Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012072336 Xt7.1-CAAQ1749.3 - 65 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAQ1749.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCCACAACAGGAATCTGCTCCTTAAGACGATGGTGAAGTCTAAGGAGCCTTGGAGCTGGGCTAACTGCCTGCAATCACCATGGCAACTGCCAGTCTGGAGGCTGAGCCTGCACCCTGACTTACACCCAGCAGGCACATGAGAAACACCGGGTCGTGGCGCCGTCAGGCCCATTCCTGTGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCCCGGCTATAGGAGCGGCGGAGGGGAGAGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTTACCCAGTCCTTTGTGCAGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGGCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCGGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAA
                                                  Xt7.1-CHK-1008224677                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAACAGGAATCTGCTCCTTAAGACGATGGTGAAGTCTAAGGAGCCTTGGAGCTGGGCTAACTGCCTGCAATCACCATGGCAACTGCCAGTCTGGAGGCTGAGCCTGCACCCTGACTTACACCCAGCAGGCACATGAGAAACACCGGGTCGTGGCGCCGTCAGGCCCATTCCTGTGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCCCGGCTATAGGAGCGGCGGAGGGGAGAGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTTACCCAGTCCTTTGTGCAGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGGCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCGGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAGAAACC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     4     7     8     9    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    11    12    11    12    11    12    11    12    11    12    11    12    12    12    12    13    12    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    12    13    12    14    13    14    13    14    13    14    14    15    15    16    15    16    15    16    15    16    15    15    16    16    16    16    17    17    16    16    16    16    16    16    16    16    18    18    18    18    18    18    19    19    19    19    19    19    19    19    19    19    19    20    20    22    20    22    21    22    21    22    21    22    19    21    20    22    18    21    19    21    17    20    16    20    16    20    15    20    14    19    15    19    15    17    15    17    15    17    17    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    18    18    18    18    18    20    20    20    20    20    21    21    22    21    22    22    23    30    30    33    33    38    38    38    38    42    42    42    42    41    42    44    45    42    45    43    46    43    46    43    45    43    45    43    44    42    44    42    43    42    42    42    42    42    42    41    41    40    41    40    42    39    42    40    42    39    40    38    40    42    42    42    42    41    41    40    40    39    39    39    39    38    39    39    39    38    39    39    39    39    39    39    39    38    38    38    38    38    38    36    36    36    36    36    36    36    36    35    35    35    35    34    34    34    34    33    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    33    33    33    33    33    33    32    33    33    33    31    32    31    31    30    30    28    30    29    30
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---C-------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -C----------
                                               BLH ATG     314     753                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     314      92                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     314    1282                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     314      58                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Cs ---- 1e-007     BAB70657.1 Delta [Ciona savignyi] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PROTEIN --- Bb ---- 2e-010     BAC06835.1 Bb-cadherin [Branchiostoma belcheri] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ci ---- 1e-011     BAE06523.1 jagged protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bf ---- 7e-013     CAC19873.1 putative notch receptor protein [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 8e-013     NP_502737.2 Y64G10A.7 [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 7e-022     NP_647898.3 CG7447-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 6e-034     XP_001199809.1 PREDICTED: similar to EGF-like-domain, multiple 7 [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dr ==== 3e-061     NP_001005231.1 EGF-like-domain, multiple 7 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Gg ==== 1e-064     XP_415421.2 PREDICTED: similar to Egfl7 protein [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 3e-069     NP_848538.2 vascular endothelial statin isoform 1 precursor [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Hs ---- 9e-072     NP_057299.1 EGF-like-domain, multiple 7 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Xl ==== 2e-140     AAH44267.1 Similar to NEU1 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === ?? ==== 2e-140     NP_001080143.1 EGF-like-domain, multiple 7 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 2e-167     AAI23102.1 EGF-like-domain, multiple 7 [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAQ1749.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG---------------------------------------------------------------------------------------------------------TGA------------------------------------------ATG------------------------TGA---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------ATG---------ATG---------------------------TAA------------------------------------------TAA---------------------------------------TAA------TAG------------------TGA------TAG------------------------------------------------------------------------ATG------------------TGA------------------------------------------------------------------------TAA------TAA---------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  0   1   1           Fat1 FL                           CABC527.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGGGCCCACAACAGGAATCTGCTCCTTAAGACGATGGTGAAGTCTAAGGAGCCTTGGAGCTGGGCTAACTGCCTGCAATCACCATGGCAACTGCCAGTCTGGAGGCTGAGCCTGCACCCTGACTTACACCCAGCAGGCACATGAGAAACACCGGGTCGTGGCGCCGTCAGGCCCATTCCTGTGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCCCGGCTATAGGAGCGGCGGAGGGGAGAGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTTACCCAGTCCTTTGTGCAGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGCCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCGGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAGAAAAAAAAAAAAAAAAAA
  5   1   2       chi In63                            IMAGE:8962086.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACATGGGGCTGTTGAAAATACTCTCAATATAAATGCGGCCCGGCAATTAGTGGCAATTCCCGAATAATGCTCCACGCACCATAAACGCGTCCCCGGGCCGCGCCGCCTGATGGATGGGTCCCCCCAGGCCCCCTTGGGACTTTGGCCTATATGTCAGCATTTACATTTCATACACACAGGAGTCAGACATGAAGGTCTGTCCCAGACTCCTCTGCTTGCAGTTTAAAGGGGAACTATACCCCATATCCCATATCCTCATGAGAATTACAGATCCAGCATGGCCGCCACCGCAGGGGATTCTGGGAGCTGTAAGCGTGCTGGCATGGCCTCCAGATGGGCAGATTCCAAAGCTCACACTTGGCCTCCTACAATTTGGAGTTTATGATCCATTTCAAGACCCCAAAAATAGAAAAATGCTATTTAACCGTTTGAATGAATAGCCTAAATCACATGCCCCCCCCCCCCCCGCTATGATGAAAATGACAGCAGTTTATTGTGTAGAGAGACCCCACGGGGCCCCGAATAAATATGAATTGAAACAAGTTCTCCCCTTTGCTTTGTGTTCCAGGGAATTCCATTGAAGCCCCGGCTATAGGAGCGGCGGAGGGGAGAGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTACCCAGTCTTGTGCAGCTGTGCTAGCCTATCGTCCGCTCTGCACGGCATAGGATCTGCAGCACCTACGACCACCTACAGATTCGTACGGCAAGTCTCCGGAAAACGT
  5   1   2       bld Gas8 5g3  in                         st114o21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGCAGCTCAGGGGCCCACAACAGGAATCTGCTCCTTAAGACGATGGTGAAGTCTAAGGAGCCTTGGAGCTGGGCTAACTGCCTGCAATCACCATGGCAACTGCCAGTCTGGAGGCTGAGCCTGCACCCTGACTTACACCCAGCAGGCACATGAGAAACACCGGGTCGTGGCGCCGTCAGGCCCATTCCTGTGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCCCGGCTATAGGAGCGGCGGAGGGGAGAGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTTACCCAGTCCTTTGTGCAGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGG
  5   1   2       bld Tad5                                  XZT4297.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCAGGGGCCCACAACAGGAATCTGCTCCTTAAGACGATGGTGAAGTCTAAGGAGCCTTGGAGCTGGGCTAACTGCCTGCAATCACCATGGCAACTGCCAGTCTGGAGGCTGAGCCTGCACCCTGACTTACACCCAGCAGGCACATGAGAAACACCGGGTCGTGGCGCCGTCAGGCCCATTCCTGTGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCCCGGCTATAGGAGCGGCGGAGGGGAGAGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTTACCCAGTCCTTTGTGCAGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGGCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCT
  5   1   2       bld Fat1 FL   in                          CABC527.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGGGCCCACAACAGGAATCTGCTCCTTAAGACGATGGTGAAGTCTAAGGAGCCTTGGAGCTGGGCTAACTGCCTGCAATCACCATGGCAACTGCCAGTCTGGAGGCTGAGCCTGCACCCTGACTTACACCCAGCAGGCACATGAGAAACACCGGGTCGTGGCGCCGTCAGGCCCATTCCTGTGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCCCGGCTATAGGAGCGGCGGAGGGGAGAGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTTACCCAGTCCTTTGTGCAGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGCCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTG
  5   1   2   10  bld Hrt1 5g3  in                         CAAQ8992.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGAATCTGCTCCTTAAGACGATGGTGAAGTCTAAGGAGCCTTGGAGCTGGGCTAACTGCCTGCAATCACCATGGCAACTGCCAGTCTGGAGGCTGAGCCTGCACCCTGACTTACACCCAGCAGGCACATGAGAAACACCGGGTCGTGGCGCCGTCAGGCCCATTCCTGTGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCCCGGCTATAGGAGCGGCGGAGGGGAGAGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTTACCCAGTCCTTTGTGCAGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGCCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCC
  5   1   2       bld Fat1      in                         CABC4307.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGGAATCTGCTCCTTAAGACGATGGTGAAGTCTAAGGAGCCTTGGAGCTGGGCTAACTGCCTGCAATCACCATGGCAACTGCCAGTCTGGAGGCTGAGCCTGCACCCTGACTTACACCCAGCAGGCACATGAGAAACACCGGGTCGTGCCGCCGTCCGGCCCATTCCTGTGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCCCGGCTATAGGAGCGGCGGAGGGGAGAGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTTACCCAGTCCTTTGTGCAGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGGCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCAGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCCAAAGCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAAACAAGCCCTTCCACATTCTGTCAGGG
  5   1   2   10  bld Fat1 5g3  in                         CABC4800.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGAATCTGCTCCTTAAGACGATGGTGAAGTCTAAGGAGCCTTGGAGCTGGGCTAACTGCCTGCAATCACCATGGCAACTGCCAGTCTGGAGGCTGAGCCTGCACCCTGACTTACACCCAGCAGGCACATGAGAAACACCGGGTCGTGCCGCCGTCCGGCCCATTCCTGTGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCCCGGCTATAGGAGCGGCGGAGGGGAGAGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTTACCCAGTCCTTTGTGCAGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGGCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCAGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTG
  5   1   2   10  bld Lun1 PIPE in                         CABD1663.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGAATCTGCTCCTTAAGACGATGGTGAAGTCTAAGGAGCCTTGGAGCTGGGCTAACTGCCTGCAATCACCATGGCAACTGCCAGTCTGGAGGCTGAGCCTGCACCCTGACTTACACCCAGCAGGCACATGAGAAACACCGGGTCGTGCCGCCGTCCGGCCCATTCCTGTGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCCCGGCTATAGGAGCGGCGGAGGGGAGAGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTTACCCAGTCCTTTGTGCAGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGGCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCAGCTAATGGC
  5   1   2       bld Lun1      in                        CABD13326.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATCTGCTCCTTAAGACGATGGTGAAGTCTAAGGAGCCTTGGAGCTGGGCTAACTGCCTGCAATCACCATGGCAACTGCCAGTCTGGAGGCTGAGCCTGCACCCTGACTTACACCCAGCAGGCACATGAGAAACACCGGGTCGTGGCGCCGTCAGGCCCATTCCTGTGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCCCGGCTATAGGAGCGGCGGAGGGGAGAGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTTACCCAGTCCTTTGTGCAGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGCCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCGGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCATCAGTACATGAA
  3  -1   2       bld Fat1      in                         CABC6385.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAGGGCGAGAGGCCGATGGTGAAGTCTAAGGAGCCTTGGAGCTGGGCTAACTGCCTGCAATCACCATGGCAACTGCCAGTCTGGAGGCTGAGCCTGCACCCTGACTTACACCCAGCAGGCACATGAGAAACACCGGGTCGTGGCGCCGTCAGGCCCATTCCTGTGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCCCGGCTATAGGAGCGGCGGAGGGGAGAGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTTACCCAGTCCTTTGTGCAGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGCCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGNGGGGTACCGGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAA
  5   1   2       bld Lun1      in                        CABD11241.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCCTTAAGACGATGGTGAAGTCTAAGGAGCCTTGGAGCTGGGCTAACTGCCTGCAATCACCATGGCAACTGCCAGTCTGGAGGCTGAGCCTGCACCCTGACTTACACCCAGCAGGCACATGAGAAACACCGGGTCGTGCCGCCGTCCGGCCCATTCCTGTGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCCCGGCTATAGGAGCGGCGGAGGGGAGAGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTTACCCAGTCCTTTGTGCAGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGGCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGNGGGGTACCAGCTAATGGCGGATGGGGAGAGCTGTGATCTTGTGCCAAAGCCGACAG
  5   1   2       bld Lun1      in                         CABD8886.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTACACCCAGCAGGCACATGAGAAACACCGGGTCGTGCCGCCGTCCGGCCCATTCCTGTGAAAATGAGCAAATGGAAAAGGGAATTCCATTGAAGCCCCGGCTATAGGAGCGGCGGAGGGGAGAGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTTACCCAGTCCTTTGTGCAGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGGCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCAGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGGCCTTCCACATTCTGTC
  5   1   2       bld In62 5g                         IMAGE:8953329.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCCCGAGATCAATAGGAGCCCCTCGCTTCGAATTCGTCCCGAACGCACGGAACTCATTTATTCACCATTGCACCGCGGGAGAGTCGCCGCCACCGGGGCTGCCAGACCATGTGGAAAGTCAGCTGCTTGGTAACGGGATACCTTCTCATCCTGGCAGTGGGCGGCGCCGCCGAGCATTTGTACCGGACAGGGCGCAGGATCTGCTCGGCAGCCGGGCACGCTGGCACCGTGTCTGTTACCCAGTCCTTTGTGCAGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGGCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCGGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAGGCCTTCCACATTCTGTCAGGAAGAATGGCAGAACTCCCGGAACAAAATAGAAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCAGAGTTTATCCACCAACCTCCCCGGACGCCTCCCGCCGATTCCATCGCCTTACTGGAAGCCACTCCCTCCAGCAGCTGGGATCGGAATGAATTCCCTCCACGAACAGATTTCCCTCTCCTGGCAGGAAAAGGCGGGG
  5   1   2       bld Lun1      in                         CABD4705.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCAATTCGGCCGAGGGTTACCCAGTCCTTTGTGCCGCCTGTGCATAGCCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGCCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCGGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCA
  5   1   2       bld Liv1      in                         CAAR7298.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCTATCGTCACGCTCTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGCCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCGGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCA
  5   1   2       bld Fat1      in                         CABC6012.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGCGACGGGCATAGGATCTGCAGCACCTACAGAACCACCTACAAGGTTTCGTACCGGCAAGTCTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGGCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCAGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCCTCTGCAANNCACCACACTGNCGGCACCCCAATG
  5   1   2       bld Liv1      in                         CAAR6406.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCCGGAAAACGTCCCTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGGCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCAGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCT
  5   1   2       bld Lun1                                CABD11093.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTCCCCTTTACTCTTGCTGCCCCGGTTGGCGGAAGATCGAGGCTCACACCCACAGCTGCGGCCAAGCCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGCCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCGGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGC
  5   1   2       bld Hrt1                                 CAAQ8823.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGGCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCAGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCC
  5   1   2       bld Hrt1      in                         CAAQ1749.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGGTGTCGACTGCCGTGCCGGAACGGAGGGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGCCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCGGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAGGGGTAATGTATACAGGCGCATTTTAATACACTAGGGGGCACTATTTTGGGCATGA
  5   1   2       bld Fat1                                 CABC6691.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGACGTGCGTCGCTTCTAATAAGTGTGAATGTTCTGCCGGATGGAGAGGGATTTATTGCCAGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGCCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCGGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGA
  5   1   2       bld Liv1      in                         CAAR1025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGACAGATGTGGACGAGTGCAGCGACGGCAGCCATCAATGTGGCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCAGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCC
  5   1   2       bld Abd0                               IMAGE:7016350                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGACGAGTGCAGCGACGGCAGCCATCAATGTGCCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCGGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAGGG
  5   1   2       bld Liv1      in                         CAAR5294.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATCGATTCAATTCGGCCGAGGCCCAACTGTGCGTCAACTCTGCCGGAAGCTACCATTGCGGCTGCCTGGGGGGGTACCGGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAA
  5   1   2       bld Liv1      in                        CAAR10301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCATTGCGGCTGCCTGGGGGGGTACCAGCTAATGGCGGATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCACATTCTGTCAGGGAAGGAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGNGGGAAACGCCTAGCGACCATGTTTA
  5   1   2       chi Tad5      in                         XZT30136.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGGCAGCAGAGAGAGAGCCCCCTCCTCTTGGGGATGGGAGACAGCCTGAGTGTGAGGATCTGGAGGATGGGGAAGACTTGTTTACCAGTACTGTATCTACGCTGGAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGGTGTCTCTCCCC
  5   1   2       chi HeRe      in                     EC2CAA21BF05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGGGGTACCGGCTAATGGCGAATGGGAAGAGCTGTGATCTTGTGCCAAAGCCGACAGTGCCCCCTGCCTCTCCCCCATCAGTACATGAACAAGGCCTTCCTCATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCGCCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCATTCCCTCCAGCAGCTGGATCGTATAGATTCGCTCAGCGAGCAGATCTCCTTTCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTGATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCGGCGCCCGGGGGTTACACTGCCACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGGTA
  3  -1   2       bld Lun1      in                        CABD12798.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGGGTGCCGCAGGGAACATCATGTCTCACTGTTGTGTCCTCTACTCTAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGNCACA
  5   1   2       bld Fat1      in                         CABC7023.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTGTCCTCTACTCTAGGCCTTCCACATTCTGTCAGGGAAGAAATGGCAGAACTCCGGAACAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACA
  5   1   2       bld Sto1      in                         CABG7302.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAAATAGAAGTTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCG
  5   1   2       bld Lun1      in                        CABD10558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTAGAGCAGAAGCTTCACTTGCTGCTGACTCCGTTCCAGAGTTTAACCACCACCTCCCCGGACGCTCGCGCCGATCCCATCGCTTTACTGACGCACTCCCTCCAGCAGCTGGATCGGATAGATTCGCTCAGCGAACAGATCTCCTTCCTGGAAGAAAGGCTGGAGACATGTTCATGCAAGACTGAGCTGTAATTGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATCTAATGTACAG
  5   1   2       bld Liv1      in                         CAAR2452.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGCAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTTGAATTCACATAAAATAACGTGAAGAAAAAAAAAAAAAAAAA
  5   1   2       bld Liv1      in                         CAAR7574.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCCCGTCTCCCCCCCCCATGGACCCCCACTGATGTACTGCGCTTGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCCTGATGGCTACATTTTGTACTGTTTTATCTTATCGGGATCACA
  5  -1   2       bld Fat1      in                         CABC6385.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGATGTACTGCGCTGGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTATAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAGAAACCCTCG
  3   1   2       bld Liv1      in                         CAAR1025.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATGTACTGCGCTGGGGAGATATAAGGAATGCGGGGGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAGAAACAAAGCCTCTCGCCCTATAG
  5   1   2       bld Liv1      in                        CAAR12639.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTCGTGCCGCTTCTCTCTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACATAAAATAACGTGAAG
  5  -1   2       bld Lun1      in                        CABD12798.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAGAA
  3   1   2      seed Hrt1      in                         CAAQ1749.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAGAAACC
  3   1   2       bld Liv1      in                        CAAR10301.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAG
  3   1   2       bld Liv1      in                         CAAR2452.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAGCATCCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAG
  3   1   2       bld Liv1      ?                          CAAR3470.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAGAAACC
  3   1   2       bld Liv1      in                         CAAR7298.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAG
  3   1   2       bld Lun1      in                        CABD10558.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAG
  3   1   2       bld Lun1      in                         CABD8886.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAGAAAAAA
  3   1   2       bld Sto1      in                         CABG7302.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAGCATTCCCAGGACGGACTCCATAATCNCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAGAAAAACCTCTCGCCCTATA
  3   1   2       bld Liv1      in                         CAAR5294.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAG
  3   1   2       bld Fat1      in                         CABC6012.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAG
  3   1   2       bld Fat1      in                         CABC7023.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCATTCCCAGGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATACTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAG
  3   1   2       bld Fat1 FL   in                          CABC527.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAG
  3   1   2       bld Fat1      ?                          CABC8322.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAGAAACC
  3   1   2       bld Lun1      in                        CABD13326.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAGAAACC
  3   1   2       bld Liv1      in                         CAAR7574.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAG
  3   1   2       bld Lun1      in                        CABD11241.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACGGACTCCATAATCCCACGGCTGCGCTGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAG
  3   1   2       bld Fat1      in                         CABC4307.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAG
  3   1   2       bld Liv1      in                        CAAR12639.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAGAAACC
  3   1   2       bld Lun1 PIPE in                         CABD1663.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAGAAACC
  3   1   2       bld Lun1      in                         CABD4705.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTGTGTCATACAGTGTGACAGGTACCCTCCCCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTAAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAG
  3   1   2       bld HeRe      in                     EC2CAA21BF05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGGTATAAGAAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTTGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCACCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTT
  3   1   2       bld Liv1      in                         CAAR6406.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCAGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAGAAACCAAAAAAAAAAACCTCTCGCCCTATAGG
  3   1   2       bld Hrt1 5g3  in                         CAAQ8992.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCAGCGAGGCTGACACTTCTCCCTCTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACACTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAG
  3   1   2       bld Fat1 5g3  in                         CABC4800.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCCTTTTGCCAACCACCCACATTGCGGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATTTATGCCCCTTATTATTATCATATAAGTCAGGTTTAATGGGTGATCCAAACAAGGGTTAATGTATCCAGGCGCATTTAATTCCATTAGGGGGCATTATTTTGGGCATGATTAATTTAGGAAATAGCAGGTAGAATAGGCATTATTTTCCTATATATCCATAACAATCCCGGGGGGTGTTTTTCCCCAGAAATGACTTTTTACAGTCGCCATTGAAACATTGGCGGGGTTCAGCCCCCAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTCCATTTTACCAAATAAGCTTTTTAAATTCTGTTGGTGCACCAGGGGGTGCAGAGTTGTTGCGCCCCCCTGTCCCGATTTAATGTCCAGTGTAAAGCACTGGGGTTGCCGTAGGGCGCCGCGTCATTGGCTGTTGTGAATGTTGGGACATTGGGCAGGACGGTTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACCC
  3   1   2       bld Tad5      in                         XZT30136.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTTTTGCCAACCACCCACACTGCCGGCACCCAAATGCCCCCCGATATGGGTACAGAGACTGAACATGGCGGATATTAAGAGTCAATCTATGCCCCTTATTATTATCATATAAGTCATGTTTAATTGGTGATCCAAACAAGGGTTAATGTATACAGGCGCATTTAATTACATTAGGGGGCACTATTTTGGGCATGATTAATATAGGAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGTTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATTTAATGTACAGTGTAAAGCACTGGGGCTGCCGTAGGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTGGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATGGGCTACATTTTGTACTGTTTTATCTTATGGGATTCACAAGTGGGTGTTTATATGTTGGAATTCCCAATAAAATAACGTGAGGAACCC
  3   1   2       bld Gas8 5g3  in                         st114o21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATACAGGCGCATTTTAATTACATTAGGGGGCACTATNTTGGGCATGANTAATATAGGAAATAGTTTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCG
  3   1   2       bld Fat1      in                         CABC1172.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAG
  5   1   2       bld Fat1      in                         CABC1172.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAATAGCTGGTAGAATAGGCATTATTATCCTATATATCCATAACAATCCCGGGGGGTGTCTCTCCCCAGAAATGACTCTCTACAGTCGCCATTGAAACATTGGCGGGGCTCAGCCCACAAGCAGCAGGGGGGAAACGCCTAGCGACCATTGTTTACATTTTACCAAATAAGCTTCTTAAACTCTGTTGGTGCAACAGGGGGTGCAGAGTTGTTGAGCCCCCCTGTCCCGATCTAATGTACAGTGTAAAGCACTGGGGCTGCCGTACGGCGCCGCGTCATTGGCTGTTGTGAATGCTGGGACATTCGGCACGACGGCTACTGGTTGCTGTCCCATAGGATCCAATGGAAGCACTAGATTGCTATGGGTATATGTATATAGCACACAGCCAGTCTGTATATGGTACCAGCAGCCTCCTGATTGGCTACATTTTGTACTGTTTTATCTTATCGGATTCACAAGTGTGTGTTTATATGTTTGAATTCACAATAAAATAACGTGAAGAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)