drosophila) [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 0          AAF06359.1 frizzled-2 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === ?? ==== 0          NP_001083829.1 frizzled-2 [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 0          AAH80489.1 Fzd2-prov protein [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABC1437.3.5                                                          TAA------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------TGA---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATGATG---------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------ATG------------------------------------------------------------------------------------------------------------------TGA------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------TGA---------------------------------------------------------------------TGA---------------------------------TAG------------------------------------------------------------------------------------------------------------TGA---------------------------------------------TGA---------------------------------------------------------------------TGA---------------TAG------------------------------ATG---TGA---------------TAG---------------------------------TGA------------------------------------TAA------------------------------------------------------------ATG---------------------------------ATG------------------------------ATGTGA------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   3        nb TpA       in                   TTpA070b07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACAGTTTGGCTTCAGTGGCCTGAAAGACTACGGTGTGAGAACTTTCCACGTCATGGAGCGGAGCAGATTTGTGTTGGACAGAACCACTCTGAAGATGGAGGTCCGACTCTGCTAACCACCAGTCCACCCCACCATGGTACGCCTGGGCCACCCATCTATGCCACACTGGACCATCCATTTCATTGTCCTCGAGTGCTGAAAGTCCCCTCTTACCTCAACTACAGGTTCTTGGGAGAGAAGGACTGCGCTGCTCCATGTGAGCCTTCCAAGAATGATGGTTTCATGTTTTTCAGTCAGGACGAGATCCGCTTTGCCCGCGTTTGGATTCTCATCTGGTCTGTGCTGTGTTGTGCATCCACCTTCTTCACCGTGACAACCTACTTGGTGGACATGCAGAGGTTTCGCTATCCCGAAAGGCCCATCATATTCCTGTCTGGTTGCTACACCATGGTGTCTGTGGCCTACATTGCTGGGTTTGTGCTGGGCGACAAAGTGGTCTGCAATGAAAATTTTTCAGAGGACGGCTACAAAACTGTTGTACAGGGGACTAAGAAGGAAGGTTGCACTATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGNGGGCATGAGGCCATAGAAGCCAACTCGCAGTACTTTCATCTGGCAGCATGGGCTGTACCTGCCGTGAAGACCATCACTATACTGGCAATGGGTC
  5   1   3        nb Ovi1      in                         CABI5015.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCAGATTTGTGTTGGACAGAACCACTCTGAAGATGGAGGTCCGACTCTGCTAACCACCAGTCCACCCCACCATGGTACGCCTGGGCCACCCATCTATGCCACACTGGACCATCCATTTCATTGTCCTCGAGTGCTGAAAGTCCCCTCTTACCTCAACTACAGGTTCTTGGGAGAGAAGGACTGCGCTGCTCCATGTGAGCCTTCCAAGAATGATGGTTTCATGTTTTTCAGTCAGGACGAGATCCGCTTTGCCCGCGTTTGGATTCTCATCTGGTCTGTGCTGTGTTGTGCATCCACCTTCTTCACCGTGACAACCTACTTGGTGGACATGCAGAGGTTTCGCTATCCCGAAAGGCCCATCATATTCCTGTCTGGTTGCTACACCATGGTGTCTGTGGCCTACATTGCTGGGTTTGTGCTGGGCGACAAAGTGGTCTGCAATGAAAATTTTTCAGAGGACGGCTACAAAACTGTTGTACAGGGGACTAAGAAGGAAGGTTGCACTATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATAAAGTGGGGGCATGAGGCCAT
  5   1   3        nb Tad5                                 XZT57080.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACCACTCTGAAGATGGAGGTCCGACTCTGCTAACCACCAGTCCACCCCACCATGGTACGCCTGGGCCACCCATCTATGCCACACTGGACCATCCATTTCATTGTCCTCGAGTGCTGAAAGTCCCCTCTTACCTCAACTACAGGTTCTTGGGAGAGAAGGACTGCGCTGCTCCATGTGAGCCTTCCAAGAATGATGGTTTCATGTTTTTCAGTCAGGACGAGATCCGCTTTGCCCGCGTTTGGATTCTCATCTGGTCTGTGCTGTGTTGTGCATCCACCTTCTTCACCGTGACAACCTACTTGGTGGACATGCAGAGGTTTCGCTATCCCGAAAGGCCCATCATATTCCTGTCTGGTTGCTACACCATGGTGTCTGTGGCCTACATTGCTGGGTTTGTGCTGGGCGACAAAGTGGTCTGCAATGAAAATTTTTCAGAGGACGGCTACAAAACTGTTGTACAGGGGACTAAGAAGGAAGGTTGCACTATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCATAGAAGCCAACTCGCAGTACTTTCATCTGGCAGCATGGGCTGTACCTGCCGTGAAGACCATCACTATACTGGCAATGGGTCAGATAGATGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGNAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCCTCTCAGGATCAGAACCATCATGAAGCAT
  5   1   2       ext Tad5      in                         XZT31463.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCATCNCACCTTCTTCACCGTGACAACCTACTTGGTGGACATGCAGAGGTTTCGCTATCCCGAAAGGCCCATCATATTCCTGTCTGGTTGCTACACCATGGTGTCTGTGGCCTACATTGCTGGGTTTGTGCTGGGCGACAAAGTGGTCTGCAATGAAAATTTTTCAGAGGACGGCTACAAAACTGTTGTACAGGGGACTAAGAAGGAAGGTTGCACTATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCATAGAAGCCAACTCGCAGTACTTTCATCTGGCAGCATGGGCTGTACCTGCCGTGAAGACCATCACTATACTGGCAATGGGTCAGATAGATGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGNGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATG
  5   1   2       ext Fat1      in                         CABC4270.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTACTTGGTGGACATGCAGAGGTTTCGCTATCCCGAAAGGCCCATCATATTCCTGTCTGGTTGCTACACCATGGTGTCTGTGGCCTACATTGCTGGGTTTGTGCTGGGCGACAAAGTGGTCTGCAATGAAAATTTTTCAGAGGACGGCTACAAAACTGTTGTACAGGGGACTAAGAAGGAAGGTTGCACTATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCATAGAAGCCAACTCGCAGTACTTTCATCTGGCAGCATGGGCTGTACCTGCCGTAAAGACCATCACTATACTGGCAATGGGTCAGATAGATGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTTATGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTACANCAGGCT
  5   1   3        nb HdA       in                  THdA017o09.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCATATTCCTGTCTGGTTGCTACACCATGAGTGTCTGTGGCCTACATTGCCTGGGTTTGTGCTGGGCGACAAAGTGGTCTGCAATGAAAATTTTTCAGAGGACGGCTACAAAACTGTTGTACAGGGGACTAAGAAGGAAGGTTGCACTATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCATATAAGCCAACTCGCAGTACTTTCATCTGGCAGCATGGGCTGTACCTGCCGTGAAGACCATCACTATACTGGCAATGGGTCAGATAGATGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCTAGACGGATAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACAGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTCCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTAGTCAGGCAAGACTCTACGCTCCT
  5   1   3        nb Tad5      in                         XZT30676.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGACGCGTGGGTGAAAATTTTTCAGAGGACGGCTACAAAACTGTTGTACAGGGGACTAAGAAGGAAGGTTGCACTATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCATAGAAGCCAACTCGCAGTACTTTCATCTGGCAGCATGGGCTGTACCTGCCGTAAAGACCATCACTATACTGGCAATGGGTCAGATAGATGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGCATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTNGAGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTA
  5   1   3        nb Tad5                                 XZT60221.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTCTGCAATGAAAATTTTTCAGAGGACGGCTACAAAACTGTTGTACAGGGGACTAAGAAGGAAGGTTGCACTATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCATAGAAGCCAACTCGCAGTACTTTCATCTGGCAGCATGGGCTGTACCTGCCGTGAAGACCATCACTATACTGGCAATGGGTCAGATAGATGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTT
  5   1   2       add HdA       in                  THdA010c05.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCGGGGTAAAAACTGTTGTACAGGGGACTAAGAAGGAAGGTTGCACTATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCATAGAAGCCAACTCGCAGTACTTTCATCTGGCAGCATGGGCTGTACCTGCCGTAAAGACCATCACTATACTGGCAATGGGTCAGATAGATGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGCATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAAGAGATGGATGGGGTAGAAGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATA
  5   1   3        nb Tad5      in                         XZT45129.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAACTGTTGTACAGGGGACTAAGAAGGAAGGTTGCACTATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCATAGAAGCCAATTCGCAGTACTTTCATCTGGCAGCATGGGCTGTACCTGCCGTGAAGACCATCACTATACTGGCAATGGGTCAGATAGATGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGNGAGACCACAGTGTGAGGAAAGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACAT
  5   1   3        nb Eye                                  CCAX1904.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAACTGTTGTACAGGGGACTAAGAAGGAAGGTTGCACTATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGCGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGGCATGAGGCCATAGAAGCCAACTCGCAGTACTTTTCATC
  5   1   2       add In62                            IMAGE:8955224.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGAAGTTTCGCACTATCCTCTTCATGATGCTTTATTTTTTTAGATGGCCAGCTCAATCTGGTGGGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCATAGAAGCCAACTCGCAGTACTTTCATCTGGCAGCATGGGCTGTACCTGCCGTGAAGACCATCACTATACTGGCAATGGGTCAGATAGATGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGATTGCAAAACCTGCCTTCCCTGCCCCTGCATATACCCAGCATGACCCAGATTTACTGAAATGATCAATATCTCTGACCTTATGTGCTCCGCAGGTCTGATTGTAGCAGATTCCTCTGAAATTTCCAGTACACACACTGGGAACAATGGAGAGAAGTGTAAGACGCTACTGATCCGCGATCATGATTATCTCATCCGACACTCTAGTCGGAGCTAACACCGATCTGTGAAACGAATTGCTAGATATCTAAGGGATAAAAATGGGACACCCCTATTACGTGAGCACCCCGTCTCTCCATGATCTGTAAAGATT
  5   1   3        nb Gas8      in                          st62b14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCATAGAAGCCAACTCGCAGTACTTTCATCTGGCAGCATGGGCTGTACCTGCCGTGAAGACCATCACTATACTGGCAATGGGTCAGATAGATGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCT
  5   1   3        nb Gas8      in                          st62a14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCATAGAAGCCAACTCGCAGTACTTTCATCTGGCAGCATGGGCTGTACCTGCCGTGAAGACCATCACTATACTGGCAATGGGTCAGATAGATGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAG
  5   1   3        nb TpA                            TTpA005i08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCATCTGGTGGGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCATAGAAGCCAACTCGCAGTACTTTCATCTGGCAGCATGGGCTGTACCTGCCGTAAAGACCATCACTATACTGGCAATGGGTCAGATAGATGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAA
  5   1   2       ext Tad5      in                         XZT36067.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCGTGAAGACCATCACTATACTGGCAATGGGTCAGATAGATGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATA
  5   1   3        nb Gas8      in                          st63b14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGGGTCAGATAGATGNAGACCTCCTGAGTGGGGTTTGCTTTGAGGGTCTAAATAACATTGACCCNCTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTNATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCNG
  5   1   2       ext Lun1      in                         CABD1561.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGATGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGNGCA
  5   1   3        nb Eye                                   CCAX641.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGCATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGC
  5   1   3        nb TbA       in                   TTbA023m15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCGGGGTTTCGCTTTCGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTCGTCTACCTCTTCATTGGAACCTCCTTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTCCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTNGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTTGTGAGGAAGNGAGATGGATTGTTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGNTAATTCCTACATGTATTTTATCTCTCTCCCAT
  5   1   3        nb Eye       in                         CCAX6408.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGCATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATAT
  5   1   3        nb Gas7      in                         XZG55073.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGACGCGTGGGTTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGCATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCCCCTTTC
  5   1   3        nb Gas7      in                         XZG15690.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCC
  5   1   3        nb TpA                            TTpA037l17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGGGGCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGCATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCC
  5   1   3        nb Neu       in                   TNeu063l11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCATCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCC
  5   1   3        nb Egg       in                   TEgg015o04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAG
  5   1   3        nb Egg                            TEgg091d20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAA
  5   1   2       ext HdA       in                  THdA010p19.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACCTCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTCCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAATGTTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTG
  5   1   2       ext Gas       in                   TGas119a01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATT
  5   1   3        nb Egg                            TEgg111p15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAACACTGGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCC
  5   1   3        nb Egg                            TEgg111p17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTATAGAGCACTGGGAGCGTATCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGACAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAACATGTTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAACAATGCCTTCTGTGTAAATG
  5   1   3        nb Egg                            TEgg111p18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCACTATTGTTATCGCATGCTACTTCTACGAGCATGCGTTTACAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGACAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACGCAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAACGACATGGATGGATATAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGATATCAGGTGAAAGGCCCTATAGAATACCATCATCAGGGACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAATTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAAT
  5   1   2       ext Tad5      in                         XZT66956.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGA
  5   1   3        nb TpA       out                  TTpA031p23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACT
  5   1   3        nb Tad5      in                         XZT44977.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTG
  5   1   3        nb Gas7      in                         XZG61826.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCCAAGAACTTGGGAGCCACTAAAGTTGC
  5   1   3        nb Tad5      in                         XZT63426.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTA
  5   1   3        nb Neu       in                   TNeu065p15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTGCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTC
  5   1   3        nb Gas       in                   TGas119l05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGGGCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGC
  5   1   3        nb HdA       in                   THdA053j06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCTGGTCGGCAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCANCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAACCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTG
  5   1   3        nb Tad5      in                         XZT67334.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTA
  5   1   3        nb Tad5      in                         XZT30786.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATT
  5   1   3        nb Tad5                                 XZT57457.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGACGCGTGGGTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACATTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTG
  5   1   3        nb Tad5      in                         XZT21416.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAACAACAAACATGGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATG
  3   1   2       ext Gas       in                    TGas119a01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAAGGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGGAAAATAATACATTTTACACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAACAATCAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas       in                   TGas077g12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTA
  3   1   4      seed Fat1 5g3  in                         CABC1437.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAACAAAAAA
  5   1   0       chi Gas7      in                         XZG45041.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGCAAATACTCATTCACCCCCCCCCCCCCCACTCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGNGTTTCTTTGTGTTTTTTTTT
  3   1   2       ext Fat1      in                         CABC4270.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAAGGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAACAATC
  3   1   3        nb Tad5      in                         XZT44977.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAAGGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAG
  3   1   3        nb Gas       in                    TGas119l05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAAATGAGAAACAATAGAAAAAAGTTNNNGGGGGCAAAAATNNAATTTACCCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTGAAATAAAAATATTTTTTGTAAAAAAAAAAAAAAAAAA
  3   1   3        nb TbA       in                    TTbA023m15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAAGGTAATTATATATTTCTATTTAAAATATGGGGCGGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATANTNCATTCACCCCCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTGGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTTTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTTTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGGGGGTTTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTTTAGGGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAGCGC
  3   1   2       ext Tad5      in                         XZT36067.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAAGGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAACCAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAAAAAAAAAAAAAAGG
  3   1   2       ext Lun1      in                         CABD1561.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAACAAAAAAAAA
  3   1   2       ext Tad5 5g3  in                         XZT55265.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAAGGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAG
  5   1   3        nb Gas       in                   TGas137i14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTGCCCCCCATAATGTAATTATATATTTCTATTTAAATATGGGCAGAAATTGAGAAACAATAGAAAATGTTTGCGGGGGCAATACTCATTCACCCCCCCCCCCCCCTTTCAAGTATTTTCTTTGATTCAGCAGTGCCTTTCTGTGTAAATGAAGTCCTATAGCCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTAACAAATTTCCTCTTGAACTTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCC
  3   1   2       ext Te4  5g3  in                         CAAN4678.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAAC
  3   1   3        nb Tad5      in                         XZT63426.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAG
  3   1   2       ext Fat1 5g3  in                         CABC7135.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTT
  3   1   3        nb Tad5      in                         XZT45129.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAAC
  3   1   2       add HdA       in                    THdA024m04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTCAGTACAGAGGGCCATGTTCCCCGCCCCCATTTACATTTTAGTTAGCAGGCCTGGACTGGGATTTAAAACCCCCCCCACTCTTTCAAGTATTTTCTGGATTCAGCAGTGCCTTCTGCGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTCGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTGGTGAGACTGGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTTTTTGCTCCCAGTTATCCACATTGTGAGAATCATACATGGACTTAGCCAGTCCTTCATTGCAGGGTGTTGCAATGCATGCTATGAGAACGAATACATGGTTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGTTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTAGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTATGCGTATTTTTTTCTGATGTGATCTTACTTATTATTATTATTTATGCCGCCTTTGAAATAAAAATTTTTTTTGTAAGAACAAAAAAAAAAAAAAAAAAGCGC
  3   1   3        nb Gas7 5g3  in                         XZG56214.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAAATTTGGGGCAGAAAATTGGGAACCAATAGAAAAATGTTTGGGGGGGCAAATATTCTTTCACCCCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTTGG
  3   1   2       add HdA       in                    THdA010c05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAACCCCCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCTTATAGCCTCCAGTCCTCGGCCGGTATTTGCCCTTTAATACTGCTCAGTTTGACGTTAACCCTGAAAAAAGTGTTATTGGTAGGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACACTCCCAAAAATTGGGGGGCCTCCCAATTTCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTTTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTTTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAACAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       ext Tad5      in                         XZT17593.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACCAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAG
  3   1   3        nb Tad5      in                         XZT21416.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGCAAATATTCATTCACCCCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAACAATCAG
  3   1   3        nb Tad5      in                         XZT30786.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAAC
  3   1   2       ext Tad5      in                         XZT31463.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAGGACC
  3   1   2       ext Tad5      in                         XZT66956.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGCAAATACTCATTCACCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGACCAAAAAAAAAAAAATT
  3   1   3        nb Gas7      in                         XZG15690.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCCCCCCCCCCCCCCCCCCCACTCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCCCATTGTGGGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGGCATTTTTTGAACCCTGAATTTAAGTATTAGAGGGGGGGTGCCTTTTTAACCCCTTTGTTTGCTGGGGATCAACTTTCCCTATCCCGGGGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCCCGGTTCCTCTTTGAATAATGATATGTTGACGGGTTTCTTTGTGTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGA
  3   1   2       add Tbd1 5g3  in                         CBXT6131.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACCCCCCCCCCCCCCCCACCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTTTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTCAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAAAAAAAAAAAAAAA
  3   1   2       add Gas7      in                         XZG45041.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCACCCCCCCCCCCCCCACTCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTTTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGG
  3   1   3        nb Gas8 5g3  in                          st24b12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCCCCCCCCCCCCCCACTCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTAAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTCTATGTGATCTTATTATTATTAT
  3   1   3        nb Gas8      in                          st62b14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCCCCCCCCCCCCACTCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTCTATGTGATCTTATTATTATTATATTTTGCCCCT
  3   1   3        nb Tad5      in                         XZT30676.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCCCCCNCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCCCATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTCCCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTGGAAATAAAAATATTTTTTGTTAGGACC
  3   1   3        nb Eye       in                         CCAX6408.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCCCCCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTTTTTGCTCCCAGTTATCCCCATTGGGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTTTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAAC
  3   1   3        nb Gas7      in                         XZG55073.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACCCCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas7      in                         XZG61826.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCCCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTT
  3   1   3        nb Tad5      in                         XZT67334.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGACC
  3   1   3        nb Gas8 5g3  in                          st71n11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTNTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTGCCCCTG
  3   1   2       ext HdA       in                    THdA010p19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCCCCCCCCCCTTTCAAGTATTTTTTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCGGTATTTGCCCTTTAATACTGCTCAGTTGGACGTTAACCCTGAAAAAAGTGTTATTGGTAGGAATTTCTTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGTTTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTTTTTGCTCCCAGTTATCCCCATTGGGGGAACATACAGGGACTTAGCCAGTCCTTCATTGCTGGGGGTTGCAATGCATGCTATGAGAATTAATACATGGCTGGGGACAGACTTACATATGCAATCTGGACATTTTTTGAACACTGAATTTAAGTATTAGGGGGGGGGTCCCTTTTTAACCCCTTTGTTTGGGGGGGATCAACTTTCCCTATCCCGGGGGGTTTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTTTTTGAATAATGATATGTTGACGGGTTTCTTTGGGTTTTTTTTTTCTAGGGGATCTTATTATTATTATTATTTTTGCCCCTTGGAAATAAAAATATTTTTTGTTAGGACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas8 5g3  in                          st36e14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTNTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTGCCCCTGA
  3   1   3        nb TpA       in                   TTpA070b07.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGGGTAAATAGAAGTCCTATAGCCTCCAGTCCTCGGCCAGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTAGAAGGTTTCATTTGGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATGGTGAGAACATACATGGACTTAGCCAGTCCTTCATTCCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTTTGAACACTGAATTTAAGTATTAGAGGGGAGGTGCCTTATTACCCCCTTTGTTTGCTGGACGATCAACTTTCCCTATCCCGGTGGGTGTTCGCTAAAGCCCGTCATGTGGCCGCTCCACGGTTCCTCTTTGAATAAAGATATGTTGCCGTGTTTCTTTGTGTTTTTTTTTCTAAGTGATCTTATTATGATTATTATTTTGGCCCC
  3   1   3        nb HdA  5g3  in                    THdA003l23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTTTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTAATTTTGCCCCTTGAAATAAAAATATTTTTTGTAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb HdA       in                    THdA053j06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCGGTATTTGCCCTTTAATACTGCTCAGTTGGACGTTAACCCTGAAAAAAGTGTTATTGGTAGGAATTTCTTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTTTTTGCTCCCAGTTATCCCCATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTTTGAACACTGAATTTAAGTATTAGAGGGGAGGTCCCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGGGGGTTTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGGGTTTCTTTGGGTTTTTTTTTTCTATGGGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAGGACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   3        nb Te4  5g3  in                         CAAN2526.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTGGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCCCTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCCCATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTTTTAGAGGGGGGGTCCCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGGGGGTTTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGGGTTTCTTTGTGTTTTTTTTTTCTAGGGGATCTTATTATTATTATTATTTTGGCCCCTTTGAAATAAAAATATTTTTTGTTAGGACC
  3   1   3        nb Gas8      in                          st62a14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCACTCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCNCTAAAGCCCGTCANGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATNTGTTGACGTGTTTCTTTGTGTTTTTTTTTCCTATGTGATCC
  3   1   3        nb HdA       in                   THdA017o09.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCCCTTTCAAGTATTTTTTTGATTCAGCAGCGCCTTTTGTGTAAATGAAGTCTTATAGCCTCCAGTCCTCGGCCGGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTAGGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACACCCAAAGAACTTGGGAGCCATTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTTTTTGCTCCCAGTTATCCCCATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGTTATGAGAATTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTTTGAACAGTGAATTTAAGTATTAGAGGGGAGGTCCCTTATTAACCCCTTTGTTTGGGGGAGATCAACTTTCCCTATCCCGGTGGGTTTTCGCTAAAGCCCGTCATGTTGCCGCTCCAGGGTTCCTCTTTGAAAAATGATACGTTGACGTGTTTCTTTGTGTTTTTTTTTTTAAGGTGATCTAATTATTATTATTATTTTTCCCCCTTTGAAAAAAAGGTATTTTTTGTTAAGACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   0       chi TbA                             TTbA034h14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTCTTAAAAGTATAATAAGGATTCACCAGTGCCTTCTGAGAAAAAGAAGTCCTATAGCTTCCAGTCCTGGGCCCCTATTTGCCCTTGAATAGGGCTCAGTTTGACGTTACCCCTGAAAAAAGTGTTTTTGGTAAGAATTTCCTCTTGAATTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGACCCACAAAAGTTGCTTGTGGGATTTGAAGGCATAACACAAAATTTTTGGGGGGGAAGGGGCCAGGGAATTTTTTTTGTTCCCGGTTTTCCCCATGGGGGGAACATACAGGGACTAAACCAGTCTTTCGTGGCTGTGTGTTGCAAAACAAAATATGAGAAAGAATTCATGGTTAGGGACAGACTTACATAGGCAATAAAAAACATTTTCGGAACACTGAATTTAAGTTTTAGAGGGGAGAACCCCCCTTAACCCCTAAAATTGTGGGAGATCAACCTCCCCTTTCCCGGTGGGTTTTGGTTAAAGGCGAATCATGTTGCCGTTCCGGGGGTCTTTTTTGAATAGGGGAAAAGCCACGAGATTCCCAGAAAAATTTTTCTATGTGATaaaaaaaaaaaaaaanaaaaaacccaaaaaaaaaaaaaaaattttttgttaagaacaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   3        nb Egg       in                    TEgg015o04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGACCTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATCCATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTCCCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGACCAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas       in                    TGas137i14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTTTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTGAAATAAAAATATTTTTGTTAGAAAAAA
  3   1   3        nb Neu       in                    TNeu063l11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCCTTTGAAATAAAAATATTTTTTGTTAAGAACAAAAAAAAAAAAAAAAAAA
  3   1   2       ext TbA  5g3  in                    TTbA055m19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCGGTATTTGCCCTTTAATACTGCTCAGTTGGACGTTAACCCTGAAAAAAGTGTTATTGGTAGGAATTTCTTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGGGCCACTAAAGTTGCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTTTTTGTTCCCAGTTATCCCCATTGGGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAAGGAATACATGGCTGGGGACAGACTTACATATGCAATTTGGACATTTTTTGAACACTGAATTTAAGTATTAGGGGGGGGGTCCCTTATTAACCCCTTTGTTTGGGGGAGATCAACTTTCCCTATCCCGGGGGGTTTTCGTTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTTTTTGAATAATGATATGTTGACGGGTTTCTTTGGGTTTTTTTTTTCTAGGGGATCTTATTATTATTATTATTTTTGCCCCTTGGAAATAAAAATATTTTTTGTTAGGACCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu       in                    TNeu065p15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGTATTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTAAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTGAAATAAAAATATTTTTTGTAAAAAAAAAAAAAAAAAA
  3   1   3        nb TpA       in                    TTpA019l13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAACAATCAAAAAAAAAAAAAAAAAA
  3   1   3        nb TpA  5g3  in                    TTpA061o04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTGAAATAAAAATATTTTTTGTAAGAACAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg  5g3  in                    TEgg062d20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTAGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAACAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas7                                 XZG17687.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGTAAAAGAAGTCCTATAGCCTCCAGTCCTCGGGCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGGACAAATTTCCTCTTGAACTTGAAGGTTTCTTTTAAAAGACAACCAAAGAACTTGGGAGCCCCTAAAGTTGCTTGTAAAACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGCCCATGGAATTTTCTTTGCCCCCAGTTATCCCCATTGGGAGAACATACATGGACTTAGCCAGTCCTTCATTGGTGTGTGTTGCAATGCATGCTATGAAAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTCCCTTATTAACCCCTTTGTTTGGTGGAGAACAACTTTCCCTATCCCGGGGGGTCTTCGCTAAAGCCCGTCATGTTGCCG
  3   1   3        nb Gas       in                    TGas077g12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAACAAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu  5g3  in                    TNeu059i07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGCCCTTTAATACTGCTACAGTTCGACGTTAACCNNTGAAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAAGAAACTTGGGAGCCACTAAAGTTGCTTGTAAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTTTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCATTCTGGACATTTTTTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGTTCAACTTTCCCTATCCCGGTGGGTTTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAA
  3   1   3        nb Gas8      in                          st63b14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTACCCCTGAAAAAAGTGTTATTGGTNGCGAATNTCCTNTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAANTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGNTCCCAGTTATCCACATTGTGAGAACATACATGGTCTTAGCCNGTCCTTCATTGCNGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGNNTTACATATNCAATCTGGACATTTTATGAACACTGAANTTAAGTATTAGAGGGGAGGTTCCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTNCTTATCCCGGTGGG
  3   1   3        nb Ovi1      in                         CABI5015.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAAC
  3   1   3        nb Neu  5g3  in                    TNeu120f12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAGGACCCAAAAAAAAAAAA
  3   1   4      seed TpA  5g3  in                    TTpA018a18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCATTCACCCCCCCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTGAAATAAAAATATTTTTTGTAAAAAAAAAAAAAAAAAAA
  3   1   3        nb TpA  5g3  in                    TTpA018b01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCCCCCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTAACCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTTGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACTAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTGAAATAAAAATATTTTTTTTAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg  5g3  in                    TEgg054f02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTAGCGCCTTTGAAATAAAAATATTTTTTGTTAAAAAAAAAAAAAAAAAAAAAA
  5   1   4      seed Lun1      in                         CABD4490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTCATCTGGTCTGTGCTGTGTTGTGCATCCACCTTCTTCACCGTGACAACCTACTTGGTGGACATGCAGAGGTTTCGCTATCCCGAAAGGCCCATCATATTCCTGTCTGGTTGCTACACCATGGTGTCTGTGGCCTACATTGCTGGGTTTGTGCTGGGCGACAAAGTGGTCTGCAATGAAAATTTTTCAGAGGACGGCTACAAAACTGTTGTACAGGGGACTAAGAAGGAAGGTTGCACTATCCTCTTCATGATGCTTTATTTTTTTAGTATGGCCAGCTCAATCTGGTGGGTCATTCTCTCCTTGACTTGGTTTCTGGCTGCTGGTATGAAGTGGGGGCATGAGGCCATAGAAGCCAACTCGCAGTACTTTCATCTGGCAGCATGGGCTGTACCTGCCGTGAAGACCATCACTATACTGGCAATGGGTCAGATAGATGGAGACCTCCTGAGTGGGGTTTGCTTTGTGGGTCTAAATAACATTGACCCACTCAGAGGTTTTGTGTTGGCCCCACTTTTTGTCTACCTCTTCATTGGAACCTCCTTTCTCTTAGCTGGCTTCGTATCCCTCTTCAGGATCAGAACCATCATGAAGCATGATGGCACCAAGACGGAGAAGTTGGAGAGGCTTATGGTGCGTATTGGGGTCTTCAGCGTCCTCTACACGGTTCCTGCCACTATTGTTATCGCATGCTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTC
  5   1   2       ext TbA       in                   TTbA004i24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTACTTCTACGAGCAGGCGTTTAGAGAGCACTGGGAGCGTAGCTGGGTCAGCCAGAATTGCAAAAGCCTGGCCATTCCCTGCCCCCTGCAGTATACCCCACGCATGACCCCAGATTTTACTGTATATATGATCAAATATCTCATGACCCTTATTGTTGGCATCACGTCAGGGTTCTGGATCTGGTCAGGCAAGACTCTACACTCCTGGAGAAAGTTTTACACAAGGCTCACCAACAACAAACATGGGGAGACCACAGTGTGAGGAAGGAGATGGATGGTTAGAGGACACCAGTCCTTTATCACTGGACTACCACTGACTGTAAATTCCTACATGTATTTTATCTCTCTCCCATATTCCCGGGATCCCAAGCAGTCTTTACAGTTATCGGGTGAAAGGCCCTATAGAATACCATCATCAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAATGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAAACAATAGAAANAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCCCCCCCCCCACTCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGT
  3   1   4      seed Lun1      in                         CABD4490.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGTACATCCCTTTGGATTTGTAATAAAACAAACTGTAAATAGTTTTTTGCCCCCATAAAGGTAATTATATATTTCTATTTAAAATATGGGGCAGAAAATTGAGAACCAATAGAAAAATGTTTGCGGGGGCAAATACTCATTCACCCCCCCNNCCCCCCCCCACTCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTCTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTGTTAAGAAC
  3   1   2       ext TbA       in                    TTbA004i24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTCTTTCAAGTATTTTCTTGATTCAGCAGTGCCTTCTGTGTAAATGAAGTCCTATAGCCTCCAGTCCTCGGCCTGTATTTGCCCTTTAATACTGCTCAGTTCGACGTTACCCCTGAAAAAAGTGTTATTGGTACGAATTTCCTCTTGAACTTGAAGGTTTCATTTAGAAGACAACCAAAGAACTTGGGAGCCACTAAAGTTGCTTGTGAGACTTGATGGCCTAACACAGACTTTTTTGGGGAGAAGGGTCCATGGAATTTTCTTTGCTCCCAGTTATCCACATTGTGAGAACATACATGGACTTAGCCAGTCCTTCATTGCTGTGTGTTGCAATGCATGCTATGAGAACGAATACATGGCTAGGGACAGACTTACATATGCAATCTGGACATTTTTTGAACACTGAATTTAAGTATTAGAGGGGAGGTACCTTATTAACCCCTTTGTTTGCTGGAGATCAACTTTCCCTATCCCGGTGGGTCTTCGCTAAAGCCCGTCATGTTGCCGCTCCACGGTTCCTCTTTGAATAATGATATGTTGACGTGTTTCTTTGTGTTTTTTTTTCTATGTGATCTTATTATTATTATTATTTTTGCCCCTTTGAAATAAAAATATTTTTTTTAAGAACAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (