Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 62%

 1012072381 Xt7.1-TNeu132l07.3 - 124 ESTs
                                                                       .....-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TNeu132l07.3                                                                                                                                                                                AGGGGAGAGTGCGGAGTCGGGAGTTGGGGGCTCAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGACCCCCAGCTGCACCCCCCGCCGCCTCCTACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGT
                                                  Xt7.1-CHK-1008222696                                                                                                                                                                                      GAGTGCGGAGTCGGGAGTTGGGGGCTCAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGACCCCCAGCTGCACCCCCCGCCGCCTCCTACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGC
                                                      consensus depths                                                                                                                                                                                     4     7     7    11     8    11     9    12    13    17    19    30    25    37    35    41    39    42    45    47    45    47    47    47    48    50    48    50    49    50    50    51    51    52    51    52    51    53    52    55    51    55    53    56    51    56    52    57    53    59    51    61    51    61    52    60    47    60    37    48    36    48    34    48    32    45    15    26    16    26    13    25    21    27    16    29    25    38    31    44    35    47    37    47    40    54    41    55    44    57    41    57    44    58    45    58    46    58    51    59    54    62    57    63    56    64    58    65    59    67    60    67    56    66    58    67    60    67    62    68    62    67    63    68    61    68    59    69    65    71    64    71    64    71    62    71    64    71    64    71    59    71    60    71    62    70    62    70    59    69    61    69    58    69    60    68    47    69    37    67    36    67    39    67    37    67    38    67    34    66    36    66    33    64    35    64    32    63    28    61    26    60    25    60
                                                                   VAR                                                                                                                                                                                                        GTCGGGAGTTGGGGGCTCAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --------T---
                                               BLH MIN      26      51                                                                                                                                                                                
                                               BLH OVR      53      91                                                                                                                                                                                
                                               EST CLI      46      33                                                                                                                                                                                
                                               ORF LNG      53       2                                                                                                                                                                                
                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 2e-025     CAD58839.1 SoxB2 protein [Ciona intestinalis] ==========================================================================================================================================================================================================
                                                                       PROTEIN --- Gg ---- 2e-025     NP_989640.1 SRY (sex determining region Y)-box 18 [Gallus gallus] --------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN --- Bb ---- 4e-027     AAW65484.1 HMG box transcription factor AmphiSox1/2/3-like [Branchiostoma belcheri] =======================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                              PROTEIN --- Dr ---- 7e-026     NP_571777.1 SRY-box containing gene 31 [Danio rerio] ===============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                             PROTEIN --- Xt ---- 7e-026     NP_001007502.1 sox3-prov protein [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Ce ---- 1e-026     NP_741836.1 SOX (mammalian SRY box) related (32.2 kD) (sox-2) [Caenorhabditis elegans] -----------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Sp ---- 5e-027     NP_999639.1 transcription factor SoxB1 [Strongylocentrotus purpuratus] ---------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PROTEIN --- Mm ---= 1e-027     NP_033261.1 SRY-box 15 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                               PROTEIN --- Dm ---- 6e-028     NP_648694.1 CG7345-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN --- Bf ---- 3e-030     AAF81765.1 HMG box transcription factor AmphiSox1/2/3 [Branchiostoma floridae] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                PROTEIN --- Hs ---- 1e-030     NP_008873.1 SRY (sex determining region Y)-box 15; SRY (sex-determining region Y)-box 15;SRY (sex determining region Y)-box 20 [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xl ---- 3e-079     BAA32249.1 SOX-D [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                       PROTEIN --- ?? ---- 3e-079     NP_001081201.1 Sox-D protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu132l07.3                                                                                                                                                                                                                                     ATG------------------------------------------------------------------------ATG---------ATG---------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------TGA---------------------------------------------------------------------------------TGA------------------------------------------------------ATG---TGA------------------------------------ATG------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------TAA
                                                                   ORF                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   1   22    - Gas7 5g                              XZG37121.5p .............................................................................................................................................ATTGGCCCTGGGGCAGTGGGAGGGGGAAGGAGAGAGGGGAGAGTGCGGAGTCGGGAGTTGGGGGCTCAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCC
  5   1   1   12    - Gas7 5g3  in                         XZG32074.5p .......................................................................................................................................................GGGCAGTGGGAGGGGGAAGGAGAGAGGGGAGAGTGCGGAGTCGGGAGTTGGGGGCTCAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGATACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCC
  3  -1   1         - Gas6      in                         ANBT3386.3p                                                                                                                                                          CCAAAGGGCTCGAGCCCTTTAGTGGGGAGAGTGCGGAGTCGGGAGTTGGGGGCTCAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCC
  5   1   1         - Neu5      in                         ANHP2895.5p                                                                                                                                                                      CAGAGGGGGGGAAGGAGAGAGGGGAGAGTGCGGAGTCGGGAGTTGGGGGCTCAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCC
  5   1   1         - Gas6      in                         ANBT1536.5p                                                                                                                                                                              CGGAAGGAGAGAGGGTAGAGTGCGGAGTCGGGAGTTGGGGGCTCAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCC
  5   1   1   12    - Gas7 PIPE in                         XZG45017.5p ..............................................................................................................................................................................GAGGGGAGAGTGCGGAGTCGGGAGTTGGGGGCTCAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCC
  5   1   1         - Gas7      in                         XZG29452.5p                                                                                                                                                                                GAAGGAGAGAGGGGAGAGTGCGGAGTCGGGAGTTGGGGGCTCAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGCGGCCCCTCAGCCCCCCCTGCCCTGCC
  5   1   1   22    - Gas7 5g                              XZG52931.5p .......................................................................................................................................................................................GTGCGGAGTCGGGAGTTGGGGGCTCAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGATACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCC
  5   1   1         - Gas  5g                        TGas023c07.p1kSP6                                                                                                                                                                                          GCGGAGTCGGGAGTTGGGGGCTCAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCTGGAGGAG
  5   1   1         - Egg  5g3  in                   TEgg076j24.p1kSP6                                                                                                                                                                                           ACGGATCGGGTGTTGGGGGCTCCTAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGGCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCGAGTATGCACCACTCGGAGATCAGCCGCCGCCTGGGGGAGAATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACGAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCCAAGCGGCCCCTCATGCCTTGCTGACCTG
  5   1   1   12    - Gas7 5g3  in                         XZG52192.5p ...........................................................................................................................................................................................GGAGTCGGGAGTTGGGGGCTCAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGATACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGGCCCTCAGGCCCC
  5   1   1         - Neu  5g3  in                   TNeu054c22.p1cSP6                                                                                                                                                                                                                CAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGA
  5   1   1   12    - Gas7 5g3  in                         XZG21638.5p .....................................................................................................................................................................................................................GAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGNCCCC
  5   1   1         - TbA  5x3                       TTbA038j23.p1kSP6                                                                                                                                                                                                                        AGAATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGACCCCCAGCTGCACCCCCCGCCGCCTCCTACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTT
  5   1   1         - Gas  5g3  in                   TGas101n24.p1cSP6                                                                                                                                                                                                                              CCGGGGCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTGGCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCATCCGCCGCCTGGGGGAGATATGGCGGGGCGGGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCATCATGCTATAAACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCATGGAGAGGGGG
  5   1   1         - Gas7      in                         XZG40386.5p                                                                                                                                                                                                                              CGGACGCGTGGGCGGACGCGTGGGCTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGATACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCC
  5   1   1   12    - Gas7 5g3  in                         XZG46824.5p .............................................................................................................................................................................................................................CCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCGAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCACCAC
  5   1   1         - Gas  5g3  in                   TGas140c21.p1kSP6                                                                                                                                                                                                                                 CGGCCATGCACCCTCCCCAGCACTCCGCCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGA
  5   1   1   14    - Gas6 5g3  in                          ANBT548.5p ..................................................................................................................................................................................................................................CCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCC
  5   1   1         - Gas  5g                        TGas046f03.p1kSP6                                                                                                                                                                                                                                    CCATGCACCCTCCCCAGCACTCCGCCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCC
  5   1   1         - Egg  5g3  in                   TEgg018f24.p1kSP6                                                                                                                                                                                                                                     CACCCTCCGCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCTCGCATCGAGAGCCCCCTGGTCAAGCGGGCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGG
  5   1   1         - Neu       in                   TNeu132l07.p1cSP6                                                                                                                                                                                                                                      GCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTGCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGGGCCTGGGGAGGGAGCAGAGCGGAGACCCCTTCCGGGAGGAGGCGCAAGCGGCGTCCGGGCGTCAGCATGCTATAGACTACCCGGGCTAC
  5   1   1         - Neu                            TNeu142h01.p1cSP6                                                                                                                                                                                                                                      GCACGCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCACGGAGAGGGGGGA
  5   1   1         - Gas       in                   TGas067e22.p1cSP6                                                                                                                                                                                                                                       GCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGA
  5   1   1         - Gas       in                   TGas067j06.p1cSP6                                                                                                                                                                                                                                       GCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGA
  5   1   1       chi Neu       in                   TNeu076h08.p1cSP6                                                                                                                                                                                                                                       CCGGCCATGCACTCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCATCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCGGATTGCTCTGTGTCTCGCAGCCTGAAGATGAGAGGACAGGCTTTTGTTATATTTAAAGAAATAAGCAGTGCCACAAATGCTCTGAGGTCAATGCAAGGGTTTCCCTTTTATGATAAACCAATGAGAATACAATATTCAAAATCCGATTCTGACATCATTGCCAAAATGAAAGGTACCTATGTGGAAAGAGAC
  5   1   1         - Egg                            TEgg135f13.p1kSP6                                                                                                                                                                                                                                        CACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAGGGAGA
  5   1   1         - Neu       in                   TNeu055o12.p1cSP6                                                                                                                                                                                                                                        CACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGA
  5   1   1         - Gas                            TGas014f06.p1kSP6                                                                                                                                                                                                                                         CACCCTCCCCACACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCC
  5   1   1         - Neu                            TNeu001n06.p1kSP6                                                                                                                                                                                                                                         CACCCTCCCCACACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGATACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCC
  5   1   1         - Neu       in                   TNeu127e16.p1cSP6                                                                                                                                                                                                                                              CCGGGACCCTCCCCAGCACTCCGCTCCCCCCGCTGCGCGCCCGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCATCCGCCGCCTGGGGGAGATATGGCGGGGCCTGTGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGGCAAGCGGCTCCGGGCTCATCATGCTATATACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAG
  5   1   1         - TpA                            TTpA066c05.p1kSP6                                                                                                                                                                                                                                               CACCCTCCCCAGCACTCCTGCTCCCCCCTGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGACCCCCAGCTGCACCCCCCGCCGCCTCCTACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTAT
  5   1   1         - Gas6      in                         ANBT1402.5p                                                                                                                                                                                                                                               CGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCC
  5   1   1         - Gas6      in                         ANBT3128.5p                                                                                                                                                                                                                                                  CCCTCCCCCAGCACTCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCNCC
  5   1   1         - Egg       in                   TEgg032j17.p1kSP6                                                                                                                                                                                                                                                   TCCCCCCGCTCCCCCCGCTCACCCCGATCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGC
  5   1   1         - Egg                            TEgg124n13.p1kSP6                                                                                                                                                                                                                                                    CACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGCA
  5   1   1         - Egg                            TEgg135m10.p1kSP6                                                                                                                                                                                                                                                    CACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGA
  5   1   1         - Gas0                                 dad18a12.y1                                                                                                                                                                                                                                                         CGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAAGCGCATGGAGAGGGGGGGGAG
  5   1   1         - Neu       in                   TNeu071o04.p1cSP6                                                                                                                                                                                                                                                          CGATTCGACTTCCCCGGGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGTTTCGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGCTGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCC
  5   1   1         - Neu       in                   TNeu056k03.p1cSP6                                                                                                                                                                                                                                                             CACTCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGA
  5   1   1         - Gas7      in                         XZG24098.5p                                                                                                                                                                                                                                                                 CCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCNCCCCGCCCCCC
  5   1   1         - Gas7      in                         XZG20862.5p                                                                                                                                                                                                                                                                             CTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGACCCCCAGCTGCACCCCCCGCCGCCTCCTACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGC
  5   1   1         - Gas6                                 ANBT2372.5p                                                                                                                                                                                                                                                                                 CCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCTNCC
  5   1   1         - Gas7                                 XZG34541.5p                                                                                                                                                                                                                                                                                    CAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCTCC
  5   1   1         - Gas                            TGas002e17.p1kSP6                                                                                                                                                                                                                                                                                         AGNACCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGC
  5   1   1         - TpA                            TTpA034d22.p1kSP6                                                                                                                                                                                                                                                                                         AGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGACCCCCAGCTGCACCCCCCGCCGCCTCCTACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGACGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTATTATTANGGGGGGGGGGGGG
  5   1   1         - Egg                            TEgg117f01.p1kSP6                                                                                                                                                                                                                                                                                           CGAGAGCCCCCTGGTCAAGCGGCCAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGG
  5   1   1         - Neu                            TNeu047k24.p1kSP6                                                                                                                                                                                                                                                                                                                       CCTTTAGGTCTGGTCCAGCGGGGNANAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCNGCTCCC
  5   1   1         - Gas6      in                          ANBT536.5p                                                                                                                                                                                                                                                                                                                           TATGGTCGGGTCCAGGGGGGATAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCTTGCCATTTA
  5   1   1         - Gas7                                 XZG52590.5p                                                                                                                                                                                                                                                                                                                           ATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGACCCCC
  5   1   1         - Tad5                                 XZT42623.5p                                                                                                                                                                                                                                                                                                                                                            GTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCC
  5   1   1         - Gas                            TGas079f10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                     GCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAGGAGA
  3   1   1         - Egg                             TEgg078l07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                  TGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAAGTGGCCCCTCAGGCGCCCCCTGGNCCTGGCCCCCCGGGTTTCCCCGCCCCCCCNCGGGACCCCCAGNTGCACCCCCCGCNCGCCTCCTACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACNCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCGAAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas       ?                     TGas139k15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                            GGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGACCCCCAGCTGCACCCCCCGCCGCCTCCTACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTTTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCT
  3   1   1         - Gas  5g3  in                    TGas140c21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                            GGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGACCCCCAGCTGCACCCCCCGCCGCCTCCTACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAAATGTTTTTATTACTATAAAGGTACTA
  5   1   1         - Gas7                                 XZG13577.5p                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGGGGGCTCAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGT
  5   1   1       chi Gas7      in                         XZG39549.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGGGGGTGA
  3   1   1         - Neu       in                    TNeu132l07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGACCCCCAGCTGCACCCCCCGCCGCCTCCTACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAGAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas       ?                     TGas142b23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGGCTCAGCATGCTATAGACTACCCGGGATACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCACAAGTTGGCCCCTCAGGCCCCCCCTTGNCCTGCCCCCCCCGGCTCCCCGCCCCCCCCGGGACCCCCAGNNTGCACCCCCCGCCGCCTCCTACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCGAAAAAAAAAAAAAAAAA
  3   1   1         - Gas       ?                     TGas124g07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGACCCCCAGCTGCACCCCCCGCCGCCTCCTACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGA
  3   1   1         - Neu  5g3  in                    TNeu054c22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCCAAATGGCCCCTCAGGCCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCNCCCCGGGACCCCCAGNTGCACCCCCCGCCGCCTCCTACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACNCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTAAAGATCAGAGACTTCATTCAAACTGGAATTTATTGCCCGTTTAGGAATGTTTTTATTACTATAAAGGTACA
  3   1   1         - Gas  5g3  in                    TGas101n24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCNCCCCGGGACCNCCCAGCTGCACCCCCCGCCGCCTCCTACTCANTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAAATGTTTTTATTACTATAAAGGTACTA
  5   1   1       chi Gas7      in                         XZG15969.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCTCAGAGAGAGACATTCCCGGCCATGCACCCTCCCCAGCACTCCGCTCCCCCCGCTCCCCCCGCTCCCCCCAACGAGAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGATACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATC
  3   1   1         - Neu       ?                     TNeu072k10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCTCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCNCCCCCGGGACCCCCAGTTGCACCCCCCGCCGCCTCCTACTCAATACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTA
  3   1   1         - Neu5                                 ANHP2556.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGACCCCCAGTTGCACCCCCCGCCGCCTCCTACTCATTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTACCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTTTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTG
  3   1   1       chi Egg       ?                     TEgg058c20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGAGCCCCCCAAAGTGGCCCTTCAGGCCCCCTTGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGACCCCCAGCTGCACCCCCCGCCGCCTCCTACTCANTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTNGGCAGGANNNNNNGGCCCCCCCCCCCCCCACCCTAGGGTAATCACATGATTAATTAGCAAGCGCAGTATTTCTCATCACTCTTTTAGAGAAAAGGTTGGGGGTTTTTTTATTTTTTCTTTTTTTTTTTTTATAAGTAGCAGTTTGCTCTTTGCCTGCCCGGGGGCCCACGTCACACAGCCAGGCTCCCCGGCAGGAAAGGGCATCCATTGGGCGCACTTTGAAAAGTCTGCTTGTGCTGCTGAGATCCACACGGGGGCGCTGTGCCCGCGGAGTGGATATTTAGGAAGCAGCACTCGTTTGGTACAGTGTCCTTACTGTAAGTGTTCCCTCCGGCGCCGCGCCATGGAGGTTTGTTATATCTTGTTTAATATTTTAATTAATATTATTTGGAGTGAAAGGAGAGGGCTCATGAAAAAAACAGTCATTTTTAGACAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas7      in                         XZG24098.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCCCAAAGGGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGTTCCCCGCCCCCCCGGGACCCCCAGGTGCACCCCCCGCCGCTTCTTACTCAATACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTG
  3   1   1         - Gas       in                    TGas067j06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCAAATTGGGCCCTCAGGCCCCCCTGCCCTGGCCCCCCGGCTCCCCGGGCCCCCGGGATCCCCAGCTGCACCCCCCGCAGCCTCTTAATCAGTTTAACGGGTTGCAGGAGGGATATGGGTAACTGCCGTACCCCTGCCCCCGAGGCCCGGAGCCCTTTTTGCCCTCAATGAGTGACGTTTTGGCGCTTTAGGGCTTTGGATTTTAGGATTACGGGGGGGACCCCGGGGCCCCCCAGCAGGTTCAGTACCAAACACGGGAAGAGGACGGAACCTTGTTTTTTGACCTTTGACCCCTGAGAGTTTGAGGGTTTCCCCCGGACCACCAGGAGGTCCTTGACTCCCCCGCCTTGGGACCTTTCAGGGAATCGGGGGTCCCCCTGTGACAGGTGCATTATGGGATTTTCACCCGTCAGGCCCTGCCCCCCCATAAGACCTTAATGCGGTGATGGGGCTGTACCAAATGGCCTTATGGGGAGGGGGGGAAACACTTAATGACTTTCCGGGTTCAACGGCTCCCCCTCCTGGGAGATATGGGGATTTCATTACTTGACTCCGTTACAATAATTATTAGGGGGGGGGGGGGGGTGACTTCGGACTTTCCAAGAATTGAAGGTTTTTGGGTTATAGGGCAATTTGGGGGGTTTAGTCGCAAACACGGTCCTCCGGATCCTTTTAAATCAGAGACATCATTCAAACTGGAATTTTTTGTGTATTCTAGAAATGTTTTTAAAACTATAAAGGTGCTAGCTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   1         - Neu       in                    TNeu076h08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGACCCCCAGNTGCACCCCCCGCCGCCTCCTACTCANTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCCAGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAGAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas7 5g3  in                         XZG32074.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCGCCCCCCCGGGACCCCCAGCTGCACCCCCCGCCGCCTCCTACTCANTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAAAAAAAAAAAAAAAAGG
  3   1   1         - Gas7 5g3  in                         XZG52192.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGGCCCCCCCGGGACCCCCAGGTGCACCCCCCGCCGCCTCCTACTCATTACAAGGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAACGTTTTTATTACTATAAAGGTACTAGCTGAGAAAGGAAAAAAAAAAGG
  3   1   1         - Gas6      in                         ANBT1402.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCCCCCCGGGACCCCCAGTTGCACCCCCCGCCGCCTCCTACTCANTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTTTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTTTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTG
  3   1   1         - Neu       in                    TNeu055o12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCCAGNTGCACCCCCCGCCGCCTCCTACTCANTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATGGGAGACTTCATTCAAACTGGAATTTATTGTGTTTCCCGGTTTAAAGATTTTATTACTATAAAGGTACTAGCT
  3   1   1         - Neu       in                    TNeu071o04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCCAGGTGCACCCCCCGCCGCCTCTTATTCATTACAAAGGGTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTTTGCCCTCAGTGAGTGACGTGTTGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTTTGACCCCTGTGAGTGCGAGGGTTTTGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTTTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTTGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas7      in                         XZG39549.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGGGGAGATATGGCGGGNCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGCTACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTTTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTCCAGTAATTATTAGGGGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGTTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTG
  5   1   1         - Neu                            TNeu006h12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTCCTACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGNGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTAT
  3   1   1         - Gas       in                    TGas053f12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAGTCAATAAAACGGCTTCCGGGATGGATAGGGGAACATGCCTTATCCCTTGCCCCCCCCCCCCGGAGCCCTTTTTGCCCTCAATGAGTGACGTGTGGGCGCTTTAGGGTTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTTGACGGAACCTCGTTCACTGACTTTTGACCCCTGTGAGTGCGAGGGTCTCGCCAGGACCCCCGGGAGGCGCTTGATTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTTTCCCCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGAGGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTCCAGTAATTATTAGGGGGGGGGGGGGGGTGACTTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATTTCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACCTATAAAGGGTACTAGCTGAAAACCAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1         - Gas       in                   TGas053f12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTCGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCAGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTA
  3   1   1         - Gas6      in                         ANBT3128.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTCATTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCGGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTTTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTG
  3   1   1         - Gas7      in                         XZG40386.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTCATTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTTTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTTTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTCCAGTAATTATTAGGGGGGGGGGGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGG
  3   1   1         - Gas6 5g3  in                          ANBT548.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAATACAACGGCTTCCAGGATGGATAGGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTTTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTTTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTTTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCGCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTG
  3   1   1         - Gas7 PIPE in                         XZG45017.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CANTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTG
  3   1   1         - Egg                             TEgg026e24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTAACCCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAAAAAAAAAAAAAAAAAA
  3   1   1         - Egg       ?                     TEgg026n20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACGGCTTCCAGGATGGATACGGGTACCTGCCCTAACNCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCACGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGTTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAAAAAAAAAAAAAAAAA
  3   1   1         - Neu5      in                         ANHP2895.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAACGGGTTTCCGGAAGGAAAAGGGGTCCTTCCCTTACCCTGCCCCCCCCGCCCGGGAGCCTTTTTGCCCTCAATGAAGGAAGGGTTGGGGCTTTTCGGGTTTGGGCTGTTCGATTTCGGGGGGCCCCGGGGGGCCCCCCCGCCGGTTCCGTTCCCGGCCCTGGAAGGGGGCGGGACCTTGTTCCCTGGCCTTTGACCCCCTTGAATTGGAGGGTTTTGGCCGGGCCCCCCGGGGGGGCTTGACTTCCCCCCGGGGGGGCCTTTCCGGGAAAGGGGGGTTCCCCTTTGACCGGGGCCAGAAGGGATTTTTCCCTGTCCGGGCCCGCCCCCCCCTTGGGCCTTTAAGCCGGGAAGGGGGTGTTCCCAGGGGCCTTTTTGGGGGGGGGGGGAGCCCTCAAAGGCTTTCCTTGTTCAAGGGGTCCCCCCCCCGGCCGGTATGGGGGATTCCTTTCCTGGTTCCGTTTCCGGAATTTTTTGGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTG
  3   1   1         - Gas6      in                          ANBT536.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCT
  3   1   1         - Gas7 5g3  in                         XZG46824.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCCCAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAAAAAAAAAAAAAAAAGG
  5   1   1         - Egg                            TEgg040n24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCCCTCCACGACTTTCCC
  3   1   1         - Gas7      in                         XZG25124.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACGCGTCCGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAG
  3   1   1         - Gas                             TGas117i12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGTACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCGAACAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas7 5g3  in                         XZG21638.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTTCCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTTTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCCCCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTTTCCCCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGGAAAAAAN
  5   1   1         - Gas7      in                         XZG25124.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAGAAAAAAAAAAAAAAAAAAGG
  3   1   1       chi Gas7      in                         XZG15969.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGCACCCCAAGATGCACAACTCGGAGATCAGCCGCCGCCTGGGGGAGATATGGCGGGGCCTGGGGGAGGACGAGCGGAGACCCTTCCGGGAGGAGGCCAAGCGGCTCCGGGCTCAGCATGCTATAGACTACCCGGGATACAAGTACGCGCCCCGCAAGAAGCGCAAGGAGAGGGGGGAGCCCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAAAAAAAAAAAAAAAGG
  3   1   1         - Gas7                                 XZG29230.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTTCCAGACACTGGAAGTGGACGGAACCTTGTTCACTGACCTTTGACCCCTGTGAGTGCGAGGGTTTCGGCAGGACCCCCAGGAGGCGCTTGACTCCCCCGGGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTTTCACCTGTCAGGACCCGCCCCCCCATAGGACCTTAATGCAGTGATGGGGCTGTTCCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTGGATTCCGTTCCCGTAATTTTTAGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTTGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTA
  3   1   1         - Gas0                                 dad36h01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCTCCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTAAATAAAGGTACTAGCTGAAA
  3   1   1         - Gas       in                    TGas067e22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGTTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAAGTGTTTTTATTACTATAAAGGTACTAGCGAAAAAAAAAAAAAAAAA
  3   1   1         - Neu       in                    TNeu056k03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTGTGGTCAGAGACTTCATTAAAACTGGAATTTATTGTCTCGCCTTAGGATGTTTTTATTACTATAAAGGTACTAGCGAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas0                                 dad34f06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCCCGCCCGGAAGCCCTTTCTTGCCCTCAGTAAGTAACGGGTCGGCGTTTTTACGGCTTCGGGCTGGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACATTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCCACCACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGAAAAGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGACAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTT
  3   1   1         - Egg0                                 dad67d11.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCTCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGTTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTAANAAGGTACTAGCTGAAAAAAA
  3   1   1         - Neu       in                    TNeu127e16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCCCCGCCCGGACCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAAAAAAAAAAAAAAAAAA
  5   1   1         - Neu5                                 ANHP1797.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAAAAAACATTTCTAGAAAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCT
  3   1   1         - Gas7      in                         XZG29452.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTTTTTGCCCTCAGTGAGTGACGGGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCCCAGGGGGGCCCCCCAGCAGGTTCAGTTCCAGCCCCTGGAAGGGGGGGGAACCTCGTTCACTGACCTTTGACCCCTGGGAGTGGGAGGGTTTCGGCAGGACCCCCAGGGGGGGCTTGACTCCCCCGCGGGGGGACCTTTCAGGGAATGGGGGGTCCCCCTGTGACAGGGGCATGATGGGATTTTCCCCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGAGGGGGCTGTACCAAGTGGCCTTTTTGGGGGGGGGGGAGGCCCTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTAGGGGGATTTCATTACTTGATTCCGTTCCAGTAATTTTTAGGGGGGGGGGGGGGGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGT
  5   1   1       chi Neu0      out                    NISC_ng21a03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGNGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTNGGGGGGTTTTGTCGCAAACACTGTAGTCCTTTATGTCATTAACCCAGAAGAGGAGGCCTGACATTCACTGGGCAGGACAGCCAGTATTAACAAGCAGACTCATTAACAGCCCCCTCCCTTCCCATAAATATCATACAGATTAATTCATATTCAAGTCC
  3   1   1         - Egg       in                    TEgg032j17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCCTCAGTGAGTGACGTGTCGGCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGTTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAAAAAAAAAAAAAAAAAA
  5  -1   1         - Gas6      in                         ANBT3386.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCTTTACGGCTTCGGACTGTACGATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTTTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCCCCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTTTCCCCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAG
  3   1   1         - Gas6      in                         ANBT1536.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATTACGGGGAGCACAGGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTG
  5   1   1         - Gas8      in                         st108b07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGGGCCCCCCAGCAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGGGG
  3   1   1         - Gas7      in                         XZG47259.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACGCGTCCGGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTTTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTTTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTG
  3   1   1         - HeRe      in                     EC2CAA33AD03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGTGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTACGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGGTTTTCTAGA
  5   1   1         - HeRe      in                     EC2CAA33AD03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGTTCAGTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGTGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTACGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTG
  5   1   1         - Gas7      in                         XZG47259.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTACCAGACACTGGAAGTGGACGGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGGGGGTGACCTCCGACTTTCCTAAAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAAAAACTTCATTCAAACTGGAATTTATTGGGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAAAAAAAAAAAAAAAAAAGG
  3   1   1         - Gas7      in                         XZG42301.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACGCGTCCGAACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTTTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTG
  5   1   1         - Gas7      in                         XZG42301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACCTCGTTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAAACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAAAAAAAAAAAAAAAAAAGG
  5   1   1         - Egg       in                   TEgg005g13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCACTGACCTCTGACCCCTGTGAGTGCGAGGGTCTCGGCAGGACCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCGCTGTGACAGGTGCATGATGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAG
  3   1   1         - Egg       in                    TEgg005g13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCACTGACCTTTGACCCCTGGGAGTGGGAGGGTTTTGGCAGGCCCCCCAGGAGGGGCTTGACTCCCCCCCGGGGGGCCCTTTCAGGGAAAGGGGGGTCCCCCTGTGACAGGGGCAAAATGGGATTTTCCCCTGTCAGGACCTCCCCCCCCAAAGGCCCTTAAACCAGTGATGGGGGTGTACCAAGTGGCCTTATTGGGAGGGGGGGAGGCCCTCAAAGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTAGGGGGATTTCATTACTTGATTCCGTTACAAAAATTATTAGGGGGGGGGGGGGGACGTCGGACTTTCCTAAAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTTTTGCAAACACTTTTTTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTTTAAAAAAGTTTTTATTTCTATAAAGGTACTAGCTGGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   1         - Egg  5g3  in                    TEgg076j24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACCAGGAGGCGCTTGACTCCCCCGCGTGGGGACCTTTCAGGGAATGGGGGGTCCCCCTGTTACAGGTGCATGATGGGATTCTCACCTGTCAGGGCCTGCCCCCGCATAGGACCTTAATGCATTGATGGGGCGGTTCCAAGTGGCCTTATTTGGAGGGGGGGAAGCACTCAATGACTTTCCTCGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTCATTCCGCTACAGTAATTATTAGGGGGGGGGGGGGGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGCGTTTTTAGGGCAATTTGGGGGGTTTTGTAGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAATCCGGAATTTATTGTGTTTTTCTAGAAACGGTTTTATTACCATAAGGGGACTAGTTGTCAAAAAACCCAAAAAAAAGAGAAAAAAA
  3   1   1         - Egg  5g3  in                    TEgg018f24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCCGCGTGGGGGCCTTTCAGGGAACGGGGGGTCCCGCCGTGACAGGTGCAAGATGGGATTTTCAACCTGTCAGGATCCTGCCCCCGCATAGGGCCTTAATGCAGTGATGGGGCTGTGCCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAAAGACTTTCCTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAAAAGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACCGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTTCTATAAAGGTACTAGCGGGAGCAAAAAAAAAAAAAAAAAAA
  5   1   1       chi Gas                            TGas045g16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCCCCCCGCTCCCCCCGCTCCCCCCAACGAAAGCCCCCTGGTCAAGCGGCCCATGAACGCCTTTATGGTCTGGTCCAGCGGGGAGAGAAAGCGCATGTCCGCCCGGCACCCCAAGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGTTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTG
  3   1   1         - Gas7      in                         XZG20862.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCCATGAAGGGATTTTCCCCTGTCAGGACCTGCCCCCGCATAGGGCCTTAAAGCAGTGAGGGGGCGGTCCCAAGGGGCCTTTTTGGGGGGGGGGGGGGCCCTCAAGGACTTTCCTTGTACAAGGGCCCCCCCCCCTGGCAGCTAGGGGGGTTTCCTTTCTTGATTCCGTTCCGGTAATTTTTGGGGGGGGGGGGGGGGCGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATTT
  3   1   1         - Te3       in                        CAAM15512.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTG
  5   1   1         - Te3       in                        CAAM15512.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGATTCTCACCTGTCAGGACCTGCCCCCGCATAGGACCTTAATGCAGTGATGGGGCTGTACCAAGTGGCCTTATTGGGAGGGGGGGATGCACTCAATGACTTTCCTTGTACAAGGGCTCCCCCTCCTGGCAGCTATGGGGATTTCATTACTTGATTCCGTTACAGTAATTATTAGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAAAAAAAAAAAAAAAAAAA
  5  -1   1       chi Neu                            TNeu071m11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCCAAAGTGGCCCCTCAGGCCCCCCTGCCCTGCCCCCCCGGCTCCCCGCCCCCCCGGGACCCCCAGTGCACCCCCCGCCGCCTCCTACTCACTACAACGGCTTCCAGGATGGATACGGGTACCTGCCCTACCCCTGCCCCCCCCGCCCGGAGCCCTTTCTGCCCTCAGTGAGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAATTTATTGTGTTTTTCTAGAAATGTTTTTATTACTATAAAGGTACTAGCTGAAAAAAAAAAAAAAAAAAAGC
  3   1   1         - Gas8      in                         st108b07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATTTTTNGGGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACTGGAA
  3   1   1         - Gas       out                   TGas072o06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGGGGGGGGGGGTGACGTCGGACTTTCCTAGAATTGAAGGTTTTTGTGTTTTTAGGGCAATTTGGGGGGTTTTGTCGCAAACACTGTCGTCCGGATCCTTTTATATCAGAGACTTCATTCAAACNTGGAATTTATTGTGTTTTTCTAGAAATNGTTTTTATTACTATAAAGGTANCTAGCTGAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)