Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 817.0    0Xt7.1-TNeu090e19.3                        286 PI      78        181     1398                Hypothetical protein MGC76124 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012072380 Xt7.1-TNeu114j16.3.5 - 126 ESTs
                                                                       ...-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TNeu114j16.3.5                                                                CTCCGAGACACGGGGGAGGCGGGAAACAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222661                                                                      GACACGGGGGAGGCGGGAAACAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTxxTTxTAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                     3     4     6     8    10    12    12    13    12    14    14    17    19    21    23    23    25    25    30    31    31    33    31    33    29    35    34    36    33    36    35    36    36    37    36    38    36    38    37    38    38    39    38    38    38    38    38    38    38    38    38    38    37    38    38    38    38    38    38    38    38    38    38    38    38    38    40    40    40    40    40    40    40    40    39    39    39    39    39    39    40    40    40    40    41    41    41    41    40    41    40    41    40    41    39    41    40    41    38    40    37    38    38    39    38    38    35    35    31    32    29    30    29    30    29    30    29    30    28    29    28    29    26    28    26    28    25    28    25    28    24    26    24    25    23    24    23    24    23    23    22    23    21    23    21    23    22    24    22    24    21    24    21    23    20    24    19    23    18    23    18    23    16    21    16    21    15    19    15    18    14    20    13    17    13    17    13    18    12    16    11    16    11    16    12    18    12    19    17    20    16    20    16    20    17    20    17    21    19    22    20    24    19    23    18    22    18    22    18    22    18    23    19    23    19    24    19    25    19    26    19    26    19    26    17    26    16    23    16    23    15    23    20    32    19    31    19    31    19    34    18    33    18    33    20    33    20    33    24    40    25    45    24    46    25    48    25    48    28    50    28    50    27    54    27    54    28    54    47    55    39    56    43    58    42    55    41    54    42    55    43    55    44    55    42    54    45    55    46    56    44    55    44    55    44    56    45    56    45    56    45    56    47    57    47    57    47    59    44    59    46    59    46    59    45    58    43    57    43    56    49    56    46    57    45    55    47    55    47    55    47    53    46    52    45    52    46    52    46    52    45    52    45    53    46    52    46    52    46    51    46    51    48    53    48    52    48    52    47    51    46    50    45    50    45    51    44    49    42    49    43    49    41    47    39    47    36    45    25    44    16    27     6     9
  5   1   2  SIG                                    Xt7.1-TNeu114j16.3                                                    GAAGGTGTGCGGCTCCGAGACACGGGGGAGGCGGGAAACAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TNeu072d11.3                                                                                                     GAATTCGTCGACAGGCCAATCTGGCCGCCCCGGGGAATCCCCGGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTTCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTATCCTGACTGCCCAGTGGCTCCCATATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATGTGAGTAGAAGATCATACTTTTATTTCCCTCCCTTACTGAGATCCCCTTATCTTATTATTTTTTTATTT------------------------------------------------------------------------------------------------------------------------------------GTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATTCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTGTTTGTAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGCAGGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAAT
                                                                   SNP                                                                                                                                                                                                    --------G---
                                                                   SNP                                                                                                                                                                                                                -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                    ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -------T--G-
                                               BLH ATG     160    2695                                                                
                                               BLH MIN     160     326                                                                
                                               BLH MPR     148     326                                                                
                                               BLH OVR     160    1253                                                                
                                               CDS MIN     160     326                                                                
                                               ORF LNG     160     102                                                                
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Br ---- 2e-010     AAM88902.1 guanine nucleotide-binding protein [Branchiostoma lanceolatum] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Br ---- 1e-010     AAX54700.1 receptor of activated protein kinase C 1 [Branchiostoma belcheri tsingtaunese] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Bf ---- 6e-011     AAM18868.1 unknown [Branchiostoma floridae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 2e-012     BAE06349.1 Cockayne syndrome 1 homolog [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PROTEIN --- Sc ---- 2e-076     NP_010858.1 subunit of histone acetyltransferase; may regulate activity of Hat1p, thecatalytic subunit of histone acetyltransferase; Hat2p [Saccharomyces cerevisiae] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ==== 0          NP_492552.1 Synthetic multivulva protein LIN-53, retinoblastoma LIN-35 binding protein (47.2kD) (lin-53) [Caenorhabditis elegans] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PREDICTED = Sp ==== 0          XP_780271.1 PREDICTED: similar to retinoblastoma binding protein 4 isoform 1 [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 0          NP_524354.1 CG4236-PA [Drosophila melanogaster] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PREDICTED = Dr ==== 0          XP_684740.1 PREDICTED: similar to Retinoblastoma binding protein 4 isoform 1 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN === Gg ==== 0          NP_990183.1 chromatin assembly factor 1 p48 subunit [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 0          NP_033056.2 retinoblastoma binding protein 4 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 0          NP_005601.1 retinoblastoma binding protein 4; retinoblastoma-binding protein p48;retinoblastoma-binding protein 4; RbAp48; chromatin assembly factor/CAF-1 p48subunit; MSI1 protein homolog [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 0          AAH72311.1 MGC82618 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PREDICTED = ?? ==== 0          NP_001085185.1 hypothetical protein LOC432269 [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PREDICTED = Xt ==== 0          AAH88588.1 Hypothetical LOC496866 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu114j16.3.5                                                                                                                                                              TAA---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------TGA------------------------------------TGA------------------------------------------------------------------------------TGA------------------------------------------------------------------------TGA------------------------TGA------------------TGA---------------------TGA------------------TAA------------------------------------------TAA---------------------------TAA---TAGATG---------------------------------TGATGA---------------------TAA------------------ATG------------------TGA---------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   2  SIG                                    Xt7.1-TNeu114j16.3                                                    GAAGGTGTGCGGCTCCGAGACACGGGGGAGGCGGGAAACAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008276276                                                          GTGCGGCTCCGAGACACGGGGGAGGCGGGAAACAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTxxTTxTAAAAAAAAAAAAAAAAAA
  0   1   1           Neu  FL                     TNeu052i12.FL-Sanger                                                                                                                                                             CTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGGCTCTGCTCCTGAATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGGAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGATGCTCAATTTGATGCATCCCACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAGGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAAAACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGTTAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1           Neu0 FL                     IMAGE:6991409.FL-MGC                                                                                                                                                                           CTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAA
  5   1   0       chi Gas                            TGas009m03.p1kSP6 CTGGGTTGAACAGTAAGCCTTGTATTTGAGATTCTTGCCTAACTGTTCGGCATTAGTTGTGTAACTTGAAGTAAGGGTATATACCAAAGGGTTTTATCCTTAACTAATACAGGCAAGTACGATTCCATAGCTCTAGTATGCACAGAACAATTGTTTTTCATTGTTATTCCTAACACTGAGAGCTCTCATGCTAATTTCTTCAGTTTCTACTGTTTATAAATATATGTGATGCAGTATCACCAGCTGTCTATGGCGGTTGTTTCTGCTTTGTCAGACAATAAAACAAGTCCTTACTGTAAACAAGCAGAGAAAATGTGGTGCACCCATATTAGTCTAAGGGAAAGTGAAAATACTGATGTCCTATCAATAGCTTTTATCTTCTATTAAAGCTACTGCACTTTACAAAAAAATAATACTCATTGTTTTTATGAAAAATTGCATTTTTATTAGGCATCTGCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACT
  5   1   2       ext Egg  5g                        TEgg117l12.p1kSP6                                                    GAAGGTGTGCGGCTCCGAGACACGGGGGAGGCGGGAAACAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTC
  5   1   3        nb Gas  5g                        TGas056d06.p1cSP6                                                    GAAGGTGTGCGGCTCCGAGACACGGGGGAGGCGGGAAACAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGT
  5   1   3        nb Egg  5g                        TEgg109o11.p1kSP6                                                     CGAAGTGTGCGGCTCCTATACCGGGGGAGGCGGGAAACAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAAGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAAATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTAT
  5   1   4   12 seed Gas7 5g3  in                         XZG54676.5p .........................................................GTGCGGCTCCGAGACACGGGGGAGGCGGGAAACAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTGGGGATATCAGTGCTGT
  5   1   3        nb Egg  5g3  in                   TEgg003d18.p1kSP6                                                                 TCCGAGACACGGGGGAGGCGGGAAACAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCTATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAA
  5   1   3   10   nb Thy1 5g3  in                        CBST5217.fwd ................................................................GCCGAGACACGGGGGAGGCGGGAAACAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGGCTCTGCTCCTGAATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGGAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGATGCTCAATTTGATGCATCCCACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCTGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCCCAGAATCCATGCCTTATTGCTACAAAAACTCCTTCCAGT
  5   1   3        nb Egg  5g3  in                   TEgg060f22.p1kSP6                                                                     CGAGAACGGGGGAGGCGGGAAACATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATCGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAAC
  5   1   2       ext TbA  5g3  in                   TTbA065n10.p1kSP6                                                                      ACCGGGTGGAGGCGGGAAACAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGTGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGNTTGAGGATGTGTCTGGGCATTTATTGCATGAATCTCTNCTTTGGATCAGTTGCAGATGATCAGAAACTGATGAT
  5   1   3        nb Egg  5g                        TEgg129k17.p1kSP6                                                                             GGGAGGCGGGAAACAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTG
  5   1   3   12   nb Gas7 5g3  in                         XZG26170.5p ............................................................................GGGAGGCGGGAAACAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACC
  5   1   3        nb Tad5                                 XZT12442.5p                                                                                GAGGCGGGAAAAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATANCATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAG
  5   1   3        nb Egg  5g                        TEgg136a22.p1kSP6                                                                                    CGGGAAAAATAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATATAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCGTCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCA
  5   1   3        nb Gas8 5g3  in                          st32l16.5p                                                                                             TAGCGGGAGGAACAGGCCCGGGCACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTTCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGG
  5   1   2       ext Neu  5g3  in                   TNeu114j16.p1cSP6                                                                                                                   CACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAA
  5   1   3        nb Neu  5g3  in                   TNeu114j18.p1cSP6                                                                                                                   CACTGAGGGGAGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAA
  5   1   3        nb Fat1 5g3  in                         CABC1976.5p                                                                                                                          TTCAATTCGGCACGAGGAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTTCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTC
  5   1   3        nb Ovi1      in                         CABI1576.5p                                                                                                                             AGGAGTCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTTCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGTTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATG
  5   1   3        nb Egg  5x3  out                  TEgg050k11.p1kSP6                                                                                                                                  TCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATG
  5   1   2       ext Gas  5g3  in                  TGas096c18.p1kaSP6                                                                                                                                     AGGGGAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTTCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTC
  5   1   3   12   nb Tad5 5g3  in                         XZT14720.5p ...........................................................................................................................................ACCGGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGAT
  5   1   3        nb Gas  5g3  in                   TGas057k22.p1cSP6                                                                                                                                                 GGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAAT
  5   1   3        nb Neu  FL   in                   TNeu052i12.p1cSP6                                                                                                                                                             CTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGGCTCTGCTCCTGAATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGGAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGATGCTCAATTTGATGCATCCCACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGAC
  5   1   3        nb TpA  5g                        TTpA076n03.p1kSP6                                                                                                                                                             CTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGANACTGATGATCTGGGACACCCCGATCAACACACATC
  5   1   3        nb Neu  5g                        TNeu003n14.p1kSP6                                                                                                                                                                      GACTCTAANAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGNGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAAT
  5   1   3        nb TbA  5g3  in                   TTbA033k17.p1kSP6                                                                                                                                                                      GGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGC
  5   1   3        nb TbA  5g3  in                   TTbA025h07.p1kSP6                                                                                                                                                                         CTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGANACTGATGATCTGGGACACCCGATCAAACACACATCAAAGCCCAGCACTCTGTGGATGCTCACACAGCTGAAAGTCACTGTCTGTCATTTACCCTTACAGCGAGTT
  5   1   2   10  ext Fat1 5g3  in                         CABC8269.5p ........................................................................................................................................................................CTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAACAACACATCANAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGGCACTGGGTCAGCT
  5   1   3        nb 1030 5g                         IMAGE:7092246.5p                                                                                                                                                                          GCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGGCTCTGCTCCTGAATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGGAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGATGCTCAATTTGATGCATCCCACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCACCTTCTTAGTGCTTCAGATGACATACAATATGCCTTTGGGAATCAGTGCTGTACTA
  5   1   2       add Neu0 FL   in                       IMAGE:6991409                                                                                                                                                                           CTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCCATGGTTTGAAGATGTGTCTTGGCCTTTATTGCATGAATCTCTCCTTTGGATTAGTTGCAGATGATTCGAAACTGATGATTCTGGGGACCCCCGATCAAACAACACATCAAAGCCCCAACCCCTCTGTGGGATGCTCCCCCCGCCTGAAATCCACTGGC
  5   1   3        nb Egg  5x                        TEgg130k17.p1kSP6                                                                                                                                                                             CTAAGAGCAAGTTGAGTCTCGCACCGGTAAAGTCTCCGCTCTGGATTTACTATGGCTGATAAAGAGGCTGCCTTTGATGATGCGGCGGAGGACCGAGTCCTCCAACCAACAGTATAAGATATGGAAAAAGAACACCCCTTTCC
  5   1   3   22   nb Gas7 5g                              XZG47318.5p ...............................................................................................................................................................................CGGACGCGTGGGCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCT
  5   1   2       ext Egg  5g3  in                   TEgg075h12.p1kSP6                                                                                                                                                                                                        AATTCGCCGGGGCTGGATTTACTATGCGCTGATAGAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAATATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGC
  5   1   3        nb HdA  5g3  in                   THdA021b08.p1kSP6                                                                                                                                                                                                             CTCTGCTCCTGGATTTACTATGGCTGATAATGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCGAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTTCACTGTCTGT
  5   1   3   10   nb Ova1 5g3  in                        CABE12271.5p ........................................................................................................................................................................................................................ATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATTTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGNNCACT
  5   1   3        nb Gas7                                 XZG12890.5p                                                                                                                                                                                                                                                      TTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGGAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGATGCTCAATTTGATGCATCCCACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCANAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCA
  5   1   3        nb Ova1      in                         CABE4643.5p                                                                                                                                                                                                                                                                       GAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACCCAATCTGA
  5   1   2       add TpA       in                   TTpA042m23.p1kSP6                                                                                                                                                                                                                                                                                                        GAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGGACACCGATNCAACACACATCANAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTA
  5   1   3        nb Tad5      in                         XZT65928.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTACTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGA
  5   1   2       add Gas1                               IMAGE:6990256                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATGGATTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGTCCAGTGTCCCCACATATGAGACATCCTGCATCAGTGAACTGACGTAACTAATGTTGGGATTAGTAAATGAAAAACATCTCTGAAAGCGAAAGTCCCCGACTCGTTTTCTGGGGTCCACCAAATCAATCCCGGACAAAGACGGGGATTTGTT
  5   1   3        nb Egg                            TEgg094l22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACA
  5   1   3        nb Eye       in                         CCAX7814.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTTTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATAATCATGCAGG
  5   1   3        nb TpA       in                   TTpA052e20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGNGTGATCTGTTCTGTATCTGAGGATATATCATGC
  5   1   3        nb Gas                            TGas019c07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGATTACACCAAACACCCATCAAAACCANATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTG
  5   1   3        nb Te5       in                         CAAO8857.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACT
  5   1   3        nb HdA       in                   THdA007l02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATACAATATGCCTTTGGGATATCAGTGCTGTACCTAAGGAGGGCAAAGTGGTGGATGCAAAGACCATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTACACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAAGATAATATCATGCANGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGG
  3   1   3        nb Ova1      in                         CABE4643.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCAAAGAACATTTTCACAGGGCACACTGCAGTGGTTGAGGATGTGTCTTGGCATTTATTGCATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATG
  5   1   3        nb TpA       in                   TTpA061l01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGAATCTCTCTTTGGATCAGTTGCAGATGATCAGAAACTGATGATCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATNGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTT
  5   1   3        nb Thy1                               CBST10137.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTGCAGATGATCAGAAACTGATGATCTGGGACACCCNGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAGGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAACAGGA
  5   1   3        nb Egg       in                   TEgg025j01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTGGGACACCCGATCAAACAACACATCAAAGCCCAGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTA
  5   1   3        nb Neu       in                   TNeu095o16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGGGCAAAGATGAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTATAAGCAAGGAGGGGTGGAGAGCTCATCTTCTGACA
  5   1   3        nb Tad5      in                         XZT59414.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGACGCGTGGGCGGACGCGTGGGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTNTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAG
  5   1   3        nb Tad5                                 XZT57596.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAATTTTCCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCCAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTC
  5   1   3        nb Tad5                                 XZT41687.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGNGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCTGATATTTAGATGCAGCCAACTGAATCAAAACTTTGTTTTCATATGAGGTC
  5   1   3        nb TpA       in                   TTpA074n08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGTCCCCACATAATGAGACCATCCTGGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGNGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAGC
  5   1   3        nb Tbd1                                CBXT18244.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGGACGCGTGGGAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAAATTCTCATTTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAAGAACTATTCAGGACCAACACTGTTGCGGTTTAAACATTCCTCCCAATCCTATATCCAAG
  3   1   3        nb Gas       in                    TGas142p15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCAGAAAAAAAAAAAAAAAAAAAAA
  3   1   2       add Neu0 FL   in                       IMAGE:6991409                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGTTTTCCCTGAAGAATGCCGGAAAGATTGTTCCCCCCCTGAAAATTTCGGTTTTATTCCAGGGTGGTCCACACCAGCCAAAGGTATTCAGGAGTTTTTCCAGGGAATTCTTAATGGAACCAAGGGGGAATCTGGTCCGGTATCCGGAGGATAAATTCATGCAGGTTTGGCAAAAGTGGGGGGGAACCTTTTCCAATGAGGAGGATTCAGAGGGGGGTGTTGATCCAGAGGGTCAAAGTTCCAGACAATTGGTATACTGTCCCGTTTCTTGCATAAAACAGACATTGTGTTTTCTGCATCCAGCACTTGGACCTTGGCCATTCAATGCCGCACAGAGCTGGTTCGGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATAAGGGTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATTGTTTGACACAGTCTGGATATCCCCAGTGCCTTTCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGGTGCCCTGTACCAAACGGTGATTTTCAGAAGTTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTAGTAAC
  5   1   3        nb Gas       in                   TGas142p15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATG
  5   1   2       add Gas       in                  TGas091p20.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGTACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTTACTAGCCTTTTATTGTTTGAATTGGGCTGCC
  5   1   3        nb Egg       in                   TEgg055p24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGA
  3   1   2       add Gas7      in                         XZG42563.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCCTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGCATCTAAATATCAGGAAAAAAAAAAAAAAAGG
  5   1   2       add Gas7      in                         XZG42563.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCCTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGCATCTAAATATCANGAAAAAAAAAAAAAAAGG
  5   1   3        nb Gas       in                   TGas143h16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATTCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTG
  3  -1   3        nb Ovi1      out                        CABI4755.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGG
  3   1   2       ext Fat1 5g3  in                         CABC8269.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAA
  5   1   3        nb Gas7      in                         XZG37368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGTATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGG
  3   1   3        nb Egg                             TEgg059d03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTCTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCCTCCCCATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTGTTTGTAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas       in                    TGas143h16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTAAAAAAAAAAAAAAAAAA
  3   1   2       ext Neu  5g3  in                    TNeu114j16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTGNCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTGTAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas8      in                          st64k20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTC
  3   1   2       add Gas       in                    TGas091p20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGTACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGGACCTCACATGTAATAAAAATGTTTGTTTGAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas  5g3  in                    TGas096c18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTGTTTGTTAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu  5g3  in                    TNeu114j18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTGTTTGTAAAAAAAAAAAAAAAA
  3   1   3        nb Neu       in                    TNeu095o16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGAATAAAAATGTTTGTTTGTAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg  5g3  in                    TEgg060f22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTGCAAAAACAGACATTGTGTTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTGTTAAAAAAAAAAAAAAAA
  3   1   3        nb TbA  5g3  in                    TTbA033k17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGGTCCTCGTTTTCCCCAGCCTTCTCTAATCTAGCTTTTATTGGTTTTGAGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTTGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGAACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATGGAATATAAAGAAGTATTCAGGACCAACACTGTTGCGTTTAAACAGTCCTCCCAATCCTATATCCACGCCCCTCCTAAGGCCCGACAATTAGCACTTCTTGTCAGTATTTGAACTAGCCTTTTATCCTTTGAATTGGGGCTGCCCTGAACCAAACGGTGATCTTCAGAAGTGTCCTTTTATTTTCCTGATACTGAGAGGCAGCCAAGGGAATCAAAACATTTGTTTTCATACGAGGTCAAAGAATTTCCCATTAAGCAAAACTATAGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATACGCAACTTTTGTTCCGTGTACAGGGTAACATTAGATGGAGGAGTCAATAGCGGATTGCACCCTGAAACTTCGACGAATCCCTATTTTGGGTATGTTATAAATATATCCTCTCCTATCTACGAGTGTTGATACTTGCGCGGAGCATTTTTATAGGGGAGAAAAAAGGCGTGCCCCCTTGTAAGGGCCTCAGCTCGTCAATTCGCACAGCGCCTCCCAGTAATAAAAATGTTTGTTTGTAAAAAAAAAAAAAAAAAAAGCG
  3   1   3        nb Eye       in                         CCAX7814.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTGCATCCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCC
  3   1   3        nb TpA       in                    TTpA061l01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTGTTTGTAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Te5       in                         CAAO8857.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTG
  3   1   3        nb Gas7 5g3  in                         XZG26170.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCATCCAGCACTTGGACATTGGCCATTCATGCCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGTTAAAAAAAAAAAAAAAAGG
  3   1   3        nb Egg       in                    TEgg055p24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTGTTTGTTAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb HdA  5g3  in                    THdA021b08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATCCAGCACTTGGACATTGGCCATTCATTTCCGCACAGAGGTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTATAAAAATGTTTGTTTGTTAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Ova1 5g3  in                        CABE12271.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTG
  3   1   3        nb Tad5      in                         XZT65928.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGTT
  3   1   2       ext TbA  5g3  in                    TTbA065n10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTTTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGGTGCCCTGTACCAAACGGTGATTTTCAGAAGTTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTCGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTGTTTGTAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       add TpA       in                    TTpA042m23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTTTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATTTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGGCGTGCCCCCTTGTAAGGGCTCAAGATTGTCAATTCGCACCAGCACCTCACCATGTAATAAAAAATGTTTGTTTTGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   4      seed Gas7 5g3  in                         XZG54676.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGTTTAAAAAAAAAAAAAAAGG
  3   1   3        nb Fat1 5g3  in                         CABC1976.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTT
  3   1   3        nb Ovi1      in                         CABI1576.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGTT
  3   1   3        nb Tad5 5g3  in                         XZT14720.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGTT
  3   1   3        nb HdA       in                   THdA007l02.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATAAGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATTGTTTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGGGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTTTTTTAACTAGCCTTTTATTGTTTGAATTGGGGGTGCCCTGTACCAAACGGTGATTTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTTTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGAAAGAAAAATTTTGTTTGTTAAAAAAAAAAAAAAAAA
  3   1   3        nb TpA       in                    TTpA052e20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATTTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTTTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGGTGCCCTGTACCAAACGGTGATTTTCAGAAGTTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTTAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas                            TGas085c02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAAATGGAG
  3   1   3        nb Neu  FL   in                    TNeu052i12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAAGAGAGCTCATCGTTTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAAAACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGGTGCCCTGTACCAAACGGTGATTTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCACGTTGTAAGGGCTCAGATTGTCAATTCGCACAGCCCCTAGAAGGTAATAAAAATGTTTGTTTGTAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas  5g3  in                    TGas057k22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCACAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTCCTGATATTTAGATGCAGTCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAAGTGTTTGTTTTGTTAATAAAATTAAAAAAAAAAAA
  3   1   3        nb Egg  5g3  in                    TEgg003d18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTGTTTTGTTAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg  5g3  in                    TEgg075h12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATTTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGTTTTTTGGTCTTTTTCCTTTGATATTAAAAAAAAAAAAAAAGAAAAAAAAA
  3   1   3        nb TbA  5g3  in                    TTbA025h07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTGTTTGTAAAAAAAAAAAAAAAAAGCG
  3   1   3        nb Egg       in                    TEgg025j01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGTTAAAAAAAAAAAAAAAAAA
  5   1   3        nb Neu                            TNeu026h09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTGGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGTT
  3   1   3        nb Tad5      in                         XZT59414.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGTTT
  3   1   3        nb Gas7      in                         XZG37368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTCCCCAGTCCCTTCCCCTGCTTTTGATATAAAGAATTTTTCGGGCCCAACCCTGTTGGGTTTAAACATTCCTCCCAATCTTATTTCCAAGCCCTTCTTAAGGACTGACAATTACCATTTTTTGTCATTTTTTTAACTACCCTTTTTTTTTTTAAATGGGGGCTCCCCTGTCCCAAACGGTGTTTTTCAAAAGTTTTTTTTTTTTCCTGATATTTAGAGGCACCCAACGGAATCAAACCTTTTGTTTTCATAGGGGGTCAAAGATTTTCCCTTTAAGCAAAAATTTTGGGTTTTTTAGGCCCAATTTCCCTCAAATGTTAATAGGCAACTTTTTTTTTGTGTCCGGCC
  3   1   3        nb Thy1 5g3  in                        CBST5217.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCCCCAGTGCCTTCCACGGCATTTGATATAAAGAACTGTTCAGGACCAAAACTGTTGCGTTTAAACATTCCTCCCAATCCAATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTG
  3   1   3        nb TpA       in                   TTpA074n08.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGACCAACACTGTTGCGTTTAAACATTCCTTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCACACATGTAATAAAAATGTTGTTTTTTTAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu                             TNeu059k02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas8      in                          st64k20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCCCTTCCTAAGGNCTGNCAANTAGCNTTTCTTGTCNTTNTTTTAACTAGCCNTTTATTGTTTGAANTGGGGGTGCCCNGTNCCNAACGGNGNTTTTCNGAAGNTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGAT
  3   1   3        nb Gas8 5g3  in                          st32l16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGCNNTTNTTGNCNTTTTTTTAANTAGCCNTTTNTTGNTTGAANTGGGGGTGCCCCGNNCCCAACGGGGNTTTTNNGNAGNTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGAT
  3   1   3        nb Gas0                                 dad43h07.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGTTAAAAAAA
  3  -1   3        nb Egg       in                    TEgg011k04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAAATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGT
  5  -1   3        nb Egg       in                   TEgg011k04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGT
  5  -1   3        nb TbA                            TTbA057l24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGTTAAAAAAAAAAAAAAAAAAAAAAGCGGC
  5   1   3        nb Gas                            TGas117o03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAAT
  3   1   3        nb Egg       in                    TEgg063f08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTGTTTGAAAAAAAAAAAA
  5   1   3        nb Egg       in                   TEgg063f08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTG
  5   1   3        nb Gas                            TGas046n20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGTGCTTGACATTTTTATAGGGGAGAAAGAGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGTT
  5   1   2  SIG                                    Xt7.1-TNeu072d11.3                                                                                                     GAATTCGTCGACAGGCCAATCTGGCCGCCCCGGGGAATCCCCGGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTTCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTATCCTGACTGCCCAGTGGCTCCCATATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATGTGAGTAGAAGATCATACTTTTATTTCCCTCCCTTACTGAGATCCCCTTATCTTATTATTTTTTTATTT------------------------------------------------------------------------------------------------------------------------------------GTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATTCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTGTTTGTAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008276272                                                                                                           GTCGACAGGCCAATCTGGCCGCCCCGGGGAATCCCCGGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTTCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTATCCTGACTGCCCAGTGGCTCCCATATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATGTGAGTAGAAGATCATACTTTTATTTCCCTCCCTTACTGAGATCCCCTTATCTTATTATTTTTTTATTTTATTTT------------------------------------------------------------------------------------------------------------------------CACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATxxxTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATTCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTGTTTGTAAAAAAAAAA
  5   1   4      seed Neu  5g3  in                   TNeu072d11.p1cSP6                                                                                                     GAATTCGTCGACAGGCCAATCTGGCCGCCCCGGGGAATCCCCGGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTTCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTATCCTGACTGCCCAGTGGCTCCCATATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGT
  5   1   2       ext TbA  5g3  in                   TTbA031d14.p1kSP6                                                                                                                                  TCAGGGGAAAAACCGGGGAAACGTGAGCTAAGTTGAGGACTCTAAGAGCAAGTTGAGTCTCGCAAGCGGTAAAGTCTCTGCTCCTGGATTTACTATGGCTGATAAAGAGGCTGCGTTTGATGATGCGGTGGAGGAACGAGTTATAAACGAAGAGTATAAGATATGGAAAAAGAACACCCCTTTCCTGTATGATCTGGTGATGACCCATGCCTTGGAATGGCCTAGCCTGACTGCCCAGTGGCTCCCAGATGTCACAAGACCCGATGGAAAAGATTTCAGTATCCACAGACTCGTCCTTGGGACACACACTTCTGATGAACAGAATCATCTGGTGATTGCTAGTGTGCAGCTTCCTAATGATGACGCTCAATTTGATGCATCACACTATGACAGTGAAAAAGGAGAGTTTGGAGGATTTGGCTCTGTCAGTGGGAAAATAGAAATTGAGATCAAAATAAATCATGAGGGAGAAGTAAACAGAGCTCGTTACATGCCACAGAATCCATGCATTATTGCTACAAAAACTCCATCCAGTGACGTTCTTGTGTTTGATTACACCAAACACCCATCAAAACCAGATCCTTCTGGTGAGTGTAATCCAGATCTCCGACTTAGAGGCCACCAAAAAGAGGGCTATGGCCTATCCTGGAATCCTAATCTAAGTGGCAACCTTCTTAGTGCTTCAGATGACCATGTGAGTAGAAGATCATACTTTTATTTCCCTCCCTTACTGAGATCCCCTTATCTTATTATTTTTTTATTTTATTTTTTTT
  5   1   2       ext Ova1      in                         CABE7529.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCCACTCTGTGGATGCTCACACAGCTGAAGTCAACTGTCTGTCATTTAACCCTTACAGCGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAAACATGGGTGATCTGGTCTGTATCTGAGGATAATATCATGCA
  5   1   2       ext Egg       in                   TEgg026b20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACACAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCCTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTG
  5   1   2       ext Egg                            TEgg103h21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAGTTCATATTGGCAACTGGGTCAGCTGACAAGACTGTTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTAT
  5   1   3        nb Gas                            TGas025c23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGCATTATGGGACCTACGCAATCTGAAATTAAAGTTGCATTCATTTGAATCTCACAAAGATGAAATTTTCCAGCAGGTCCAGTGGTCCCCACATAATGAGACCATCCTGGCATCCAGTGGAACTGACCGTAGACTAAATGTTTGGGATTTAAGTAAAATTGGAGAAGAGCAGTCTCCTGAAGATGCAGAAGATGGTCCCCCTGAACTTCTGTTTATCCATGGTGGTCACACAGCCAAGATATCAGACTTCTCATGGAATCCTAATGAACCATGGGTGATCTGTTCTGTATCTGAGGATAATATCATGCAGGTCTGGCAAATGGCGGAGAACATTTACAATGATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGGTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGA
  3   1   4      seed Neu  5g3  in                    TNeu072d11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATGAAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAAGTTCCTAGACATTGCTATACTGTCCTGTTTCTTGCAAAAACAGACATTGTGTCTTCTGCATCCAGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTGTTTGTTAAAAAAAAAAAAAAAA
  3   1   2       ext Egg       in                    TEgg026b20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCACTTGGACATTGGCCATTCATTGCCGCACAGAGCTGCTTCTGGCTCCTCGTTTTCCCCAGCCTTCTCTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATTCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGTTAAAAAAAAAAAAAAAAAA
  3   1   2       ext Ova1      in                         CABE7529.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTAATCTCGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATAGGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATCTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGCTGCCCTGTACCAAACGGTGATCTTCAGAAGTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTTGTTTTGTT
  3   1   2       ext TbA  5g3  in                    TTbA031d14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCTTTTACTGGTTTTGTGAGGAATCCCCTTTTATTTTATATATATATATATGGTTATTTTATATAAAATTCTCATTTTAACCATGTATCTGCTGCCAAGGAGTTTTTAGAAGCAAGGAGGGGTAGAGAGCTCATCGTCTGACACAGTCTGGATATCCCCAGTGCCTTCCACTGCATTTGATATAAAGAACTATTCAGGACCAACACTGTTGCGTTTAAACATTCCTCCCAATCCTATATCCAAGCCCTTCCTAAGGACTGACAATTAGCATTTCTTGTCATTCTTTTAACTAGCCTTTTATTGTTTGAATTGGGGGTGCCCTGTACCAAACGGTGATTTTCAGAAGTTTTTTTTTTTTTCCTGATATTTAGATGCAGCCAACTGAATCAAAACATTTGTTTTCATATGAGGTCAAAGAATTTCCCATTAAGCAAAAATATTGAGTGTTTTAAGGCCAATTTCACTCAAATGTTAATATGCAACTTCTGTTTTGTGTACAGACTAACATTAGATGGAGGAGTCAATAGCGGACTGCACCCTGAAACTTTGATGAATCCCTATTTTGACTATATTATAAATATATCCTCTCCTATCTATGTGTCTTGATACTTGTGCTTGACATTTTTATAGGGGAGAAAGAGGCGTGCCCCTTGTAAGGGCTCAGATTGTCAATTCGCACAGCACCTCACATGTAATAAAAATGTTGTTTGTAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)